BIO 211 FINAL

Regulation of gene expression b. Which one of the levels listed in part (a) is most commonly used in bacteria? Briefly explain one example.

- Bacteria primarily regulate genes at the level of transcription. - In bacteria cells they have a lac operon which needs to be controlled depending on how much lactose is in the cell. The lac repressor binds to the operator and halts production of enzymes needed to metabolize lactose as a carbon course when there is no lactose in the cell.

18. Do mutations occur in a random way (by chance), or in order to confer a selective advantage to an organism? What some environmental factors that induce mutations? During which cellular process do most mutations arise? -induced mutations: chemicals

- Base analogs cause transitions --> 5BU (analog of T) normally pairs with A, but can mispair with G - Alkylating agents cause transitions --> Chemicals that add methyl or ethyl groups to bases (EX: mustard gas) - Hydroxylamine causes transitions --> Adds -OH group to cytosine (C) - Oxidative radicals cause transversions --> G converted to analog and can mispair with A - Intercalating agents cause frameshift mutations --> Sandwich themselves between bases EX: Benzopyrene (cigarette smoke), charbroiled food

17. DNA Mutations: explain the difference between the many types of mutations we studied (missense, nonsense, silent, frameshift, loss-of-function, gain-of-function), and how each affects amino acids. - Transition and transversion

- Base substitutions alter a single nucleotide in the DNA 1. Transition: purine replaced by a purine or pyrimidine with a pyrimidine 2. Transversion: purine replaced by pyrimidine or pyrimidine replaced by purine

1. Cancer: what are all of the factors associated with promoting a cancerous state? (See take-home points in the Day 19 note-taking guide).

- Cancer is fundamentally a genetic disease, although few cancers are actually inherited. - Multiple mutations are typically required to cause cancer. - Oncogenes are dominant-acting mutated copies of normal genes (proto-oncogenes) that stimulate cell division. - Tumor suppressor genes normally inhibit cell division; recessive mutations contribute to cancer. - In addition to mutations in proto-oncogenes and tumor suppressor genes, cancer is associated with genomic instability, DNA repair failure, Chromatin modification, and Environmental factors. - Mutations in genes that regulate the cell cycle are often involved in cancer: know roles of Rb, E2F, Ras, and p53.

14. Epigenetics: know the definition of epigenetics and the types of regulators that affect epigenetic phenotypes. Does epigenetic regulation involve changing the DNA sequence? Key terminology: DNA methylation, X-chromosome inactivation.

- Epigenetics means the inheritance of a phenotype resulting from chromatin changes, without differences in DNA sequence - Many epigenetic changes are stable, persisting across cell divisions or even generations - but can also change - Epigenetic alterations can be influenced by environmental factors - Methylation is the best- understood mechanism of epigenetic change - Lyon hypothesis states that within each XX cell, one of the two X chromosomes is randomly inactivated.

20. List the social impacts of the human genome project.

- Human genome project spurred rapid development of DNA sequencing technology - Now possible to sequence entire human genome in a few hours - Genome information may be beneficial for information about genetic disease, personalized medicine, questions about ancestry, etc. - Potential concerns: - Privacy - Insurance companies - Patenting of genes - Ethics of embryo screening - Sequencing technology has also allowed sequencing of other organisms, including microbiome

10. Transcription: what are the similarities and key differences between transcription in bacteria and eukaryotes? Key terminology: promoter, sigma factor, transcription factors, rho termination protein, RNA polymerases (how many in each?), polarity (5' and 3' ends of nucleic acids). Transcription Process in Bacteria pt 2

- In bacterial promoters, consensus sequences are found upstream of the start site, approx. at positions -10 and -35 - The -10 consensus sequence, sometimes called the Pribnow box, includes the sequence TATAAT - The -35 consensus sequence includes the sequence TTGACA

19. Cancer: what are all of the factors associated with promoting a cancerous state? (See take-home points in the Day 19 note-taking guide). - Rb and E2F

- Rb, a tumor suppressor gene regulates G1/S • RB normally prevents DNA replication (S phase) • When cyclin/CDK is active, allows passage through G1/S checkpoint

22. Describe each of Mendel's main principles (dominance, segregation, and independent assortment). Explain how meiotic processes lead to two of those principles. Key terminology: homologous and non-homologous chromosomes.

- Reveals principle of segregation --> each diploid individual possesses two alleles at a locus - these two alleles separate when gametes are formed, one allele going into each gamete - And the concept of dominance --> When two different alleles are present in a genotype, only one allele may be expressed in the phenotype --> The dominant allele is the allele that is expressed, and the recessive allele is the allele that is not expressed - Independent assortment: alleles at different loci separate independently (will discuss next class) - Dominant: protein product is produced - Recessive: protein product is not produced (loss of-function mutation)

10. Transcription: what are the similarities and key differences between transcription in bacteria and eukaryotes? Key terminology: promoter, sigma factor, transcription factors, rho termination protein, RNA polymerases (how many in each?), polarity (5' and 3' ends of nucleic acids). Eukaryotic Transcription (introns and exons)

- The coding sequences of many eukaryotic genes are disrupted by non-coding introns - Exons: coding regions - remain in RNA - Introns: non-coding intervening sequences - spliced out of RNA - All introns and exons are initially transcribed into RNA, but during or after transcription, the introns are removed and the exons are joined to yield a mature RNA

10. Transcription: what are the similarities and key differences between transcription in bacteria and eukaryotes? Key terminology: promoter, sigma factor, transcription factors, rho termination protein, RNA polymerases (how many in each?), polarity (5' and 3' ends of nucleic acids). How is Eukaryotic Transcription Different from Bacterial Transcription?

- Transcription in eukaryotes occurs in the nucleus and is not coupled to translation - Eukaryotic transcription requires chromatin remodeling - Eukaryotes must modify histone proteins to make the DNA accessible for transcription - Initiation requires general transcription factors (not the sigma factor of RNA polymerase) binding the promoter - Eukaryotic mRNAs require processing to produce mature mRNAs - Eukaryotes possess three forms of RNA polymerase, each of which transcribes different types of genes - Where does the TATA box get its name? - TATA box in eukaryotes is similar to the -10 region/Prinbow box in prokaryotes: the site where a protein binds to recruit RNA polymerase - Prokaryotes: the protein is s factor - Eukaryotes: the protein is TBP (TATA binding Protein) within TFIID

5. Replication: what are the similarities and key differences between replication in bacteria, eukaryotes, and in vitro (PCR)? Key terminology: primer, leading and lagging strand, nucleosome creation, helicase, gyrase, DNA polymerase (specific names in E. coli and PCR), origin of replication. Eukaryotic replication-

- Unwinding in eukaryotes is similar to process in bacteria - Helicases, single-strand binding proteins and topoisomerases (similar to gyrase) from eukaryotes work in much the same way as in bacteria - Eukaryotic DNA Polymerases are significantly different than those from bacteria - Most nuclear DNA synthesis is done by DNA polymerase alpha (a), DNA polymerase delta (d), and DNA polymerase epsilon (e) - Eukaryotes face the end-replication problem so they have telomerase to prevent shortening

12. The Genetic Code: Know the key characteristics of the genetic code and how to use it to determine amino acids from mRNA sequence. Key terminology: degenerate, universal, non-overlapping, unambiguous, codon, amino acid.

- Why do we say the genetic code is degenerate? Because there are 61 sense codons and only 20 different amino acids commonly found in proteins, the code contains more information than is needed to specify the amino acids and thus is said to be degenerate. - the genetic code was assumed to be universal, meaning that each codon specifies the same amino acid in all organisms - What does non-overlapping mean for the genetic code? Refers to the fact that each nucleotide is part of only one codon and encodes only one amino acid in a protein - The set of nucleotides that encode a single amino acid—the basic unit of the genetic code—is called a codon - a triplet code requiring three nucleotides per codon would be the most efficient way to encode all 20 amino acids.

23. Be able to deduce the mode of inheritance for a trait by examining a pedigree, including X-linked dominant/recessive, Y-linked, autosomal dominant/recessive, and mitochondrial. - autosomal dominant

- affect XX & XY individuals with equal frequency - do NOT skip generations - Every person with a dominant trait must have inherited the allele from at least one parent (this is why autosomal dominant traits do not skip generations) - Exceptions to this rule arise when people acquire the trait as a result of a new mutation or when the trait has incomplete penetrance - If an autosomal dominant allele is rare, most people displaying the trait are heterozygous

23. Be able to deduce the mode of inheritance for a trait by examining a pedigree, including X-linked dominant/recessive, Y-linked, autosomal dominant/recessive, and mitochondrial. - X-linked dominant

- affect both XX and XY, although often appear more frequently in XX - do NOT skip generations - Each person with X-linked dominant trait has affected parent - How to distinguish between X-linked and autosomal dominant: XY: in X-linked dominant, XY person inherits trait only from XX parent (never XY), however in autosomal dominant, XY can inherit trait from XY XX: can receive an X-linked dominant trait from either parent - Affected XY pass the trait to all their XX and none of their XY kids (e.g. I-1) - Affected XX (if heterozygous) pass trait to ~ ½ their XY & ~ ½ their XX kids (e.g. as in children of III-6)

23. Be able to deduce the mode of inheritance for a trait by examining a pedigree, including X-linked dominant/recessive, Y-linked, autosomal dominant/recessive, and mitochondrial. - Y-linked

- affect only XY people - are passed from XY parent to all XY kids - do NOT skip generations - Because each XY person has a single Y chromosome, there is only one copy of each Y-linked allele: therefore, Y-linked traits are neither dominant nor recessive

23. Be able to deduce the mode of inheritance for a trait by examining a pedigree, including X-linked dominant/recessive, Y-linked, autosomal dominant/recessive, and mitochondrial. - X-linked recessive

- appear more often in XY than XX individuals (need only 1 copy to display trait) - because XY get X from XX, often passed from unaffected XX --> affected XY --> unaffected XX (tends to skip generations) - are not passed from XY to XY (child inherits Y from parent in this case) - When a XX person is heterozygous, ~½ of XY children are affected and ½ of XX children will be unaffected carriers - Obligate carriers are are individuals whose heterozygous genotype can be definitively determined from a pedigree (e.g. XX individuals I-2, II-2, III-7) - An XX person displaying an X-linked recessive trait must be homozygous all of their XY kids will display the trait

23. Be able to deduce the mode of inheritance for a trait by examining a pedigree, including X-linked dominant/recessive, Y-linked, autosomal dominant/recessive, and mitochondrial. - autosomal recessive

- appear with equal frequency in XX & XY individuals \ - appear only when a person inherits two alleles for the trait, one from each parent - Most parents of affected offspring are heterozygous and unaffected; consequently, the trait seems to skip generations - When both parents are heterozygous, ~¼ offspring are expected to express the trait (will not be obvious unless the family is large) - In the rare event that both parents are affected by an autosomal recessive trait, all the offspring will be affected

25. Explain the relationship between gene distance and crossing over. Key terminology: recombination frequency, map distance, crossing over, % recombination. - crossing over

- genes occasionally switch from one homologous chromosome to the other through process of crossing over - Crossing over involves the exchange of parts of chromosome arms between homologous chromosomes by breakage and reunion

Gene transfer in bacteria a. Describe in some detail (at least 3-4 sentences) each of the three mechanisms by which bacteria can exchange genetic material

1. Conjugation involves a physical transfer of DNA from donor to recipient cell = 2 bacterial cells involved 2. Transformation takes place when a bacterium takes up DNA from the medium in which it is growing 3. Transduction requires a bacterial virus (bacteriophage) to carry DNA from one bacterium to another

13. How is gene expression regulated in eukaryotes? bacteria? At what level(s) does gene expression most often occur in each? - eukaryotes post transcriptionally

3 processes that affect gene regulation by altering chromatin structure: 1. Chromatin remodeling 2. Modification of histone proteins 3. DNA methylation For eukaryotic genes to be transcribed... - DNA that is wrapped tightly around histones (chromatin) needs to become more accessible to the transcription machinery - (+) charged tail domain of histones interact with (-) charged DNA - Histone tails can be modified by the addition or removal of: - Phosphate groups (P) - Methyl groups (Me)* - Acetyl groups (Ac)* - Others, such as ubiquitination - DNA methylation most common on C bases adjacent to G - Written as CpG, where p represents the phosphate group in DNA - Regions with many CpG sequences are called CpG islands

Central Dogma a. From the DNA molecule below transcribe the resulting RNA molecule. Assume transcription starts with the first nucleotide. (Sequence provided on exam will be different from this sequence) 5'ATGACGGACAGTTACCCCAATTAGCGGAAG 3' (non-template strand) 3'TACTGCCTGTCAATGGGGTTAATCGCCTTC 5' (template strand)

5' AUG ACG GAC AGU UAC CCC AAU UAG CGG AAG 3'

11. Be able to write the RNA sequence (with correct 5'/3' notation) after transcription if given a DNA template strand (or vice versa, write a DNA template with 5'/3' notation if given an RNA molecule). In what direction does new synthesis occur?

5-->3

8. Describe how agarose gel electrophoresis works (used in lab to view DNA) - what determines how far the DNA will travel in the gel?

After being cut (also called digested) with restriction enzymes, DNA fragments can be separated based on size by agarose gel electrophoresis - Small fragments travel faster and will be at the bottom of the gel- Large fragments travel slower and will be at the top of the gel Separates (or resolves) DNA fragments-DNA dye visualizes all DNA

13. How is gene expression regulated in eukaryotes? bacteria? At what level(s) does gene expression most often occur in each? - bacteria

Bacteria primarily regulate genes at the level of transcription - Operon: a series of gene coding regions (usually products with related functions) under the control of a single gene regulatory unit - Genes coding for enzymes with regulatory functions are organized in clusters, and transcription is under control of a single regulatory region - Regulatory regions are almost always located upstream of the gene cluster they control and are cis-acting - Molecules that bind these cis-acting sites are called trans-acting elements

5. Replication: what are the similarities and key differences between replication in bacteria, eukaryotes, and in vitro (PCR)? Key terminology: primer, leading and lagging strand, nucleosome creation, helicase, gyrase, DNA polymerase (specific names in E. coli and PCR), origin of replication. - Bacteria replication

Bacteria replication is semi- conservative _D_ DNA gyrase _B_ DNA helicase _H_ DNA ligase _F_ DNA polymerase III _G_ DNA polymerase I _E_ DNA primase _A_ Initiator protein _C_ Single-stranded-binding proteins

27. Describe the CRISPR-Cas9 system. What is the function of CRISPR in bacterial cells?

Clustered regularly interspaced short palindromic repeats • Bacterial immune system • An RNA molecule guides the Cas9 enzyme to the complementary strand of DNA • Cas9 cleaves the DNA, causing a double-stranded break • Scientists can provide their own RNA molecule, directing Cas9 anywhere in the genome • Scientists can also supply a repair template to introduce changes (mutations) into the DNA

3. What is the Central Dogma and which processes are involved?

DNA --> RNA --> protein Genetic information is first transcribed from DNA to RNA, and then RNA is translated to amino acid sequence of a protein transcription and translation are involved - Transcription- All cellular RNAs are synthesized from DNA templates through the process of transcription - Translation- from RNA's to proteins

Avery, MacLeod, and McCarty experiment 4. The results of the experiment and the interpretation of the results

DNA is the genetic material in bacteria because DNase killed the DNA in the bacteria and this was the only flask that with no type IIIS virulent bacteria and only IIR bacteria.

13. How is gene expression regulated in eukaryotes? bacteria? At what level(s) does gene expression most often occur in each? - eukaryotes transcription (enhancer and insulator)

Enhancers affect the transcription of very distant genes - Can be 100s to millions of base pairs away - DNA can loop out, so transcriptional regulator proteins can directly interact with basal transcription apparatus (at core promoter) - Effect of enhancers is limited by insulators (aka boundary elements) - Insulators block effects of enhancers in position-dependent manner - If they are between an enhancer and a promoter: blocks enhancer - If they are not between enhancer & promoter: no effect

Regulation of gene expression Transcriptional regulation-

General transcription factors (TFs) are a part of the basal transcription apparatus. It binds to the core promoter and allows for minimal levels of transcription. Transcriptional regulatory proteins bind to regulatory promoter and are needed for normal/higher levels of transcription. Some regulatory proteins are activators and increase transcription, while others are repressors and lower transcription rates or do not allow transcription to occur at all.

18. Do mutations occur in a random way (by chance), or in order to confer a selective advantage to an organism? What some environmental factors that induce mutations? During which cellular process do most mutations arise? -induced mutations: radiation

High-energy rays (X-rays, gamma rays, cosmic rays) penetrate tissues and damage DNA --> called ionizing radiation - Change stable molecules into free radicals and reactive ions --> these alter nitrogenous bases and break phosphodiester bonds in DNA - Often cause double-stranded breaks in DNA - Ultraviolet (UV) light has less energy than ionizing radiation, but is still mutagenic --> cause pyrimidine dimers - Most frequently involves 2 thymines (thymine dimer) - Dimers distort DNA and block replication - If replication blocked, cell division stops and cells die - UV light kills bacteria - is an effective sterilizing agent - SOS response allows cell division to continue- but keeps mutations - KEY POINT: These mutations occur during Replication

Gene transfer in bacteria a. You grow some his- bacteria and some leu- bacteria together in a flask and find that you now get some colonies growing on minimal medium. Design a set of experiments that would tell you which of the three mechanisms was operating. Include any controls that would help you have more confidence in your results.

I would first put the bacterial strains separately on minimal media as a negative control. I will then put the two stains separately on complete media so I know the strains are not dead. I will then put two separate strains of DNA in a u-shaped tube separated by a filter. The holes will be small enough to block conjugation, but big enough to still allow transformation and transduction to occur. I will then place the bacteria in the U-shaped tube on minimal media and if colonies grow, I would conclude that conjugation was not one of the mechanisms. I will then run the same experiment but add DNase to both sides of the tube. If either of the sides grew on minimal media then I would I would rule out transformation because the DNase would kill any of the DNA in the environment. This would leave me with transduction. If I were to run an experiment to rule out transduction I would make the holes in the filter small enough to so phage cannot fit through, but still allow DNA to fit through the hole.

Meiosis c. What are the two processes discussed in class that generate genetic variation? At what stage of meiosis does each process occur?

Independent assortment- anaphase I after their random alignment in metaphase I Crossing over- occurs in Prophase I of Meiosis I

16. Chromosome mutations: describe the four types of chromosome rearrangements and which type most often leads to the evolution of new gene families (ex. globin gene family). -inversions

Inversions: no gain or loss of genetic material, but may have position effects (gene moved to heterochromatin) or gene may break in half.

16. Chromosome mutations: describe the four types of chromosome rearrangements and which type most often leads to the evolution of new gene families (ex. globin gene family). -deletion and duplication

KEY POINT: Duplicated chromosome segments may play a role in the evolution of new gene families

Central Dogma d. Translate the RNA molecule into a protein. (Genetic code will be given). 5' AUG ACG GAC AGU UAC CCC AAU UAG CGG AAG 3'

Met- Thr- Asp- Ser- Tyr- Pro- Asn- stop

18. Do mutations occur in a random way (by chance), or in order to confer a selective advantage to an organism? What some environmental factors that induce mutations? During which cellular process do most mutations arise?

Mutations occur my chance Classifying Mutations by Cause - Spontaneous mutations happen naturally and randomly and are usually linked to normal biological or chemical processes in the organism - Replication errors (tautomeric shifts, wobble base-pairing, strand slippage) - Spontaneous chemical changes (depurination, deamination) - Rates of spontaneous mutations vary in different organisms - Induced mutations result from the influence of an extraneous factor, either natural or artificial - Two major types of inducer - Chemicals - Radiation

Avery, MacLeod, and McCarty experiment 2. Describe the positive and negative controls that were included in this experiment, if any

No controls are shown.

2. Is the genetic material DNA in all cases? What is an exception?

RNA is the genetic material in Tobacco Mosaic Virus

19. Cancer: what are all of the factors associated with promoting a cancerous state? (See take-home points in the Day 19 note-taking guide). - Ras

Ras is a proto-oncogene

15. Sex determination: explain how sex is determined in mammals (including the key gene) and how sex is determined in fruit flies. - humans

SRY gene on the Y chromosome was identified as the gene that codes for TDF: - SRY is translocated to X in rare XX males. - SRY is absent from Y in rare XY females. The X chromosome has many more genes than the Y chromosome • Shouldn't XX mammals produce twice the amount of X-linked gene products (proteins) as XY mammals? NO, because XX mammals "compensate" by inactivating one of their X chromosomes to make a single "dosage" of X-linked genes. KEY point: expression of most, but not all, genes is repressed a. Dosage compensation in mammals • How many Barr bodies do you expect in: i. An XXY individual ___1_ ii. An XXXX individual __3_ iii. An XO individual ___0_____ • If an XX individual has one X inactivated, then why does Turner syndrome (XO) cause a phenotype? We now know that in XX individuals, only about 75% of genes on the "inactivated" X chromosome have suppressed expression. Therefore, people with Turner syndrome are missing the expression of those special genes, that are not inactivated in XX females • Similarly, why do XXY individuals have a phenotype? Overexpression of the genes that were not inactivated on "inactive" X

Cancer c. Describe a specific example (from class) of a tumor suppressor gene and an oncogene, and explain how the normal form of each gene changes to contribute to cancer (is the mutation loss-of-function or gain-of-function, and what is the effect of that mutation on protein and on the pathway?).

The Rb gene is a tumor suppressor that halts the cell cycle when DNA is damaged. When Rb is mutated, DNA-damaged cells are not arrested in G1 and DNA repair does not take place. Damaged cells do not undergo apoptosis and remain in the body. This failure to arrest DNA-damaged cells will be repeated in subsequent cell cycles permitting other mutations to accumulate, which leads to tumor formation and cancer. (loss of function mutation) E2F is a protooncogene that binds to DNA and stimulates the transcription of genes required for DNA replication. When the E2F is mutated, it becomes an oncogene and drives passage through checkpoints under any conditions. (gain of function)

Cancer b. Describe the relationship between cancer and environmental mutagens, including two specific examples of environmental mutagens.

The baseline rate of cancer usually arises do to errors in replication or background chemical changes. Cancer that occurs due to environmental agents is above baseline rate because carcinogens promote mutations. One example of an environmental mutagen is a healthy individual who gets too much exposure to sun and gets a thymine dimer mutation caused by UV radiation. Another example is a little girl who was exposed to Ionization radiation in the Soviet Union and gets thyroid cancer.

25. Explain the relationship between gene distance and crossing over. Key terminology: recombination frequency, map distance, crossing over, % recombination. - genetic recombination

The exchange of material between between non-sister chromatids during meiosis is the basis of genetic recombination

25. Explain the relationship between gene distance and crossing over. Key terminology: recombination frequency, map distance, crossing over, % recombination. - genetic recombination frequency

The percentage of recombinant progeny produced in a cross is called the recombination frequency (or rate of recombination), which is calculated as follows: --> One map unit (mu) equals a 1% recombination rate

1. What is the relationship between which cells contain genes (the DNA), and which cells express genes (i.e. where RNA or protein is made)? Put another way: Do you find the same DNA in all cells? Do you find the same RNA or protein in all cells?

The same DNA is all the cells, but the same RNA and protein is not in all of the cells because not all of the DNA is being transcribed in each cell. gene regulation- While all cells possess all of the DNA, containing all of the genes, they do not express every gene

Central Dogma b. In what part of the cell is this RNA produced in bacteria? In eukaryotes?

Transcription in eukaryotes occurs in the nucleus and is not coupled to translation. In Bacteria cells transcription and translation occur simultaneously in the cytoplasm.

10. Transcription: what are the similarities and key differences between transcription in bacteria and eukaryotes? Key terminology: promoter, sigma factor, transcription factors, rho termination protein, RNA polymerases (how many in each?), polarity (5' and 3' ends of nucleic acids). Transcription Process in Bacteria

Transcription is divided into three stages: 1. Initiation: • Sigma factor recognizes the promoter • Core RNA polymerase binds to sigma factor to form the holoenzyme • Holoenzyme unwinds DNA and begins synthesis: no primer needed 2. Elongation: • DNA is threaded through RNA polymerase and the polymerase unwinds the DNA and adds new nucleotides, one at a time, to the 3′ end of the growing RNA strand • Sigma factor is released once holoenzyme moves past transcription start site 3. Termination: • the recognition of the end of the transcription unit and the separation of the RNA molecule from the DNA template

15. Sex determination: explain how sex is determined in mammals (including the key gene) and how sex is determined in fruit flies. - flies

Use the rules you wrote down to determine the sex of these flies: • A fruitfly is found that has three sex chromosomes (XXY) and three of each autosome. The sex of this fruitfly is _intersex____ because __ratio is 2/3 (between 0.5 and 1.0)______. • A different fruitfly has three sex chromosomes (XXX) and two sets of autosomes. The sex of this fruitfly is ____metafemale______ because _ratio is 1.5 (larger than 1.0)_________.

Cancer a. Although cancer is not usually inherited in a Mendelian way in families, it is said to be a genetic disease. Explain why cancer can be considered to be a genetic disease.

Usually one mutant allele of a cancer- causing gene is inherited which predisposes people to cancer. The likelihood that cancer will develop depends on the particular mutant allele, mutations on other genes, and environmental factors.

7. Know the basic biology of bacteriophages, the viruses that infect bacteria, including the main aspects of their life cycle and how they exchange genetic information. Key terminology: lytic, lysogenic/lysogeny.

Viruses that infect bacteria are called bacteriophages, or phages for short • Have 2 alternative life cycles: lytic cycle and lysogenic cycle • Lytic cycle ends with bacteria rupturing open, releasing newly synthesized phage to infect other cells • Lysogenic cycle involves the phage DNA integrating into the bacterial chromosome where it remains as an inactive prophage (prophage can be prompted to dissociate and trigger lytic cycle) • The infection of bacteria by phage can lead to the transduction of bacterial genes from one cell to another, via the phage

Avery, MacLeod, and McCarty experiment 5. State what would have been observed for each of the 3 treatments if protein were the genetic material.

We would have observed no IIIS bacteria in the flask with protease added and only IIR bacteria.

25. Explain the relationship between gene distance and crossing over. Key terminology: recombination frequency, map distance, crossing over, % recombination. - activity example

a. Consider 2 autosomal genes a and b that are recessive to their respective dominant alleles A and B. Two parents are crossed: AABB and aabb. What are the possible gametes that will be produced from the resulting heterozygote (AaBb)? In what ratios? i. Assume a and b are located on separate autosomes (not linked) A. 50% AB, 50% ab B. 40% AB, 40% ab, 10% Ab, 10% aB C. 10% AB, 10% ab, 40% Ab, 40% aB D. 25% AB 25% ab 25% Ab 25% aB ii. Assume a and b are completely linked (on the same autosome but no crossing over occurs) A. 50% AB, 50% ab B. 40% AB, 40% ab, 10% Ab, 10% aB C. 10% AB, 10% ab, 40% Ab, 40% aB D. 25% AB 25% ab 25% Ab 25% aB iii. Assume a and b are linked on the same autosome and are 20 map units apart A. 50% AB, 50% ab B. 40% AB, 40% ab, 10% Ab, 10% aB C. 10% AB, 10% ab, 40% Ab, 40% aB D. 25% AB 25% ab 25% Ab 25% aB

20. List the social impacts of the human genome project. - activity

a. Whole genome sequencing of individuals. A. What are possible advantages to having your whole genome sequenced? - Information that could help protect against disease, target use of pharmaceutical, learn about ancestry B. What are possible disadvantages? - Learn about a disease that there is no way to protect against, privacy, more difficulty with insurance, discrimination by employers, ancestry information might be difficult

16. Chromosome mutations: describe the four types of chromosome rearrangements and which type most often leads to the evolution of new gene families (ex. globin gene family). - aneuploidy and polyploidy

aneuploidy- causes down syndrome (addition of an autosome) polyploidy- very common in plants a. A species has 2n = 16 chromosomes. How many chromosomes will be found per somatic cell in each of the following mutants in this species? - monosomatic- 15 - autotriploid- 24 - trisomic -17 - autotetraploid

4. Describe solutions to DNA packaging within cells: how is bacterial DNA packaged as compared/contrasted to eukaryotic DNA? Know key terminology: chromatin, nucleosomes, supercoiling, histones. - eukaryotic packaging

eukaryotic dna needs extensive folding and packaging to fit inside the nucleus. DNA is made into a chromatin which is a complex of DNA and proteins (usually histones). Histones contain positively charged amino acids which allows them to bind to the negatively charged DNA. A nucleosome is DNA wrapped 2 times around an octamer of eight histone proteins which looks like a linear array of 'beads on a string'.

24. Epistasis: be able to use the Branch diagram method to determine blood type genotypic ratios and phenotypic ratios in offspring using parental information for the H/h locus and the IA/IB/i locus.

f) Based on her parents' and sons' ABO blood groups, determine Mary's ABO and H genotype. - Mary passed the IB allele to her two sons, so she is likely I Bi. She could also be IAI B. She can't be IBI B because her mother doesn't have an IB allele. Looking at her parents' blood types, she must have gotten the IB from her father and the i (or the IA) from her mother. She inherited a copy of the h allele from both parents. She is likely hh IBi or hh IAI B. g) After you've determined Mary's genotype, determine her sons' ABO and H genotypes. - If Mary is hh IBi (or hh IAI B), son 1 must be Hh IBi and son 2 must be Hh IBI A.

13. How is gene expression regulated in eukaryotes? bacteria? At what level(s) does gene expression most often occur in each? - eukaryotes transcription

general transcription factors (TFs) are part of the the basal transcription apparatus - binds at core promoter - minimal levels of transcription. - Transcriptional regulator proteins are needed for "normal"/higher levels of transcription - - Bind to regulatory promoter (upstream of the core promoter) - Bind to enhancers (may be located far away) - Some regulator proteins are activators (↑ transcription) others are repressors (↓ transcription)

23. Be able to deduce the mode of inheritance for a trait by examining a pedigree, including X-linked dominant/recessive, Y-linked, autosomal dominant/recessive, and mitochondrial. - mitochondrial

is passed only from affected XX to both their XY and their XX offspring; when XY parents are affected, none of their children have the trait (as seen in the children of II-2 and III-6).

4. Describe solutions to DNA packaging within cells: how is bacterial DNA packaged as compared/contrasted to eukaryotic DNA? Know key terminology: chromatin, nucleosomes, supercoiling, histones. -bacteria packaging

most bacterial DNA is condensed through supercoiling. Bacteria DNA is not associated with histones, but it is associated with proteins. - most bacteria DNA negatively supercoil - bacteria and eukaryotes supercoil their DNA

Gene transfer in bacteria b. State whether cell-cell contact is required for each mechanism

only cell to cell contact is required for conjugation.

19. Cancer: what are all of the factors associated with promoting a cancerous state? (See take-home points in the Day 19 note-taking guide). - P53

p53, a tumor suppressor gene • The "Last Gatekeeper" gene (aka Guardian of the Genome) • 2 possible responses to DNA damage: 1. Acts as a Transcription Factor to activate expression of p21, which inhibits CDK/G1 cyclins to halt the cell cycle; then activates DNA repair. 2. Triggers apoptosis (programmed cell death) if damage can't be repaired.

Regulation of gene expression Post-transcriptional regulation-

siRNAs silence gene expression post- transcriptionally by cleaving the mRNA and degrading it. Net effect: no protein made

Regulation of gene expression Chromatin structure-

· DNA that is wrapped tightly around histones needs to become more accessible to the transcription machinery. Proteins called chromatin remodeling complexes alter chromatin structure without altering histones directly. (+) charged tail domain of histones interact with (-) charged DNA - Histone tails can be modified by the addition or removal of: - Phosphate groups (P) - Methyl groups (Me)* (inhibit gene expression) - Acetyl groups (Ac)* (promotes gene expression by altering chromatin structure allowing DNA to be more accessible)

21. Know the names of the products of meiosis in animals and in plants. Key terminology: egg, sperm, gamete, megaspore, microspore, pollen grain, endosperm, zygote. • Microsporocyte • Spermatid- • Oogonium • Megaspore • Spermatogonium • Ovum • Megasporocyte • Sperm • Endosperm

• Microsporocyte- plant, male, diploid • Spermatid- animal, male, haploid • Oogonium- animal, female, diploid • Megaspore- plant, female, haploid • Spermatogonium- animal, male, diploid • Ovum- animal, female, haploid • Megasporocyte- plant, female, diploid • Sperm- both, male, haploid • Endosperm- plant, neither, triploid

Avery, MacLeod, and McCarty experiment 3. If any controls were missing, describe the positive and negative controls that could have been included in this experiment

• Pos. control = no treatment of IIIS, and see transformation • Neg. control = don't add IIR to the IIIS and see lack of transformation

26. Explain what gene conservation across species means. What exactly is conserved about the gene?

• Recall that many important genes are conserved across species • Example: PTEN tumor suppressor protein is evolutionarily conserved • Mutations have occurred so that the DNA and amino acid sequences of PTEN are different in different species • BUT there is enough similarity so that the important parts (domains) of the protein still work the same way • The molecular function of the protein is conserved in different species, even if the details vary Because genes and genetic pathways are conserved, can study genes in model systems and apply that knowledge to human disease • Much of what we know about oncogenes and tumor suppressors came from studies in worms and flies • CRISPR-Cas-9 gene editing facilitates this study

13. How is gene expression regulated in eukaryotes? bacteria? At what level(s) does gene expression most often occur in each? - eukaryotes transcription (siRNAs)

• Some siRNAs can also regulate transcription • Recognize DNA target instead of mRNA • Recruit enzymes that methylate histones to close chromatin, blocking transcription • Net effect: no protein is made