BIO EXAM 3

A mutation within a gene that will insert a premature stop codon in mRNA would ________. A) result in a longer polypeptide chain B) result in a shortened polypeptide chain C) change the location at which transcription of the next gene begins D) have the same effect as deleting a single nucleotide in the gene

B

A vaccine works by ________. A) inhibiting bacterial reproduction B) stimulating the immune system to develop lasting defenses C) killing cells infected with a virus D) preventing translation of mRNA molecules that code for disease-causing proteins

B

Consider the following figure. It illustrates that a single amino acid substitution in the hemoglobin gene ________. A) always involves adenine and uracil B) changes an amino acid in the hemoglobin protein C) is a silent mutation D) causes a nonsense mutation

B

DNA nucleotides include ________. A) uracil, guanine, adenine, and cytosine B) thymine, guanine, adenine, and cytosine C) thymine, uracil, adenine, and cytosine D) thymine, guanine, adenine, and uracil

B

Examine the genetic code table shown below. The codon CAU codes for the amino acid ________. A) isoleucine B) histidine C) glutamine D) leucine

B

HIV (human immunodeficiency virus) must use its own ________ to reproduce. A) DNA polymerase B) reverse transcriptase C) RNA polymerase D) tRNA

B

How is Zika virus most commonly transmitted? A) through human saliva B) through a single species of mosquito C) through medical needles D) through spider bites

B

How many amino acids are common to all living systems? A) 10 B) 20 C) 30 D) 100

B

How many nucleotides make up a codon? A) two B) three C) four D) five

B

If guanine makes up 60% of the bases in a DNA double helix, what percent of the bases is adenine? A) 60% B) 40% C) 20% D) 50%

B

If one strand of a DNA double helix has the sequence ATCCGA, what is the sequence of the other strand? A) ATCCGA B) TAGGCT C) AGCCTA D) UAGGCU

B

Prions are infectious molecules that can cause brain diseases in several animals. What type of molecule is a prion? A) DNA B) protein C) RNA D) carbohydrate

B

Recombinant DNA technology produces transgenic bacteria with a human gene that codes for a human protein. What problem could be associated with this process? A) formation of a bacterium that cannot synthesize the product B) production of a human protein that does not function normally C) a bacterium with DNA that is resistant to restriction enzymes D) production of the mouse form of the protein instead of the human form

B

The CORRECT sequence of events that occurs during transcription is ________. A) splicing, adding a cap, adding a tail B) initiation, elongation, termination C) adding a tail, adding a cap, splicing D) elongation, initiation, termination

B

The expressed (coding) regions of eukaryotic genes are called ________. A) promoters B) exons C) introns

B

The figure shows an electrophoresis gel which includes a DNA ladder that can be used to estimate the sizes of DNA molecules. The ladder increases in 100 nucleotide increments, from 100 to 700. Four DNA molecules have been separated on this gel (labeled A to D). Which DNA molecule is the largest? A) DNA molecule A B) DNA molecule B C) DNA molecule C D) DNA molecule D

B

To make restriction fragments, a DNA sample is treated with ________. A) DNA ligase B) restriction enzymes C) DNA polymerase D) lysozyme

B

Translation converts the information stored in ________ to ________. A) DNA; RNA B) RNA; a polypeptide C) DNA; a polypeptide D) RNA; DNA

B

What is the best definition for recombinant DNA? A) a type of nucleic acid that includes both RNA and DNA strands B) DNA that includes nucleotides from two different sources C) an alternate form of DNA that is the product of a mutation

B

What is the main function of the CRISPR-Cas9 system? A) to alter the nucleotide sequences of specific genes in a living cell B) to make copies of a gene in a PCR reaction C) to produce proteins from RNA outside of a living cell D) to prevent bacterial infections in humans

A

What is the smallest number of nucleotides that must be added or subtracted to change the triplet grouping of the genetic message? A) one B) two C) three D) four

A

Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans? A) Humans and chimpanzees share a relatively recent common ancestor. B) Humans evolved from chimpanzees. C) Humans are unique and different from all other life forms. D) Humans are a more complex life form than chimpanzees.

A

What can act as a vector to introduce new genes into a cell? A) primers B) ligase C) restriction enzymes D) plasmids

D

What cellular structure facilitates the process of translation? A) lysosomes B) smooth endoplasmic reticulum C) peroxisomes D) ribosomes

D

What is the definition of a genetically modified organism? A) an organism carrying a gene that was acquired by artificial means B) an organism in which a particular mutation has appeared for the first time C) a cloned organism carrying two different alleles

A

A specific stretch of DNA that contains information for the amino acid sequence of a polypeptide is a(n) ________. A) gene B) protein C) nucleic acid D) enzyme

A

All of the following are examples of potential emerging viruses except one. Choose the exception. A) a virus that is harmful to humans mutates very slowly over long periods of time B) a virus that is normally harmless to humans undergoes rapid mutations C) a virus that begins to infect people in Los Angeles, a popular tourist destination D) a virus that affects primarily rabbits mutates and begins to infect humans

A

Approximately what percentage of the human genome consists of noncoding DNA? A) 98.5% B) 87.0% C) 77.5% D) 67.0%

A

Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________. A) gel electrophoresis B) enzymes C) recombinant DNA D) plasmids

A

DNA and RNA are polymers composed of ________ monomers. A) nucleotide B) carbohydrate C) fatty acid D) amino acid

A

If a strand of DNA has the sequence GACTTA, transcription will result in a(n) ________. A) single RNA strand with the sequence CUGAAU B) DNA double helix with the sequence CTGAAT for one strand and TAAGTC for the complementary strand C) single RNA strand with the sequence CTGAAT D) DNA double helix with the sequence CUGAAU for one strand and UAAGUC for the complementary strand

A

Peptide bonds form between ________. A) amino acids B) an mRNA codon and a tRNA anticodon C) a tRNA and the amino acid it is carrying D) an mRNA transcript and the small ribosomal subunit

A

Plant viruses ________. A) often use RNA, rather than DNA, as their genetic material B) benefit plants, rather than causing disease C) cause diseases that can be easily cured D) do not exist, as viruses attack only animals

A

STR analysis is a DNA profiling technique that makes use of the fact that different people have ________. A) different numbers of repeats of short DNA sequences at certain sites in the genome B) different alleles for many genes in the genome C) different restriction fragments D) different CODIS DNA sequences

A

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________. A) gene cloning B) PCR C) STR analysis D) whole-genome shotgun method

A

The scientific field that studies complete sets of genes is called ________. A) genomics B) metagenomics C) proteomics D) genetic engineering

A

The study of the full protein sets that genomes encode is ________. A) proteomics B) genomics C) metagenomics D) systems biology

A

The world's first genetically engineered pharmaceutical product was ________. A) humulin B) human growth hormone C) a vaccine against hepatitis B D) erythropoietin

A

Transcription is the ________. A) manufacture of a strand of RNA complementary to a strand of DNA B) manufacture of two new DNA double helices that are identical to an old DNA double helix C) modification of a strand of RNA prior to the manufacture of a protein D) manufacture of a protein based on information carried by RNA

A

A DNA fragment with the sticky end sequence TGGCA will bind with another DNA fragment with the sticky end sequence ________. A) TGCCA B) ACCGT C) TGGCA D) ACGGT

B

What was the goal of the Human Genome Project? A) to determine the functions of all of the proteins in a human cell B) to determine the nucleotide sequence of all of the DNA in the human genome C) to determine the function of all noncoding DNA in the human genome D) to determine the amino acid sequence of all of the proteins in a human cell

B

23) Mad cow disease is caused by ________. A) a retrovirus similar to HIV B) an enveloped virus C) infectious proteins called prions

C

A(n) ________ is to bacteria as a ________ is to animal cells. A) retrovirus; virus B) phage; prophage C) prophage; provirus D) RNA virus; DNA virus

C

Gel electrophoresis separates DNA fragments because ________. A) double-stranded DNA moves slower than single-stranded DNA B) of ratios of guanine to cytosine C) DNA fragments have different lengths D) of the salt concentration in the gel

C

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA A) 0 times B) 1 time C) 2 times D) 3 times

C

How can bacteriophage DNA be spread from cell to cell without causing cell death? A) by altering the way a cell splices its RNA B) via a lytic cycle C) via a lysogenic cycle D) by changing the length of its DNA molecules

C

How does RNA differ from DNA? A) RNA is double-stranded; DNA is single-stranded. B) RNA is a polymer of amino acids; DNA is a polymer of nucleotides. C) RNA contains uracil; DNA contains thymine. D) In RNA G pairs with T; in DNA G pairs with C.

C

In a DNA double helix, adenine pairs with ________ and guanine pairs with ________. A) cytosine; thymine B) guanine; adenine C) thymine; cytosine D) uracil; cytosine

C

In what type of organism was the CRISPR-Cas9 system discovered? A) plant B) human C) bacteria D) fungi

C

Of these steps, which occurs first in the production of a recombinant plasmid? A) cloning B) cutting DNA into fragments C) isolation of a plasmid from a bacterium D) reproduction of the engineered plasmid in bacteria

C

The RNA that is translated into a polypeptide is ________ RNA. A) ribosomal B) transfer C) messenger

C

The accompanying figure shows the flow of genetic information in a eukaryotic cell. The transfer of information from RNA into a protein is known as ________. A) DNA replication B) transcription C) translation

C

The backbone of DNA consists of ________. A) nitrogenous bases B) a repeating sugar-nucleotide-sugar-nucleotide pattern C) a repeating sugar-phosphate-sugar-phosphate pattern D) paired nucleotides

C

The figure below shows ________. A) a single strand of RNA B) double-stranded RNA C) a single strand of DNA D) double-stranded DNA

C

The human genome contains approximately ________ genes. A) 1,000 B) 5,000 C) 21,000 D) 30,000

C

The shared genetic code of all life on Earth is evidence that ________. A) the genetic code arose relatively late in the history of life on Earth B) DNA replication is error-free C) all life shares a common ancestry D) bacterial cells arose earlier than eukaryotic cells

C

This figure shows the reproductive cycle of a virus that causes mumps. If a researcher wanted to develop a drug to prevent mumps proteins from being translated, what step would they target? A) Step 2 B) Step 3 C) Step 4 D) Step 5

C

What is the definition of a "transgenic organism?" A) an organism that is the first of its kind to show a particular phenotype B) an organism in which a genetic defect has been corrected using gene therapy C) an organism containing a gene from another species

C

What name is given to the collection of traits exhibited by an organism? A) genome B) genotype C) phenotype

C

When plasmids are used to produce a desired protein, the ________. A) plasmids multiply and produce the protein outside of the bacterium B) bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate C) desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium D) bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene

C

Which enzyme is used to bind DNA fragments together? A) restriction enzyme B) lysozyme C) DNA ligase D) DNA polymerase

C

You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association? A) You can use the sample to determine the individual's blood type. B) You can use gel electrophoresis to determine the length of the DNA found in the sample. C) You can use PCR to increase the amount of DNA available for STR analysis.

C

"Sticky ends" are ________ that are produced by the action of ________. A) double-stranded DNA molecules with double-stranded ends; DNA ligase B) double-stranded DNA molecules with single-stranded ends; DNA ligase C) double-stranded DNA molecules with double-stranded ends; restriction enzymes D) double-stranded DNA molecules with single-stranded ends; restriction enzymes

D

A DNA molecule has the sequence TCAACTTGA. The equivalent RNA molecule would have the sequence ________. A) TCAACTTGA B) UCAACUUGA C) UGTTCUUCT D) AGUUGAACU

D

DNA contains the nitrogenous base ________ instead of ________, which is found only in RNA. A) a deoxyribose sugar; a ribose sugar B) uracil; thymine C) uracil; guanine D) thymine; uracil

D

DNA replication ________. A) is a slow process that results in virtually no errors B) requires DNA polymerase and RNA polymerase C) is a fast process that results in numerous errors D) requires the cooperation of over a dozen enzymes and other proteins

D

Golden rice 2 is a genetically modified form of rice that was developed to treat what nutritional deficiency? A) calcium B) vitamin B12 C) iron D) vitamin A

D

If one strand of a DNA double helix has the sequence GACGTCA, what will be the sequence of the other strand? A) GACGTCA B) ACTGCAG C) TGACGTC D) CTGCAGT

D

Restriction enzymes are obtained from ________. A) archaea B) eukaryotes C) viruses D) bacteria

D

The possibility that Mongolian ruler Genghis Khan spread an unusual chromosome to nearly 16 million men living today resulted from studies of ________. A) proteomics B) systems biology C) the X chromosome D) the Y chromosome

D

What is the ultimate source of all diversity? A) natural selection B) sexual recombination C) meiosis D) mutation

D

What population is at the highest risk of being affected by Zika virus? A) people over the age of 80 B) young adults (age 18 to 25) C) children (age 5 to 10) D) developing babies (less than one year old)

D

Which statement is TRUE with regard to a DNA molecule? A) The amount of adenine is equal to the amount of guanine, and the amount of thymine is equal to the amount of cytosine. B) The amount of adenine is equal to the amount of cytosine, and the amount of guanine is equal to the amount of thymine. C) The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of uracil. D) The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine.

D