Biol107 Ch 11-15
bioinformatics
A scientific field of study that uses mathematics to develop methods for organizing and analyzing large sets of biological data.
11.9 State the advantages and disadvantages of embryonic stem cells and adult stem cells in the replacement of tissues in adults.
- Advantages: Allowed to be used in all parts of the body. Adult stem cells can be harvested from a person's blood, fat, or bone marrow with little effect on the individual.- Disadvantage: Lots of debate and disagreement around it. "Humans should not play god".
11.6 Detail how DNA microarrays help scientists visualize gene expression.
-DNA microarray enables scientists to perform an experiment on thousands of genes at the same time.
12.10 Explain how genomics and gene therapy can be used to diagnose and treat diseases.
-Genomic testing is used to monitor, diagnose, treat, prevent and predict disease/s. Gene therapy alters an individuals genes inside the bodys cells to ultimately treat and stop a disease. Gene therapy works by uses of vectors. Vectors are genetically engineered by scientists to deliver gene/s.
12.7 Compare and contrast what is learned in the fields of genomics, metagenomics, proteomics, and systems biology.
-Genomics is the interdisciplinary field of science that focuses on the function, structure, evolution, editing, and mapping of genomes. Genomics contrasts with genetics, which refers to studying individual genes and the inheritance between genes. Throughout Genomics, Functional, Structural, and Epigenomic studies will be done. Functional genomics refers to the attempt to use data from genomic projects, i.e. (gene sequencing) to describe the interactions and functions of proteins and genes. Structural genomics attempts to explain the three-dimensional structure of every protein encoded by a set genome. Finally, Epigenomics is the study of how changes in the way genes are expressed can change organisms. Epigenetic studies show how epigenetic changes result in a cell's genetic material changing. -In comparison to genomics, metagenomics is a research technique. What is metagenomics? Metagenomics is the sequencing-based analysis of genomes containing an environmental sample. Metagenomics is a tool to obtain actionable information on Pathogens and Antimicrobial Resistance. Metagenomics works through DNA isolation --> Fragmentation --> and DNA Sequencing. -Proteomics is the search to see how different proteins interact with each other and the roles the proteins play within the organism. The list aspects of Proteomics are protein identification, protein quantification, Protein localization, Post-translational modifications, Functional Proteomics, Structural proteomics, and protein interactions. Protein identification is where proteins are typically expressed in a cell type. For example, organism or tissue as a whole, or which proteins are differentially expressed? Protein quantification measures the totality of protein abundance and investigates the rate of protein turnover. Protein localization focuses on determining where a protein is located. This aspect (Protein localization) is crucial as cellular localization controls which molecular interaction targets and partners are available. Post-translational modification can affect protein localization, activation, stability, interactions, signal transduction, and other protein characteristics, thereby adding a significant layer of biological complexity. Functional Proteomics identifies the bodily functions of specific individual proteins or whole protein interaction networks. Structural proteomics induces essential insights into protein function by conducting structural studies. Proteins interactions investigate which proteins interact, how proteins interact, and where they interact. There are a couple of approaches to proteomics. Before starting the processes, know they have pros and cons. Now, the Top-down proteomic approach is where proteins in a sample of interest are first separated before being individually characterized. The bottom-up proteomics approach is where all the proteins in the model are first digested into a complex mix of peptides. These peptides are then analyzed to identify which proteins were present in the sample. The advantages of Bottom-up proteomics are the following. Bottom-up proteomics is the most mature and widely used approach for protein identification and characterization. Bottom-up proteomics has less sophisticated instrumentation and expertise. Finally, Bottom-up proteomics can achieve high-resolution separations. The following are disadvantages of Bottom-up proteomics. Bottom-up proteomics has a low percentage coverage of the proteins sequence, and much information about PTMS and alternative splice variation is lost. Top-down proteomics advantages are complete protein sequence, the ability to locate and characterize PTMS, Protein isoform determination, and elimination of the time-consuming protein digestion. Some disadvantages of Top-down proteomics are the following; the favored instrumentation is expensive to purchase and operate, and the selected dissociation techniques (ECT) are efficient processes requiring prolonged ion accumulation activation and detection times. It has not been achieved on a large scale due to a lack of intact protein fractionation methods integrated with tandem mass spectrometry. In short, Proteomics can be divided into four areas (Sequence, structural, functional, interaction, and expression. Sequence and structure's primary focus is educating a particular protein sequence and structure. Functional and interaction's primary focus is to concentrate on a protein's function and interaction partners. Expression's primary focus is the cataloging of proteins inset samples. What is systems biology? Systems biology is the study of the interactions and behavior of the components of biological entities. System biology investigates organisms and cells. IE, cells, molecules, organisms, and organs. System biology contrasts with genomics because systems biology emerged from the genomics revolutions. The Human Genome Project catalyzed genomics!
signal transduction pathway
A signal molecule can act by binding to a receptor protein and initiating a signal transduction pathway, a series of molecular changes that converts a signal received outside a cell to a specific response inside the target cell.
Plasmids
A small ring of self-replicating DNA separate from the larger chromosomes. Plasmids are most frequently derived from bacteria. Plasmids are used by biologists to manipulate genes.
Cladistics
the study of evolutionary history; specifically, an approach to systematics in which organisms are grouped by common ancestry.
The cellular response of a signal transduction pathway designed to activate a transcription factor would be __________.
the synthesis of mRNA
Which group of organisms is a population?
the termites infesting your house (not including the microorganisms living in their guts)
What is plate tectonics?
the theory that the continents are part of great plates of Earth's crust that float on the hot, underlying portion of the mantle. Movements in the mantle cause the continents to move slowly over time.
How recombinant DNA is created
by combining two ingredients a bacterial plasmid and the gene of interest
Recombinant DNA is made
by combining two pieces of DNA from different sources
How can some prokaryotes survive during very harsh conditions?
by forming specialized cells called endospores
15.3 Compare the structure, function, reproduction, and types of nutritional diversity of prokaryotes.
-Prokaryotes exhibit all four modes of nutrition.-They can be Photoautotrophs(Sunlight is their energy source and CO2 is their carbon source), Chemoautotrophs(inorganic chemicals are their energy source and CO2 is their carbon source), Photoheterotrophs(sunlight is their energy source and organic compounds are their carbon source) or Chemoheterotrophs(organic compounds are both their energy source and carbon source) Every type of nutrition observed in eukaryotes is represented among the prokaryotes, along with some nutritional modes unique to prokaryotes. Combining these possibilities for energy sources and carbon sources results in four major modes of nutrition.• Photoautotrophs: photosynthetic organisms that capture light energy and use it to drive the synthesis of organic compounds and other inorganic carbon compounds. Cyanobacteria and many other groups of prokaryotes are photoautotrophs, as are plants and algae.• Chemoautotrophs: also need only an inorganic compound; however, instead of using light as an energy source, they oxidize inorganic substance, such as hydrogen sulfide, ammonia, or ferrous ions. This mode of nutrition is unique to certain prokaryotes.• Photoheterotrophs: Harness energy from light but must obtain carbon in organic form. This mode is unique to certain marine and halophilic (salt-loving) prokaryotes.• Chemoheterotrphs: must consume organic molecules to obtain both energy and carbon. This nutritional mode is widespread among prokaryotes. Fungi, animals, most protists, and even some parasitic plants are also chemo heterotrophs. Cocci - spherical, appearing in clusters are called staphylococci, bacteria that cause strep throat are streptococci Bacilli - rod-shaped Spiral some harvest inorganic substances such as ammonia, soil bacteria from nitrogen compounds some are photosynthetic some require organic compounds
12.8 Explain how the "whole-genome shotgun" method is used to study genomes.
-The whole-genome shotgun approach entails sequencing many overlapping DNA fragments in parallel. Then a computer is used to assemble the tiny pieces into large contigs. Then from large contigs, chromosomes are made. WGS works best for genomes with few repeated regions.
14.4 Explain how mass extinctions can be seen as times of great opportunity and how the extinction of most of the dinosaurs affected mammalian evolution.
-mass extinction provide a big-picture view of how those changes came about. -For example, mammals existed for at least 75 million years before undergoing an explosive increase in diversity just after the cretaceous period. Their rise to prominence was undoubtedly associated with the void left by the extinction of the dinosaurs. The world would be a very different place today if many dinosaur lineages had escaped the cretaceous extinctions or if none of the mammals had survived.
14.6 Explain what is studied in the field of evo-devo, including the role of homeotic genes in diversity of body forms.
-result from alternations in homeotic genes, the master control genes that determine such basic developmental events as where a pair of wings or legs will apperar on a fruitfly.
If the frequency of one allele in a population is 0.7 in a population with two alleles at a particular locus, what is the frequency of the alternate allele?
0.30
Suppose in a large population that there are only two alleles at a particular locus, A and a, and we know that 60% of the alleles in the gene pool are A. Suppose further that we observe this population for five generations, during which we know that no mutation, selection, or migration has occurred. After this period, the frequency of the a allele is expected to be __________.
0.4
5 steps to producing all three lactose enzymes
1 - binding to the repressor and 2; changing the repressors shape. Altering the repressors shape changes how it acts. In its new shape, the repressor cannot bind to the operator, and the operator switch remains on. 3, RNA polymerase is no longer blocked, so it can now bind to the promoter and from there 4; transcribe the genes for the lactose enzymes into MRNA 5, Translation produces all three lactose enzymes
Approximately one out of every 2,500 Caucasians in the United States is born with the recessive disease cystic fibrosis. According to the Hardy-Weinberg equilibrium equation, approximately how many people are carriers?
1 in 25
What are the 2 main branches of Prokaryotic Evolution defined?
1)Bacteria-one of two prokaryotic domains of life 2)Archaea-one of two prokaryotic domains of life.
Steps to an approach to human gene therapy
1-A gene from a normal person is cloned, converted to an RNA version, and then inserted into the RNA genome of a harmless virus. 2-Bone marrow cells are taken from the patient and infected with the recombinant virus. 3-The virus inserts a DNA copy of its genome, including the normal gene, into the DNA of the patient's cell. 4-The engineered cells are then injected back into the patient. The normal gene is transcribed and translated within the patient's body, producing the desired protein. Ideally, the nonmutant version of the gene would be inserted into cells that multiply throughout a person's life. Bone marrow cells, which include the stem cells that give rise to all the types if blood cells, are prime candidates. If the procedure succeeds, the cells will multiply permanently and produce a steady supply of the missing protein, curing the patient.
Stepwise development of colon cancer
1-Colon caner begins when an oncogen arises through mutation, causing unusually frequent division of normal-looking cells in the colon lining. 2-Later, additional DNA mutations (such as the inactivation of a tumor suppressor gene) cause the growth of a small benign tumor (called a polp) in the colon wall. The cells of the polyp look normal, although they divide unusually frequently. If detected during a colonoscopy, suspicious polyps can usually be removed before they become a serious risk. 3-Further mutations lead to formation of a malignant tumor-one that can metasize (spread). It typically takes at least six mutations (usually creating at least one active oncogene and disabling at least one tumor-suppressor gene) before a cell becomes cancerous.
What are the 4 modes of nutrition in prokaryotes?
1-Photoautotroph-Energy source: Light. Carbon Source: Carbon dioxide (or related compounds). 2-Photoheterotroph-Energy source: Light. Carbon Source: Carbon Dioxide (or related compounds). 3-Chemoautotroph-Energy source: Chemical Compounds, Carbon SourceL Carbon Dioxide (or related compounds). 4-Chemoheterotroph-Energy Source: Chemical Compounds. Carbon Source: Organic Compounds
cutting and pasting DNA steps
1-The restriction enzyme cuts the DNA strands between the bases A and G in the recognition sequence, producing pieces of DNA called restriction fragments. The staggered cuts yield two double-stranded DNA fragments with single-stranded ends, called sticky ends. Sticky ends are the key to joining DNA restriction fragments originating from different sources. 2-Next, a piece of DNA from another source is added. 3-The complementary ends on the blue and yellow fragments stick together by base pairing. 4-The union between the blue and yellow fragments is then made permanent by the "pasting" enzyme DNA ligase. This enzyme connects the DNA pieces into continuous strands by forming bonds between adjacent nucleotides. The final outcome is a single molecule of recombinant DNA.
silencer
A eukaryotic DNA sequence that functions to inhibit the start of gene transcription; may act analogously to an enhancer by binding a repressor.
overview of DNA profiling steps
1-first, DNA samples are isolated from the crime scene, suspects, victims, or other evidence. 2-Next, selected sequences from each DNA sample are copied many times to produce a large sample of DNA fragments. 3-Finally, the amplified DNA fragments are compared. Together, these steps provide data about which samples are from the same individual and which samples are unique.
What are the Four-Stages Hypothesis for the Origin of Life?
1-the synthesis pf small organic molecules, such as amino acids and nucleotide monomers 2-the joining of these small molecules into macromolecules, including proteins and nucleic acids 3-the packing of all these molecules into pre-cells, droplets with membranes that maintained an internal chemistry different from the surroundings 4-the origin of self-replicating molecules that eventually made inheritance of genetic material possible
11.1 How and why genes are regulated
1. Gene regulation ensures that the appropriate genes are expressed at the proper times. It can also help an organism respond to its environment. Gene regulation is accomplished by a variety of mechanisms including chemically modifying genes and using regulatory proteins to turn genes on or off.
cell-to-cell signaling in which the target cells response is the transcription (turning on) of a gene steps
1; First, the signaling cell secretes the signal molecule. 2; This molecule binds to a specific receptor protein embedded in the targets cells plasma membrane. 3; The binding activates a signal transduction pathway consisting of a series of relay proteins (green) within the target cell. Each relay molecule activates the next. 4; The last relay molecule in the series activates a transcription factor that 5; triggers the transcription of a specific gene. 6; Translation of the mRNA produces a protein that can then perform the function originally called for by the signal.
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
2 times
11.2 State how gene regulation leads to cells with many different properties.
2. Gene regulation makes cells different. These different patterns of gene expression cause your various cell types to have different sets of proteins, making each cell type uniquely specialised to do its job. For example, one of the jobs of the liver is to remove toxic substances like alcohol from the blood stream.
Chapter 11: How Genes Are Controlled Practice Test
20 Questions
Chapter 12: DNA Technology Practice Test
20 Questions
Chapter 13: How Populations Evolve
20 Questions
Chapter 15: The Evolution of Microbial Life Practice Test
20 Questions
Chapter 14: How Biological Diversity Evolves Practice Test
21 Questions
Quiz_Ch. 15
21 Questions
The human genome contains approximately ________ genes.
21,000
Quiz_Ch. 13-14
26 Questions
Quiz Chapter 11
27 Questions
Chapter 12 Quiz
35 Questions
The figure shows an electrophoresis gel which includes a DNA ladder that can be used to estimate the sizes of DNA molecules. The ladder increases in 100 nucleotide increments, from 100 to 700. Four DNA molecules have been separated on this gel (labeled A to D). What is the approximate size of DNA molecule C?
480 nucleotides
Approximately what percentage of the human genome consists of noncoding DNA?
98.5%
In Principle, PCR is simple
A DNA sample is mixed with nucleotides, the DNA is mixed with nucleotides, the DNA replication enzyme DNA Polymerase, and a few other ingredients. The solution is then exposed to cycles if heating it to separate the DNA strands and cooling it allows double-stranded DNA to re-form. During these cycles, specific regions of each molecule of DNA are replicated, doubling the amount of that DNA. The result of this chain reaction is an exponentially growing population of identical DNA molecules.
restriction enzyme
A bacterial enzyme that cuts up foreign DNA (at specific restriction sites), thus protecting bacteria against intruding DNA from phages and other organisms. Restriction enzymes are used in DNA technology to cut DNA molecules in reproducible ways.
RNA interference (RNAi)
A biotechnology technique used to silence the expression of specific genes. Synthetic RNA molecules with sequences that correspond to particular genes trigger the breakdown of the gene's mRNA.
What are phylogenetic trees?
A branching diagram that represent a hypothesis about evolutionary relationships between organisms.
Carcinogen
A cancer-causing agent, either high-energy radiation (such as X-rays or UV light) or a chemical.
oncogene
A cancer-causing gene; usually contributes to malignancy by abnormally enhancing the amount or activity of a growth factor made by the cell.
cells; oncogene; proto-oncogene
A cell can acquire an oncogene from a virus or from the mutation of one of its own proto-oncogenes
Adult Stem Cell
A cell present in adult tissues that generates replacements for nondividing differentiated cells. Adult stem calls are further along the road to differntation than embryonic stem cells and therefore give rise to only a few related types of specialized cells. For example, stem cells in bone marrow generate different kinds of blood cells. Adult stem cells from donor bone marrow have long been used as a source of immune system cells in patients whose own immune systems have been destroyed by disease or cancer treatments. Adult animals have only tiny numbers of stem cells, but scientists are learning to identify and isolate these cells from various tissues and, in some cases, to grow them in culture.
What can affect a phenotype?
A change as small as a single nucleotide in a protein-coding gene
recombinant DNA
A dna molecule carrying genes derived from two or more sources, often from different species.
enhancer
A eukaryotic DNA sequence that helps stimulate the transcription of a gene at some distance from it. An enhancer functions by means of a transcription factor called an activator, which binds to it and then to the rest of the transcription apparatus.
What is a reproductive barrier?
A factor that prevents individuals of closely related species from interbreeding
What is a gene pool?
A gene pool is the total collection of alleles for all the genes in a population at any one time.
tumor-suppressor gene
A gene whose product inhibits cell division, thereby preventing uncontrolled cell growth. Any mutation that keeps a growth-inhibiting protein from being made or from functioning may contribute to the development of cancer.
DNA microarray
A glass slide containing thousands of different kinds of single-stranded DNA fragments arranged in an array (grid). Tiny amounts of DNA fragments, representing different genes, are attached to the glass slide. These fragments are tested for hybridization with various samples of cDNA molecules, thereby measuring the expression of thousands of genes at one time.
Is this sort of cloning possible in animals?
A good indication that some animal cells can also tap into their full genetic potential is regeneration, the regrowth of lost body parts. For example, when a salamander loses a tail, certain cells in the tail stump reverse their differentiated state, divide, and then differentiate again to give rise to a new tail. Many other animals, especially among the invertebrates (sea stars and sponges, for example), can regenerate lost parts, and isolated pieces of a few relatively simple animals can dedifferentiate and then develop into an entirely new organism.
homeotic gene
A master control gene that determines the identity of a body structure of a developing organism, presumably by controlling the developmental fate of groups of cells. (In plants, such genes are called organ identity genes). For example, one set of homeotic genes in fruit flies instruct cells to the midbody to form legs. Elsewhere, these homeotic genes remain turned off, while others are turned on. Mutations in homeotic genes can produce bizarre effects. For example, fruit flies with mutations in homeotic genes may have extra sets of legs growing from their head.
What is binary fission?
A means of a sexual reproduction in which a parent organism, often a single cell, divides into two individuals of about equal size.
What is a reproductive behavior?
A mechanism that prevents individuals of closely related species from interbreeding.
Whole-genome shotgun method
A method for determining the DNA sequence of an entire genome. After a genome is cut into small fragments, each fragment is sequenced and then placed in the proper order.
What is radiometric dating?
A method for determining the ages of fossils and rocks from the ratio of a radioactive isotope to the nonradioactive isotopes of the same element in the sample.
restriction fragments
A molecule of DNA produced from a longer DNA molecule cut by a restriction enzyme
Each of us is part of the ongoing evolution of the human species. Which of the following occurrences would have the greatest impact on the future biological evolution of the human population?
A mutation occurs in one of your sperm or egg cells.
proto-oncogene
A normal gene that can be converted to a cancer-causing gene
What does a phylogenetic tree depict?
A phylogenetic tree is a way of depicting the evolutionary history of a group of organisms.
What are Exotoxins?
A poisonous protein secreted by certain bacteria. Exotoxins are proteins that bacterial cells secrete to their environment.
13.10 Explain why a population is considered the smallest unit of evolution.
A population is the smallest unit that can evolve because anything less than that or more than that either doesn't include all members of a species or includes more than one species, which means that the whole species isn't evolving.
DNA Profiling
A procedure that analyzes an individual's unique collection of genetic markers using PCR and gel electrophoresis. DNA profiling can be used to determine whether two samples of genetic material were derived from the same individual.
What is natural selection?
A process in which individuals with certain inherited traits are more likely to survive and reproduce than are individuals that do not have those traits.
growth factor
A protein secreted by certain body cells that stimulates other cells to divide. When all these proteins are functioning normally, in the rights amounts at the right times, they help keep the rate of cell division at an appropriate level. When they malfunction if a growth factor becomes hyperactive. for example-cancer (uncontrolled cell growth) may result.
What are postzygotic barriers?
A reproductive barrier that prevents development of fertile adults if hybridization occurs.
What are prezygotic barriers?
A reproductive barrier that prevents mating between species or hinders fertilization of eggs if members of different species attempt to mate.
What is bacillus?
A rod-shaped prokaryotic cell
Figure 12.15 shows how gel electrophoresis separates DNA fragments obtained from different sources
A sample with many copies of the DNA from each source is placed in a separate wall (hole) at one end of a gel, a thin slab of jelly like material that acts as a molecular sieve. A negatively charged electrode is then attached to this end of the gel and a positive electrode to the other end. Because the phosphate groups of nucleotides give DNA fragments a negative charge, the fragments move through the gel toward the positive pole. Shorter DNA fragments move farther through a gel than do longer gragments. Gel electrophoresis thus separates DNA fragments by length. When the current is turned off, a series of band (blue smudges in the photo) is left in each column of the gel. Each bond is a collection of DNA fragments of the same length. The DNA bonds can be made visible by staining, by exposure onto photographic film (if raioactivel labeled), or by measuring fluorescence (if labled with a fluorescent dye).
microRNA (miRNA)
A small, single-stranded RNA molecule that associates with one or more proteins in a complex that can degrade or prevent translation of an mRNA with a complementary sequence
What is the biological species concept?
A species is a population of organisms that under natural conditions are able to mate and produce fertile offspring. This definition can not be applied to all organisms. For example, it doesn't work for asexual organisms, prokaryotes, or extinct fossil organisms.
Promoter
A specific nucleotide sequence in DNA, located at the start of a gene, that is the binding site for RNA polymerase and the place where transcription begins.
restriction enzyme
A specific sequence on a DNA strand that is recognized and cut by a restriction enzyme
What is cocci?
A spherical prokaryotic cell
What are vegistal structures?
A structure of marginal; if any. importance to an organism. Vegistal structures are historical remnants of structures that had important functions in the organisms ancestors.
What are exaptations?
A structure that evolves in one context and gradually becomes adapted for other functions.
What is a biofilm?
A surface-coating cooperative colony of prokaryotes. A biofilm may consist of one or several species of prokaryotes, and it may include protists and fungi as well.
What is the three-domain system?
A system of taxonomic classification based on three basic groups: Bacteria, Archaea, and Eukarya.
Gel Electrophoresis
A technique for sorting macromolecules. A mixture of molecule is placed on a gel between a positively charged electrode and a negatively charged one; negatively charged molecules migrate toward the positive electrode. The molecules separate in the gel according to their rates of migration. DNA profiling by STR analysis depends upon comparing lengths of DNA fragments.
nuclear transplantation
A technique in which the nucleus of one cell is placed into another cell that already has a nucleus or in which the nucleus has been previously destroyed. The cell is then stimulated to grow, producing an embryo that is a genetic copy of the nucleus donor.
polymerase chain reaction (PCR)
A technique used to obtain many copies of a DNA molecule or part of a DNA molecule. A small amount of DNA mixed with a heat-resistant DNA polymerase, DNA nucleotides, and a few other ingredients replicates repeatedly in a test tube. Through PCR, a scientist can obtain enough DNA from even minute amounts of blood or other tissue to allow a DNA profile to be constructed. In fact, a microscopic sample with as few as 20 cells can be sufficient for PCR amplification.
What is the geologic time scale?
A time scale established by geologists that divides Earth's history into a sequence of geologic periods, grouped into four divisions: precambrian, Paleozoic, mesozoic, and cenozoic.
Normal Cell growth
A tumor suppressor gene normally codes for a protein that inhibits cell growth and division. Such genes help prevent cancerous tumors from arising or spreading.
alternative RNA splicing
A type of regulation at the RNA-processing level in which different mRNA molecules are produced from the same primary transcript, depending on which RNA segments are treated as exons and which as introns.
human gene exons
A typical human gene contains about ten exons; nearly all genes are spliced in at least two different ways, and some are spliced hundreds of different ways.
DNA technology is also helping medical researchers develop vaccines
A vaccine is a harmless variant order active of a disease-causing microorganism such as a bacterium or virus that is used to prevent an infectious disease. When a person is inoculated, the vaccine stimulates the immune system to develop lasting defenses against the microorganism. For many viral diseases, the only way to prevent serious harm is to use vaccination to prevent the illness in the first place. The vaccine against hepatitis B, a disabling and sometimes fatal liver disease, is produced by genetically engineered yeast cells that secrete a protein found on the virus's outer surface
human growth hormone (HGH)
Abnormally low levels of this hormone during childhood and adolescence can cause dwarfism. Because growth hormones from other animals are not effective in people, HGH was an early target of genetic engineers. Before genetically engineered HGH became available in 1985, children with an HGH deficiency could only be treated with scarce and expensive supplies of HGH obtained from human cadavers. Another genetically engineered protein helps dissolve blood clots. If administered shortly after a stroke, it reduces the risk of additional strokes and heart attacks
inherited mutation examples
About 15% if colorectal cancers, for example, involve inherited mutations. There is also evidence that inheritance plays a role in 5-10% of patients with breast cancer, a disease that strikes one out of every ten American women.
What is Pangaea "all land"?
About 250 million years ago, near the end of the Paleozoic era, plate movements brought all the previosult separated landmasses together into a supercontinent called Pangaea.
How are prokaryotic cells mobile?
About half of all prokaryotic cells are mobile. Many of those that travel have one or more flagella that propel the cells away from unfavorable places or toward more favorable places, such as nutrient-rich locales.
What profound effects can a subtle change in the development program have?
Accordingly, changes in the number, nucleotide sequence, and regulation of homeotic genes have led to the huge diversity in body forms.
How do transcription factors, such as activators, turn on more than one eukaryotic gene at the same time?
Activators attach to enhancers.
DNA profiling can also be used to identify people who have been killed in natural disasters.
After a tsunami devastated southern Asia the day after Christmas 2004, DNA Profiling identified hundreds of victims
How do pathogenic bacteria cause disease?
by producing a poison-either an exotoxin or and endotoxin
Photosynthetic protists belong to what informal category?
Alga; an informal term that describes a great variety of photosynthetic protists, including unicellular, colonial, and multicellular forms. Prokaryotes that are photosynthetic autotrophs are also regarded as algae.
In general, how do algae and protozoans differ?
Algae are photosynthetic, and almost all protozoans are heterotrophic.
15.2 Describe the relative abundance of prokaryotes on Earth and how they can affect humans and ecosystems.
Although invisible to the naked eye, prokaryotes are an essential component of the earth's biosphere. They catalyze unique and indispensable transformations in the biogeochemical cycles of the biosphere, produce important components of the earth's atmosphere, and represent a large portion of life's genetic diversity. Although the abundance of prokaryotes has been estimated indirectly, the actual number of prokaryotes and the total amount of their cellular carbon on earth have never been directly assessed.They outnumber all eukaryotes combined. The collective mass of prokaryotes 10 x that of eukaryotes bacterial infections responsible for half of human disease intestinal inhabitants help us digest
identified genes for human diseases via PCRS
Among the genes for human diseases that have been identified are those for sickle-cell disease, hemophilia, cystic fibrosis, Huntington's disease, and Duchenne muscular dystrophy. Individuals afflicted with such diseases can often be identified before the onset of symptoms, even before birth, allowing for preventative medical care to begin.
What is Actinomycete?
An actinomycete is a mass of branching chains of rod-shaped cells. These bacteria are common in soil, where they secrete antibiotics that inhibit the growth of other bacteria. Various antibiotic drugs such as streptomycin, are obtained from actinomycetes.
Systems Biology
An approach to studying biology that aims to model the dynamic behavior of whole biological systems based on a study of the interactions among the system's parts.
What is speciation?
An evolutionary process in which one species splits into two or more species.
What is evolutionary adaptations?
An inherited characteristic that enhances an organism's ability to survive and reproduce in a particular enviornment.
What is symbiosis?
An interaction between organisms of different species in which one species, the symbiont, lives in or on another species, the host.
Human Genome Project
An international collaborative effort that sequenced the DNA of the entire Human Genome. The project began in 1990 as an effort by government-funded researchers from six nations. Several years into the project, more than 99% of the genome had been determined to 99.999% accuracy. This ambitious project has provided a wealth of data that may illuminate the genetic basis of what it means to be human.
transgenic organism
An organism that contains genes from another organism, typically of another species.
genetically modified (GM) organisms
An organism that has acquired one or more genes by artificial means. If the gene is from another organism, typically of another species, the recombinant organism is also known as a transgenic organism.
What is polyploid?
An organism that has more than two complete sets of chromosomes as a result of an accident of cell division.
What does an organisms shape depend on, give an example?
An organisms shape depends in part on the relative growth rates of different body parts during development. For example, in the fetuses of both chimpanzees and humans, the skulls are rounded and the jaws are small, making the face rather flat.
Read the following scenario to answer the following question.Malaria is a disease caused by parasitic protists in the genus Plasmodium. The parasite is transmitted to humans by female Anopheles mosquitoes. The Plasmodium parasite feeds on human red blood cells, eventually destroying them. Humans infected with malaria can exhibit many symptoms. Depending on the severity of the infection, these can range from fever, chills, sweating, and headaches to anemia and kidney failure. Ultimately, malaria can result in death. However, if time and money permit, once a person is infected, they can be treated with different antimalarial drugs. Two commonly used drugs are artemisinin and quinine. In addition, one way to prevent the spread of malaria is to apply pesticides to treat areas with Anopheles mosquitoes. The National Malaria Eradication Program began work in 1947 with the goal of eliminating malaria from the southern United States. In 1947, 15,000 cases of malaria were reported nationwide. By 1950, only 2,000 cases were reported, and by 1951, malaria was considered eradicated from the United States. Today, the disease is most common in Africa and South America, two continents that are highly impoverished. About one million people die from malaria every year, many of them children. In Africa, it is estimated that one in every five childhood deaths is due to malaria. A vector is an organism that transfers a pathogen to a host. In the case of malaria, the vector(s) is (are) ________.
Anopheles mosquitoes only
What is a protist?
Any eukaryote that is not a plant, animal, or fungus.
embryonic stem cell (ES Cell)
Any of the cells in the early animal embryo that differentiate during development to give rise to all the kinds of specialized cells in the body. Embryonic stem cells can divide indefinitely, and under the right conditions - such as the presence of certain growth- stimulating proteins- can (hypothetically) develop into a wide variety of different specialized cells.
Chapter 13 How Populations Evolve
April 14, 2022 1:09
Chapter 15 The Evolution of Microbial Life
April 15, 2022
Chapter 11 How Genes Are Controlled
April 26 9:01 AM
Chapter 12 DNA Technology
April 27, 2022
The prokaryotic group that tends to inhabit extreme environments belongs to ________.
Archaea
Which prokaryotic group is most closely related to eukaryotes?
Archaea
What do Prokaryotes also produce?
metabolic waste products that may eventually pollute the colony's environment.
13.7 Compare the processes of artificial selection and natural selection.
Artificial- selective breeding to produce desirable traits. Has components of variation and inheritability. Natural- survival of the fittest, modifies over a longer period of time.
How does a biofilm develop into a city of microbes?
As a biofilm becomes larger and more complex; it develops into a city of microbes. Communicating by chemical signals, members of the community engage in division of labor, including defense against invaders, among other activities.
What is the Ecological Impact of Prokaryotes?
As a result of their metabolic diversity, prokaryotes perform a variety of ecological services that are essential to our well-being
DNA profiling can provide evidence of guilt or innocence
As of 2017, lawyers at the Innocence Project, a non profit legal organization in New York City, have helped to exonerate more than 350 convicted criminals, including 20 who were on death row. The average sentence served by those who were exonerated was 14 years. In nearly half of these cases, DNA profiling has also identified the true perpetrators.
The human genome sequenced by government-funded scientists was actually a reference genome compiled from a group of individuals
As of today, the complete genomes of many individuals have been completed. Whereas sequencing the first human genome took 13 years and cost $100 million, we are rapidly approaching the day when an individuals genomes can be sequenced in a matter of hours for less than $1,000.
Safety and Ethical issues
As soon as scientist realized the power of DNA technology, they began to worry about potential dangers. Early concerns focused on the possibility of creating hazardous new disease-causing organisms. What might happen, for instance, if cancer-causing genes were transferred into infectious bacteria or viruses? To address such concerns, scientists developed a set of guidelines that have become formal government regulations in the United States and some other nations
Genome sequences have been determined for cells from several cancers, for ancient humans, and for the many bacteria that live in the human intestine
As the ultimate repository of the genetic information from which all of life's inherited characteristics develop genomes hold the key to our genetic identity.
The fauna and flora of Australia are very different from those of the rest of the world. Why might this be true?
Australia has been isolated for about 50 million years.
What are the three domains life is organized into?
Bacteria, Archaea, and Eukarya
What are Bacterial infections responsible for?
Bacterial infections are responsible for about half of all human diseases, including tuberculosis, cholera, stis, and certain types of food poisoning.
Why is the human brain proportionally larger than the chimpanzee brain?
Because growth of the organ is switched off much later in human development.
Pig and Cow insulins
Because human insulin is not readily available, diabetes was historically treated using insulin from cows and pigs. Pig and cow insulins can cause allergic reactions in people because their chemical structures differ slightly from that of human insulin. In addition, by the 1970s, the supply of beef and pork pancreas available for insulin extraction could not keep up with the demand.
Ethicality in Adult Stem Cells
Because no embryonic tissue is involved in their harvest, adult stem cells are less ethically problematic than embronic stem cells. However, many researchers hypothesize that only embronic stem cells are likely to lead to groundbreaking advances in human health because they are more versatile. Recent research has shown that some adult cells, such as human skin cells, may be reprogrammed to act like embryonic stem cells. In the near future, such cells may prove to be both therapeutically useful and ethically clear.
Systems Biology impact
Because of the vast amounts of data generated in these types of studies, advances in computer technology and bioinformatics have been crucial in making systems biology possible
Why are protists unicellular?
Because their cells are eukaryotic, even the simplest protists are much more complex than any prokaryote.
What ways can the reproductive isolation characterize different species?
Behavioral mechanisms, temporal isolation, mechanical isolation.
12.12 Evaluate the potential benefits, risks, and concerns of producing genetically modified foods.
Benefits: 1.Imparts increased tolerance to herbicides. 2. Imparts insect resistance 3. Imparts increased tolerance for heat, cold or drought conditions 4. Increase crop yield 5. Increases the nutrient content of the crop yield. Risks: 1. GM foods have been linked to toxicity and allergic reactions.Genetic modifications often includes proteins not present in the original organism which can cause allergic reactions in humans who consume it. 2. Some GMO have genes that confer antibiotic resistance, consuming such GMOs may lead to transfer of these antibiotic resistance genes to our gut flora-making them resistant too, 3. Genes may migrate, for example if herbicide resistance gene migrates from the host plant or organism and got into weeds confering them herbicide resistance as well. This kind of gene transfer can impose problems as we cannot predict the fate of the gene being incorporated in our system via these GM products. 4. Also those who produce GM foods get patents for these products and these products are then not available to general public at reasonable cost.this is also one of the major issue regarding cost and distribution of GM foods.
What are Biofilms affect against humans
Biofilms are common among bacteria that cause disease in humans. For instance, ear infections and urinary tract infections are often the result of biofilm-forming bacteria. Biofilm of harmful bacteria can also form on implanted medical devices such as catheters, replacement joints, and peacemakers.
What can Biofilms form on?
Biofilms can form on almost any type of surface, such as rocks, organic material, metal, and plastic
What is hybrid breakdown?
In other cases, the first generation hybrids are viable and fertile, but when these hybrids mate with one another or with either parent species, the offspring are feeble or sterile.
Which of the following organelles were likely generated through symbiosis?
mitochondria and chloroplasts
13.9 Explain the role of mutation and sexual reproduction in the evolution of life.
Both are random. Mutations are changes in the nucleotide sequence of DNA. New mutations change gene pool by replacing alleles with new ones which will eventually become significant. Sexual recombination includes the shifting of alleles during meiosis. Alleles pass on through generations and eventually evolve through generations. But all of the offspring are unique.
What events can lead to genetic drift?
By chance, this volcano kills more brown beetles than green beetles, causing the frequency of the green allele to increase.
Comparisons with human DNA revealed that we share 96% of our genome. Genomic scientists are currently finding and studying the important differences, shedding scientific light on the age0old question of what males up humans
By comparing humans with related species both living (chimpanzees) and extinct (neanderthals) researchers are shedding light on the recent evolutionary history of our own people.
Why compare ingroup and outgroup?
By comparing members of the ingroup with each other and with the outgroup, we can determine what characters distinguish the ingroup from the outgroup.
How do Prokaryotes living in the soil and at the bottom of lakes, rivers, and oceans help to decompose dead organisms and other waste materials?
By returning vital chemical elements such as nitrogen to the environment
Which of the following lists geologic periods in the correct order, from oldest to most recent.
Cambrian, Permian, Cretaceous, Quaternary
A new DNA gene editing technique uses a bacterial enzyme called__________ to cut any double-stranded DNA sequence that is complementary to an associated molecule of guide RNA.
Cas9
11.5 What is the significance of cell signaling and homeotic genes in multicellular organisms?
Cell signaling allows for specialization of groups of cells. Multiple cell types can join together to form tissues. Homeotic genes helps us understand that they all arose from a single ancestral gene that duplicated multiple times.
What do cells use DNA packing for
Cells may use DNA packing for the long-term inactivation of genes. One intriguing case is seen in female mammals, where one x chromosome in each somatic cell is highly compacted and almost entirely inactive. This x chromosome inactivation first takes place early in embryonic development, when one of the two x chromosomes in each cell is inactivated at random. After one x chromosome is inactivated in each embryonic cell, all of that cells descendants will have the same x chromosome turned off. Consequently, if one x chromosome in the embryonic cell has one allele and the other has a different allele, about half of the cells descendants will express one allele, while the other half will express the other allele.
What is gene flow?
Changes in its allele frequencies caused by genetic drift and natural selection will not be diluted by alleles entering from other populations
What pigment do all algae (as well as plants) possess?
Chlorophyl
What does the cladistics approach to phylogeny clarify?
Clarifies evolutionary relationships that were not alway apparent in other taxonimic classifications. For instance, biologists tratitionally placed birds and reptiles in separate classes of vertebrates.
Although bacteria can produce many human proteins, some proteins can only be made by eukaryotic cells, such as cells from fungi, animals, and plants
Common bakers yeast is currently used to produce proteins used as medicines, including the hepatitis B vaccine, an antimalarial drug, and interferons used to treat cancer and viral infections. In 2015, scientists announced they had transferred 23 genes from bacteria, plants, and animals into yeast that allow the recombinant fungi to concert sugar into the painkiller drug hydrocone.
How might Darwins finch species have evolved from a small population of ancestral birds that colonized one of the islands?
Completely isolated on the island, the founder population may have changed significantly as a natural sekection it to the new environemnt, and thus it became a new species. Later, a few individuals of this new species may have migrated to a neighboring island, where, under different enviornmental conditons, this new dounfer population was changed enough through natural selection to yet another species. Some of these birds mau then have recolonized the first island and coexisted there with the original ancestral species if reproductive barriers kept the species distinct. Multiple rounds of colonozation and specation on the many separate islands of the Galapagos probably followd. Today, each of the Galapagos Isalnds has several species of finches, with as many as ten on some islands. Reproductive isolation due to species-specific mating songs help keep the species separate.
Which of the following best describes cancer cells?
Controls governing cell division have been altered.
Please read the following scenario and then answer the following question.Corn crops are susceptible to damage by different species of corn borer, an insect (a type of arthropod) that feeds and lives on corn plants. It is estimated that corn borers may cause up to $1 billion of damage a year to corn crops. Because of pests like the corn borer, researchers have created genetically modified pest-resistant crops. One type of pest-resistant crop, Bt corn, expresses a bacterial toxin that kills corn borers if they consume the toxin. While Bt corn has been planted and used in the United States since 1996, some researchers and members of the public continue to worry about negative effects of the Bt toxin on other animals, including arthropods and humans. In order to investigate the effects of Bt toxins on other animals, researchers conducted experiments where they fed arthropods Bt corn or non-Bt corn. A summary of the effects of eating Bt corn on single species of corn borer, mite, and beetle are shown in the figure below. What can you conclude from the data in the graph?
Corn borers are less likely to survive if they eat Bt corn compared to non-Bt corn.
DNA Profiling Paternity
DNA Profiling proved that Thomas Jefferson or a close male relative fathered a child with an enslaved woman, Sally Hemings.
How is "species defined by the biological species concept?"
Members of a species can potentially interbreed and produce fertile offspring.
If you were working for a pharmaceutical company trying to develop anticancer drugs, what biological process would be the best target to investigate?
mitosis
STR (Short Tandem Repeat)
DNA consisting of tandem (in a row) repeats of a short sequence of nucleotides. For example, one person might have the sequence AGAT repeated 12 times in a row at one place in the genome, the sequence GATA repreated 35 times at a second place, and soon; another person is likely to have the same sequences at the same places but with a different number if reoeats. By focusing on STRs, forensic scientists are able to compare the tiny fraction of the genome that is most likely to vary from person to person.
Gel electrophoresis separates DNA fragments because ________.
DNA fragments have different lengths
12.1 Explain how DNA profiling is used in criminal trials to establish guilt and innocence.
DNA is commonly used to clear up crimes in one in every of Ways. In instances in which a suspect is identified, a sample of that person's DNA may be in comparison to evidence from the crime scene. The effects of this assessment can also additionally assist in establishing whether or not the suspect devoted the crime.
Which enzyme "pastes" DNA fragments together?
DNA ligase
Which enzyme can be used to "glue" DNA fragments together?
DNA ligase
Which enzyme is used to bind DNA fragments together?
DNA ligase
The figure shows an electrophoresis gel which includes a DNA ladder that can be used to estimate the sizes of DNA molecules. The ladder increases in 100 nucleotide increments, from 100 to 700. Four DNA molecules have been separated on this gel (labeled A to D). Which DNA molecule is the largest?
DNA molecule B
What is the first level of control of eukaryotic gene transcription?
DNA packing and unpacking
What is the best definition for recombinant DNA?
DNA that includes nucleotides from two different sources
Ribosomes can perform some of the functions of both ________ and ________.
DNA; protein
What is an important step in identifying a prokaryote?
Determining cell shape by microscopic examination
DNA sequencing
Determining the complete nucleotide sequence of a gene or DNA segment. In a procedure called "next-generation sequencing," DNA is cut into fragments of around 300 nucleotides, and then thousands of these fragments are sequenced simultaneously. This technology is rapid and inexpensive, This is an example of "high-throughput" DNA technology, which is currently the method of choice for studies where massive numbers if DNA samples-even representing an entire genome or a collection of genomes are being sequenced.
Explain a phylogenetic tree
Each branch represents the divergence of two groups from a common ancestor, with the emergence of a lineage possessing one or more new features. The sequence of branching represents the order in which they evolved and when groups last shared a common ancestor.
microRNA (miRNA) steps
Each miRNA 1 - forms a complex with one or more proteins that can 2 bind to any mRNA molecule with at least seven or eight nucleotides of complementary sequence. If the mRNA molecule contains a sequence complementary to the full length of the miRNA, the complex 3 degrades the target mRNA. If the mRNA molecule matches the sequence along just part of the miRNA, the complex 4 blocks its translation.
What is spontaneous mutation and what do they result in?
Each time DNA is replicated prior to binary fission, spontaneous mutations occur. As a result, rapid reproduction generates a great deal of genetic variation in a prokaryotic population. If the environment changes, an individual that possesses a beneficial gene can quickly take advantage of the new conditions.
Prokaryotes
Earth's first life-form. An organism characterized by Prokaryotic cells
Identify a difference between embryonic and adult stem cells from the following list.
Embryonic stem cells are undifferentiated; adult stem cells are partially differentiated.
What are Endotoxins?
Endotoxins are chemical components of the outer membrane of certain Bacteria.
What is Giant bacterium?
Epulopiscium fishelsoni, which lives in the gut of a surgeonfish, is large enough to be seen with the unaided eye. It can grow to 10 times the size of a typical eukaryotic cell.
Gene Regulation in Eukaryotic Cells
Eukaryotes, especially multi cellular ones, have more sophisticated mechanisms than bacteria for regulating the expression of their genes. This is not suprising because a prokaryote, being a single cell, does not have different types of specialized cells, such as neurons and red blood cells. Therefore, it does not require the elaborate regulation of gene expression that leads to cell specialization in multicellular eukaryotic organisms. The Pathway from gene to protein in eukaryotic cells is a long one, providing a number of points where the process can be turned on or off, speed up or slowed down.
13.1 Explain why an understanding of evolution is essential to the study of biology.
Evolution allowed earth to become populated with an abundance of diversity. Understanding evolution informs all of biology, from exploring life's molecules to analyzing ecosystems.
What is evolutionary biology; What is development biology?
Evolutionary biology- a discipline of biology concerned with the processes and patterns of biological evolution especially in relation to the diversity of organisms and how they change over time. Development biology is the study of the process by which animals and plants grow and develop.
What is macroevolution?
Evolutionary change above the species level. Examples of macroevolutionary change include the orgin of a few groups of organisms through a series of speciation events, the impact of mass extinctions on the diversity of life, and the orgin of key adaptions.
What does Continental drift and mass extinctions provide?
Followed by the diversification of survivors, continental drift and mass extinction provide a big-picture view of how those changes came about.
Which of the following is the best description of limitations on human genome sequencing?
There are no longer substantial time or monetary constraints in the sequencing of individual genomes.
Modern Methods of DNA profiling are so specific and powerful that the DNA samples can be in a partially degraded state. Such advances are revolutionizing the study of ancient remains.
For example, a 2014 study of DNA extracted from five mummified Egyptian heads (dating from 800 B.B to 100 A.D was used to deduce the geographic origins of the mummies, as well as to identify pathogens that had infected those people before they did.
Give an example of radiometric dating
For example, a living organism contains both the common isotope carbon-12 and the radioactive isotope carbon-14 in the same ratio as that present in the atmosphere. Once an organism dies, it stops accumulating carbon, and the stable carbon-12 in its tissues does not change. Carbon-14 has a half-life of 5,73- years, so hald the carbon-14 in a specimen decays in the next 5,730 years, and so on scientists measure the ratio of carbon-14 to carbon-12 in a a fossil to calculate its age.
Give example of biogeography.
For example, almost all the animals and plants that live on Madagascar, are unique they diversified from an ancestral population after madagascar was isolated from Africa and India.
Give example of a Postzygotic barrier.
For example, although certain closely related salamander species will hybridize, the offspring fail to develop normally because of genetic incompatibilities between the two species.
DNA profiling can also help protect endangered species by proving the orgin of contraband animal products
For example, analysis of seized elephant tusks can pinpoint the location of the poaching, allowing enforcement officials to increase surveillance and prosecute those responsible. In 2014, three tiger poachers in India were sentenced to five years in jail after DNA profiling matched the dead tigers flesh to tissue under the poachers fingernails.
PCR can be used in the treatment and diagnosis of disease.
For example, because the sequence of the genome of HIV is known, PCR can be used to amplify, and thus detect, HIV in blood or tissue samples. In fact, PCR is often the best way to detect this otherwise elusive virus. Medical scientists can now diagnose hundreds of human genetic disorders by using PCR with primers that target the genes associated with these disorders. The amplified DNA product is then studied to reveal the presence or absence of the disease-causing mutation
Give example of hybrid breakdown
For example, different species of rice plants can produce fertile hybrids, but the offspring of the hybrids do not survive.
How can you find the MRNA by building a nucleic acid probe a short, synthetic, single-stranded polynucleotide?
For example, if part of the sequence on the mRNA of interest is CUCAUCAG then a single-stranded proble could contain the sequence GAGTAGTG. The probe molecule is labled with a fluorescent tag, allowing for identification of all cells expressing the gene of interest-theyre the ones that are glowing under the microscope!
How may our improved understanding may lead to important clinical applications?
For example, in 2004 , researchers discovered a particular miRNA that is essential for the proper functioning of the pancreas. Without it, insulin-producing beta cells die, which can lead to diabetes.
How do researchers take advantage of siRNAs to artificially control gene expression?
For example, injecting siRNA into a cell can turn off expression of a gene with a sequence that matches the siRNA. siRNA therefore allows researchers to disable specific genes in order to investigate their functions.
As more information becomes available about our personal genetic makeup, some people question whether greater access to this information is alway beneficial
For example, mail-in kits have become available that can tell healthy people their relative risks of developing various diseases (such as Parkinson's and Crohn's) later in life. Some argue that such information helps families prepare. Others worry that the tests prey on our fears without offering any real benefit because certain diseases, such as Parkinson's, are not currently preventable or treatable. Other tests, however, such as for breast cancer risk, may help a person make changes that can prevent disease. How can we identify truly useful tests?
What are practical application of phylogeny?
For example, maize is an imprtant food crop worldwide; it also provides us with snacks!
Give example on how Extinctions provide organisms with new environmental opportunities.
For example, mammals existed for at least 75 million years before undergoing an explosive increase in diversity just after the cretaceous period. Their rise to prominence was undoubtedly associated with the void left by the extinction of the dinosaurs. The world would be a very different place today if many dinosaur lineages had escaped the cretaceous extinctions or if none of the mammals had survived.
What role do Prokaryotes play in chemical cycles?
For example, nearly all the nitrogen that plants use to make proteins and nucleic acids come from prokaryotic metabolism in the soil. In turn, animals get their nitrogen compounds from plants.
How have biologists identified hundreds of restriction enzymes, each recognizing a particular short DNA sequence, usually four to eight nucleotides long?
For example, one restriction enyzme only recognizes the DNA sequence GAATTC, wheras another recognizes CGATCC
Many operons have been identified in bacteria. Some are quite similar to the lac operon, Whereas others have somewhat different mechanisms of control.
For example, operons that control amino acid synthesis cause bacteria to stop making these molecules when they are already present in the environment, saving materials and energy for the cells. In these cases, the amino acid activates the repressor. Armed with a variety of operons, E coli and other prokaryotes can thrive in frequently changing environments.
11.11 Can animal avatars be used to treat cancer patients? Explain.
Mice are used the most in cancer avatar research. The mices are used to test chemotherapies against an individuals tumor. The purpose of mice as avatars is to tailor a treatment plan for the individuals specific cancer.
What is microevolution?
Microevolution is a change in allele frequencies in a population over a span of generations
What approaches are combing to remodel phylogenetic trees and challenge traditional classifications?
Molecular systematics and cladistics
Practical applications
For example, proteins associated with specific diseases may be used to aid diagnosis (by developing tests that search for a particular combination of proteins) and treatment (by designing drugs that interact with the proteins involved). As high-throughput techniques become more rapid and less expensive, they are increasingly being applied to the problem of cancer. The cancer Genome Atlas Project is simultaneous investigation by multiple research terms of a large group of interacting genes and gene products. This project aims to determine how changes in biological systems lead to cancer. A three-year pilot project set out to find all the common mutations in three types of cancer-living, ovarian, and brain-by comparing gene sequences and patterns of gene expression in cancer cells with those in normal cells. The results confirmed the role of several genes suspected to be linked to cancer and identified in few previously unknown ones, suggesting possible new targets for therapies. The research approach proved so fruitful for these three types of cancer that the project has been extended to ten other types of cancer, chosen because they are common and often lethal in humans.
Controversy about the safety of these foods is a significant political issue
For example, the European union has suspended the introduction into the market of new GM crops and considered banning the import of all GM food. In the United States and other nations where the gm revolution initially proceeded relatively unnoticed, mandatory labeling of GM foods is now being debated.
DNA technologies can also identify causes of illnesses
For example, the centers for Disease Control and prevention regularly uses DNA technology to identify the precise strain of bacteria that is causing a food poisoning outbreak, allowing officials to implement food safety measures
What are the final opportunities for regulation gene expression occur after translation
For example, the hormone insulin is synthesized as one long, inactive polypeptide that must be chopped into pieces before it comes active. Other proteins require chemical modificaiton before they become active.
How can researchers study the expression of groups of genes?
For example, they can invest: gate which genes are active in different tissues (such as cancerous versus normal) or at different stages if development.
Food choice that significantly reduces a persons odds of developing cacer
For instance, eating 20-30g of plant fiver daily (about the amount found in seven apples), while eating less animal fat, may help prevent colon cancer. There is also evidence that certain substances in fruits and vegetables, including vitamins C and E and certain compounds related to vitamin A, may help protect against a variety of cancers. Cabbage and its relatives, such as broccoli and cauliflower, are thought to be especially rich in substances that help prevent cancer.
How is plant cloning now used extensively in agriculture?
For some plants, such as orchids, cloning is the only commercially practical means of reproducing plants. In other cases, cloning has been used to reproduce a plant with specific desirable traits, such as high fruit yield or resistance to disease.
What are Fossils?
Fossils are evidence of organisms that live in the past. The strata (layers) of sedimentary rocks provide a record of life on Earth each rock layer contains a local sample of the organisms that existed at the time the sediment was deposited.
13.5 Explain how the fossil record and homologies are evidence for evolution and why fossils represented a problem for the idea of fixed, permanent species.
Fossils document the similarities and differences between past and present organisms, also showing extinction. Homologies show how related species form an ancestral organism change over time by natural selection. fossils contradict the idea of a fixed species because fossils don't match any living creature
The treatment cured the patients of SCIA, but there was serious side effects
Four of the treated patients developed leukemia, and one died after the inserted gene activated an oncogene, creating cancerous blood cells
gene therapy curing children
From 2000 to 2011, gene therapy cured 22 children with severe combined immunodeficiency (SCID), a fatal inherited disease caused by a defective gene that prevents development of the immune system, requiring patients to remain isolated within protective bubbles. Unless treated with a bone marrow transplant, which is effective only 60% of the time, SCID patients quickly die from infections that most of is easily fend off. In these cases, researchers periodically removed immune system cells from the patients blood infected them with a virus engineered to carry the normal allele of the defective gene, then reinjected the blood into the patient.
Today, most public concern about possible hazards centers on genetically modified (GM) foods.
GM strains account for a significant percentage of several staple crops in the United States, Argentina, and Brazil; together, these nations account for more than 80% of the world's supply of GM crops.
What is gene flow?
Gene flow describe evolution due to individuals moving into or out of a population
What does it mean to say that genes are turned on or off?
Genes determine the nucleotide sequence of specific MRNA molecules, and mRNA in turn determines the sequence of amino acids in proteins. A gene that is turned on is being transcribed into mRNA and that mesage is being translated into specific proteins.
Genetic variety is a necessary ingredient for the adaptation of a species as environmental conditions change with time
Genes that are damaging under some conditions may be advantageous under others. Are we willing to risk making genetic changes that could be detrimental to our species in the future?
What is Genetic Drift?
Genetic Drift occurs when populations evolve due to chance events. In a small population, chance events produce large fluctuations in allele frequencies from one generation to the next. Genetic drift also occurs in large populations. But in a large population, genetic drift has less effect because it causes much smaller fluctuations in allele frequencies.
What is the most obvious difference between a moss and a fern? What do ferns have that mosses don't that accounts for this difference?
Mosses are small and grow on the ground. Ferns group up and are larger. Ferns have roots and a vascular system, moss does NOT
12.2 Define the terms genetic engineering, genetically modified organism, and transgenic organism and give examples of each.
Genetic Engineering with examples: process of the use of rDNA (recombinant DNA) tech to alter the genes of an organism. So genetic engineering is when a scientists tweaks a set of genes to create a more desirable organism. Ex: Cloning of mushrooms via mushrooms spores from the gills. Genetically Modified Organism with examples: Genetically modified organisms (GMOs) are those organisms whose genomes have been altered using genetic engineering technology. They have novel combinations of genes that do not occur in natural populations of the speciesIt may include adding genes in, or silencing genes. GMOs should have genes that are heritable. Ex: Agricultural crops are genetically modified to improve growth rates, yield, and nutrients in the crops. Transgenic Organism with examples: Transgenic organisms are a specific example of GMO. They are when the alteration to the genome involves the genetic material from a different species. For example GloFish have genes added in from sea anemones and are therefore considered transgenic
13.12 Distinguish between the following concepts: genetic drift and gene flow; the bottleneck effect and the founder effect; directional selection, disruptive selection, and stabilizing selection; sexual selection and natural selection.
Genetic drift- change in gene pool of population due to chance. Gene flow- genetic exchange with another population from the loss or addition of alleles. Bottleneck- drastic reduction in pop size. Founder- Few individuals colonize an isolated habitat. Directional- selects one extreme phenotype. Disruptive- Both extreme phenotypes. Stabilizing- Favors intermediate phenotype. Sexual- certain traits are more likely to get an organism to reproduce. Natural- survival of the fittest.
Genetic engineering morality concerns
Genetic engineering of gametes (sperm or ova) and zygotes has been accomplished in lab animals. It has not been attempted in humans because such a procedure raises very difficult ethical questions, should we try to eliminate genetic defects in our children and their descendants? Should we interfere with evolution in this way? From a long-term perspective, the elimination of unwanted versions of genes from the gene pool could backfire.
According to one hypothesis, 16 million Asian men may have a similar Y chromosome to Genghis Khan. What must have happened in order for this to occur?
Genghis Khan or his descendants must have fathered many sons.
13.4 Explain how Darwin's voyages on the Beagle influenced the development of his thoughts on evolution (natural selection), including how Lyell's ideas impacted Darwin's thinking, and the publication of Darwin's work, On the Origin of Species.
His observations noticed that geographic proximity is a better predictor of relationships among organisms than similarity of environments. Lyell theorized that geologic processes that were around at the beginning of time were the same ones that were happening in the present as well and that they worked the same way. Darwin witnessed the power of natural forces to change earth's surface when he experienced an earthquake that raised chile's coast by one meter.
13.6 Explain how evolutionary trees are constructed and what they represent.
Homologous structures are used to determine branching sequencing. Patterns of descent branch off from one common trunk. At each fork there is an ancestor common to all evolutionary branches extending from it. They represent hypotheses.
12.11 Explain how applied genomics and systems biology are used to make new biological discoveries.
How can systems biology be used to make new biological discoveries? For example, proteins associated with specific diseases may be used to aid diagnosis by developing tests that search for a particular combination of proteins and treatment by designing drugs that interact with the proteins involved. Systems biology is a very efficient way to study emergent properties, novel properties that arise at each successive level of biological complexity as a result of the arrangement of building blocks at the underlying level. The more we can learn about the arrangement and interactions of the components of genetic systems, the deeper will be our understanding of whole organisms will be. How can applied genomics be used to make new biological discoveries? Applied genomics can be used to make new biological discoveries via; diagnostic testing, clinical predictive testing, pharmacogeomic testing, and tumor testing. For example, solving the mystery of Nic Volkers rare mutation involved the latter of steps!
12.6 Explain how the polymerase chain reaction (PCR), short tandem repeat (STR) analysis, and gel electrophoresis are used in DNA profiling, the treatment and diagnosis of disease, and the investigations of crime, paternity, and ancient DNA.
How is the Polymerase chain reaction (PCR) used in DNA profiling? Small quantities of DNA are often recovered from samples (forensic samples, cheek swabs, etc.). The polymerase chain reaction amplifies the DNA so that there is enough DMA for the analysis to proceed. It is also used to selectively amplify specific regions of DNA for the investigation to quickly make copies of selected segments of the available DNA. How is short tandem repeat (STR) analysis used in DNA Profiling? -It is a technique that simultaneously detects more than one STR in one DNA analysis. It is vital to DNA profiling because the more STRs a scientist can characterize, the better chance that they originated from the same individual. How is gel electrophoresis used in DNA profiling? Gel electrophoresis is the method of separation of DNA based on its charge. Since the DNA is negatively charged, the DNA will move from the negative electrode to the positive electrode, and the speed of the movement of the DNA fragments depends upon the size of the fragments. The smaller fragments move faster than, the larger fragment, thereby separating the fragments, which are visualized as bands on the gel under UV light. This creates a unique pattern for the DNA sample. DNA fingerprinting, also known as DNA profiling, is the method of comparing the two DNA samples. This is based on the principle that 99.9% of the human DNA is the same while there are variations in the 0.1% of the DNA. Human satellite DNA shows the short-term variable repeats (VNTRs), different in every individual. Therefore on the treatment of the DNA sample with the restriction enzymes, the cleavage sites of every sample will be other and result in different sets of fragments. So when the two samples of DNA are treated with restriction enzymes, they will result in a different pattern on the Gel electrophoresis if they are from an additional source. The same way will be observed if the sample of DNA is from the same source. This DNA fingerprinting method is used in crime investigation to compare the DNA sample collected from the investigation site with the suspects or Paternity or maternity disputes. Note: The application of DNA fingerprinting is as follows. 1) It can be used for paternity and maternity tests. 2) It helps in criminal investigations - even a small blood sample can help in an investigation. 3)It helps in person identification. How does Polymerase chain reaction (PCR) treat and diagnose diseases? PCR 9polymerase chain reaction) tests are a fast, highly accurate way to diagnose certain infectious diseases and genetic changes. The tests work by finding the DNA or RNA of a pathogen (disease-causing organism) or abnormal cells in a sample. How does short tandem repeat (STR) analysis treat and diagnose diseases? Tests can dial on diseases that are caused by errors in genetic features. Some people's STR sequences in specific genes are too lengthy, causing str expansion disorders. Treatments are limited, but the sooner a patient is diagnosed, the sooner they can be potentially healed. How does gel electrophoresis treat and diagnose diseases? Electrophoretic separation of differently sized fragments allows the characterization or typing of normal variants known to be genetically linked to disease. What does the polymerase chain reaction (PCR) have to do with investigations of crime? With PCR, crime scene investigators can edit traces of DNA into amounts that can be linked and identified to an individual suspect. Biologists can produce copies of individual genes to study evolution, gene function, and other topics. What does Short tandem repeat (STR) analysis have to do with investigations of crime? -Forensic uses. STR analysis is a tool used in forensic analysis that evaluates specific STR regions found on nuclear DNA. The variable (polymorphic) nature of the STR regions analyzed for forensic testing intensifies the discrimination between one DNA profile and another. What does gel electrophoresis have to do with investigations of crime? Gel electrophoresis creates DNA fingerprints from crime scenes and suspects samples. A match between samples provides evidence of which suspect committed the crime. What does the polymerase chain reaction have to do with paternity? Scientists can produce and replicate DNA copies in minimal quantities to determine paternity via PCR. What does the short tandem repeat (STR) analysis have to do with paternity? -Forensic DNA profiling utilizes autosomal short tandem repeat (STR) markers to establish or identify missing persons, confirm familial relations, and link persons of interest to crime scenes. It is widely accepted that genetic markers used in forensic applications are not predictive of phenotype. What does gel electrophoresis have to do with paternity? Gel electrophoresis is used in paternity testing by examining and comparing DNA from a known child to the DNA of male/s. This process is done when the biological father is unknown. What does the polymerase chain reaction have to do with ancient DNA? Multiplex autosomal short tandem repeat (STR) genotyping enables researchers to obtain genetic information from ancient human samples.
14.5 Explore how human activities create opportunities for hybridization that would not otherwise exist.
Human activities such as artificial selection create hybrids such a dogs that would never exist without selective breeding.
15.1 Describe how microbial communities affect health, especially when they are disrupted.
Humans are covered in microbial communities - acquired during the first two years of life. Modern life takes a toll on them - antibiotics, purifying water, sterilizing food, etc. Disrupting our microbial communities may increase susceptibility to infectious disease, predispose thus o cancer, and contribute to conditions like asthma, IBS, Crohn's, & autism.
13.13 Explain how humans are contributing to the increase in antibiotic-resistant bacteria.
Humans overuse and misuse antibiotics such as adding antibiotics to animal feed, doctors overprescribing it, and humans not taking the full course, allowing mutant bacteria to reproduce and survive to eventual lead to future generations being resistant.
The genomes of thousands of species have been published, and tens of thousands more are in progress. The majority of organisms sequenced are prokaryotes, including more than 4,000 bacterial species and nearly 200 archaea
Hundreds of eukaryotic genomes - including protists, fungi, plants, and animals both invertebrate and vertebrate have been completed
There is also a danger that information about disease-associated genes could be abused
One issue is the possibility of discrimination and stigmatization. In response, the US Congress passed the Genetic Information Nondiscrimination Act of 2008. Title 1 of the act prohibits insurance companies from requesting or requiring genetic information during an application for health insurance. Title 2 provides similar protections in emplpyment.
Insulin functions
as a hormone and helps regulate the level of glucose in the blood. If the body fails to produce enough insulin, the result is type 1 diabetes.
Read the following scenario to answer the following question.Endotoxins are commonly found in the air, both inside and outside our homes. These "air endotoxins" can come from sources that include house dust mites, agricultural and industrial dust, and dust from indoor pets. Air endotoxins are typically found in low amounts, but production of them can increase dramatically under specific environmental conditions such as dampness, mold, and sewage. Many scientific studies have been conducted investigating possible links between indoor endotoxin levels and asthma, chronic bronchitis, and other upper respiratory diseases. Interestingly, some studies have found positive correlations between indoor endotoxin exposure and severity of some of these diseases while other studies have suggested that some air endotoxin exposure can actually decrease the risk of developing asthma in children. Additionally, data suggest that industrial workers who are exposed to endotoxins in the air can develop irreversible lung damage.In 2005, Hurricane Katrina devastated the eastern coastline of the United States. The state of Louisiana, and in particular the city of New Orleans, experienced tragic loss of human life and homes due to the failure of the levee system. Intense flooding destroyed homes and created severe exposure to wet, moldy surfaces. At that time there were no regulations in existence on the amount of exposure that individuals should have to air endotoxins. Scientists from the Natural Resources Defense Council who wanted to determine if endotoxin levels had risen in New Orleans conducted tests across 12 outdoor areas, 9 of which had been significantly flooded while the other 3 were less affected. Two indoor areas were also sampled for endotoxin levels. No significant differences were found in endotoxin levels between the flooded and non-flooded areas or between the indoor and outdoor areas. However, a limited number of samples were collected, and they were taken after a recent dry spell. Endotoxin levels at all sites were found to be higher than national average levels but were lower than levels typically associated with long-term changes in lung function. What is an implication of the fact that tests were conducted after a period of dry weather?
If more periods of rainfall occur after the testing, bacteria that secrete endotoxins may increase, thereby increasing endotoxin levels.
Similarly, advances in genetic profiling raise privacy issues
If we were to create a DNA profile for every person at birth, then theoretically we could match nearly every violent crime to a perpetrator because it is virtually impossible for someone to commit a violent crime without leaving behind DNA evidence. But are we, as a society, prepared to sacrifice our genetic privacy, even for such worthwhile goals? In 2014, the US Supreme Court, by a 5-4 vote, upheld the practice of collecting DNA samples from suspects at the time of their arrest. Ruling that obtaining DNA is "like fingerprinting and photographing, a legitimate police booking procedure that is reasonable under the Fourth Amendment, "the supreme court decision will likely usher in an era of expanded use of DNA profiling in many aspects of police work.
Scientists biotechnology
In 1978, scientists working at a biotechnology company chemically synthesized DNA fragments and linked them to form the two genes that code for the two polypeptides that make up human insulin. They then inserted these artifical genes into E. Coli host cells. Under proper growing conditions, the transgenic bacteria cranked out large quantities of the human protein. In 1982, Humulin hit the market as the world's first genetically engineered pharmaceutical product. Today, it produced around the clock in gigantic fermentation vats filled with a liquid culture of bacteria. Rach day, more than 4 million people with diabetes use the insulin collected, purified, and packaged at such facilities.
gene therapy results in...
In 2009, an international research team conducted a trial that focused on a form of progressive blindness linked to a defect in a gene responsible for producing light-detecting pigments in the eye. The researchers found that an injection of a virus carrying the normal gene into one eye of affected children improved vision in that eye, sometimes enough to allow normal function, without significant side effects. The other eye was left untreated as a control.
DNA profiling can also be used to identify murder victims
In 2010 for example, DNA analysis was used to identify the remains of war crime victims who had been buried in mass graves in bosnia 15 years earlier.
Replacing genes in Cows
In 2015, researchers replaced a gene in dairy cows with one from Angus cattle to produce cattle that lack horns, saving the bulls from painful dehorning
In what way is genomics beginning to provide information for treatment of a potentially wide variety of diseases based on the genetic makeup of each patient?
In a few cases, such as some specific kinds of breast cancer, genomics has allowed doctors and patients to specifically select drugs that are effective in treatment of a particular genetic variant of a disease.
Growing insect-resistant plants reduces the need for chemical insecticides
In another example, modified strawberry plants produce bacterial proteins that act as a natural antifreeze, protecting the delicate plants from the damages of cold weather.
Comparison prokaryotes and eukaryotes
In both prokaryotes and eukaryotes, regulatory proteins bind to DNA and turn the transcription of genes on and off.
What is genus (the first part of binomial)?
In classification, the taxonomic category above species the first part of a species binomial; for example, Homo
Just how reliable is a genetic profile?
In forensic cases using STR analysis with the 13 standard sites, the probability of two people having identical DNA Profiles is somewhere between one chance in 10 billion and one in several trillion. Thus, despite problems that can still arise from insufficient data, human error, or flawed evidence, genetic profiles are now accepted as compelling evidence by legal experts and scientists alike.
How do mutations in multicellular organisms work?
In multicellular organisms, however, only mutations in cells that produce gametes can be passed to offspring and affect a populations genetic variability.
Which of the following is a valid difference between embryonic stem cells and the stem cells found in adult tissues?
In nature, only embryonic stem cells give rise to all the different types of cells in the organism.
What are the two distinct forms of polypoid speciation?
In one form, polyploidy arises from a single parent species. For example, a failure of cell division might double the chromosome number from the original diploid number (2n) to tetraploid (4n). Because the polyploid individual cannot produce fertile hybrids with its parent species, immediate reproductive isolation results. A second form of polyploid speciation can occur when two different species interbreed and produce hybrid offspring.
What does the fossil record say about the time frame for speciation-the length of time between when a new species forms and when its populations diverge enough to produce another species?
In one survey of 84 groups of plants and animals, the time for speciation ranged from 4,000 to 40 million years. Such long time frame tells us that it has taken vast spans of time for life on Earth to Evolve.
11.4 Compare transcriptional regulation in eukaryotes and prokaryotes and explain how transcription is regulated in eukaryotes.
In prokaryotes : they lack nucleus, DNA is found in the cytoplasm. RNA transcription and protein formation occur almost simultaneously . Gene expression is regulated primarily at the transcriptional level. In eukaryotes - they contain nucleus. DNA is confined to the nuclear compartment. RNA transcription occurs prior to protein formation, and it takes place in the nucleus. Translation of RNA to protein occurs in the cytoplasm. Gene expression is regulated at many levels (epigenetic, transcriptional, nuclear shuttling, post transcriptional translational and post translational). Transcriptional regulation in eukaryotes. Control of gene expression is far more complex in eukaryotes than prokaryotes. Expression of eukaryotic gene is controlled primarily at the level of initiation of transcription Transcription in prokaryotes is controlled by proteins that bind to specific regulatory sequences and modulate the activity of RNA polymerase. It is accomplished by multiple different transcriptional regulatory proteins. In addition, the packaging of DNA into chromatin and its modification by methylation impact further levels of complexity to the control of eukaryotic gene expression.
Operator
In prokaryotic DNA, a sequence of nucleotides near the start of an operon to which an active repressor can attach. The binding of a repressor prevent RNA polymerase from attaching to the promoter and transcribing the genes of the operon. The operator and protein together determine whether RNA polymerase can attach to the promoter and start transcribing the genes (light blue). In the lac operon, when the operator switch is turned on, all the enzymes needed to metabolize lactose are made at once.
practical applications of reproductive cloning
In research, genetically identical animals can provide perfect "control animals" for experiments. The pharmaceutical industry is experimenting with cloning animals for potential medical use. For example, researchers have produced pig clones that lack a gene for a protein that can cause immune system rejection in humans. Organs from such pigs may one day be used in humna patients who require life-savind transplants. Other animals (such as dogs and cats) are cloned to serve as pets. Reproductive cloning is to restock populations of endangered animals. Some of the rare animals that have been cloned are asian cows and asian ox.
How have subpopulation become to be a process of sympatric speciation?
In some cases, subgroups of a population become adapted for exploiting food sources in different habitats, such as the shallow versus deep habitats of a lake.
How does behavioral isolation prevent interbreeding between members of closely related species?
In some species, potential mates are recognized by signals such as color or dance moves or a song. Without the appropriate signals, mating doesn't happen.
What is mechanical isolation?
In still other cases, the reproductive structures of different species are physically incompatible.
Governments and regulatory agencies throughout the world are grappling with how to facilitate the use of biotechnology in agriculture, industry, and medicine while ensuring that new products and procedures are safe.
In the United States, all genetic engineering projects are evaluated for potential risks by a number of regulatory agencies, including the Food and Drug Administration, the Environmental Protection Agency, the National Institutes of Health, and the Department of Agriculture.
transcription factor
In the eukaryotic cell, a protein that functions in initating or regulating transcription. Transcription factors bind to DNA or to other proteins that bind to DNA.
The animals and plants of India are almost completely different from the species in nearby Southeast Asia. Why might this be true?
India was a separate continent until relatively recently.
Imagine a scenario in which part of a population of South American finches is blown by a storm onto an island offshore and manages to survive and reproduce there for a period of 10,000 years. After that period, a climate change results in lower sea levels and the reconnection of the island with the mainland. Members of the formerly isolated island finch population can now interact freely with members of the original mainland population. Which of the following observations would, by itself, lead you to conclude unequivocally that the island finch population had evolved into a distinct species?
Individuals from the different populations sometimes mate with each other, but all of the resulting eggs are sterile.
An individual protist mixotroph loses its chloroplasts yet continues to survive. Which of the following most likely accounts for its continued survival?
It is able to take in organic material from the environment.
Which statement about the voyage of the Beagle is TRUE?
It turned into a tremendous opportunity for Darwin to collect fossils, plants, and animals.
Why is it that isolated islands, such as the Hawaiian Islands, often have many endemic species (those found nowhere else)?
Lack of gene flow between island and mainland populations can lead to genetic divergence.
What would you assume if you found RNA transcripts of lactose-utilizing genes within E. coli?
Lactose is present in the cell.
What does Life depend on?
Life depends on the recycling of chemical elements between the biological and physical components of ecosystems, and example of interactions within biological systems.
________ introduced a system for grouping species into a hierarchy of categories.
Linnaeus
Examine the relationships between the elephants in the accompanying figure. Which pair is most closely related?
Loxodonta africana and Loxodonta cyclotis
Why is Gametic isolation very important when fertilization is external?
Male and female sea urchins of many species release eggs and sperm into the sea, but fertilization occurs only if species-specific molecules on the surface of egg and sperm attach to each other.
Compare male and female pine cones by Size and Structure
Males are smaller females open to receive pollen
How can mature plants be cloned to produce genetically identical copies?
Mature plant cells can develop into all the specialized cells of an adult plant.
15.5 Describe the ways that bacteria cause disease and have been used as biological weapons.
Most pathogenic bacteria cause disease by producing a poison (endotoxin / exotoxin)Endospores of a bacterium that causes anthrax is contracted by being inhaled and antibiotics can't eliminate the toxins already in the bodyA bacterium that produces botulinum as its exotoxins blocks transmissions of nerve signals and result in paralysis of muscles needed to breath - deadliest poison bacteria can be endotoxins or exotoxins endotoxin: poisonous components of the outer membrane of certain bacteria (i.e., salmonella or bacterial mengingitismeningitis) Ea eexotoxinsss: a toxic protein secreted by certain bacteria: ie. Staph Aureus causing TSS or food poisoning ex of a biological weapon is anthrax - endospores produce exotoxin that accumulates to lethal levels in eh blood. Antibiotics kill the bacteria but can't eliminate the toxin already in the blood. i.e., C. botulinum creates poison - botulinum which blocks the transition of the nerve signals that use muscle contraction, which paroles the muscles required for breathing.
What are some of Protist habitats?
Most protists are aquatic, living in oceans, lakes, and ponds, but they are found almost anywhere there is moisture, including terrestrial habitats such as dump soil and leaf litter. Other are symbionts that reside in the bodies of various host organisms
Protists
Most protists are unicellular. But the protists also include certain large, multicellular organisms that are believed to be direct descendants of unicellular protists.
What do the three kingdoms consist of?
Multicellular eukaryotes that differ in structure, development, and how they obtain matter and energy.
What can Natural Selection do and not do?
Natural Selection cannot predict the future; it can only improve an existing structure in the context of its current use.
What causes populations to evolve?
Natural selection - individuals with inherited traits better suited to their environment survive and produce more offspring than other individuals.
13.8 Explain how natural selection is more a process of editing than a creative mechanism.
Natural selection is not goal-directed; it does not lead to perfectly adapted organisms. It is the result of environmental factors that vary from place to place and over time. A trait that is favorable in one situation may be useless—or even detrimental—in different circumstances. And some adaptations are compromises.
Natural selection and evolution are two terms that are sometimes confused, even by freshman biology students. What is the relation between natural selection and evolution?
Natural selection is one of several mechanisms of evolution.
Scientists have even begun to gather sequence data from our extinct relatives
Neanderthals (Homoneanderthalensis) appeared at least 300,000 years ago in Europe and Asia and survived until about 30,000 years ago. Modern humans (Homo Sapiens) first appeared in Africa around 200,000 years ago and spread into Europe and Asia around 50,000 years ago-meaning that modern humans and Neanderthals most likely coming led for a long time.
15.4 Explain how prokaryotes promote chemical recycling.
Nearly all nitrogen plants use comes from prokaryotic metabolism. Prokaryotes decompose organic matter and return elements to the environment in inorganic forms that can be used by other organisms Life depends on the recycling of chemical elements between the biological and physical components of ecosystems, an example of interactions within natural systems i.e., all the nitrogen plants use to make proteins come from prokaryotic metabolism in the soil breakdown of organic wastes and dead organisms
Biosafety protocol
Negotiators from 130 nations (including the United States) agreed on a Biosafety Protocol that requires exporters to identify GM organisms present in bulk food shipments and allows importing nations to decide whether the shipments pose environmental or health risks. The United States declined to sign the agreement, but it went into effect anyway because the majority of nations were in favor of it. Since then, European nations have, on occasion, refused crops from the United States and other nations for fear that they contain GM crops, leading to trade disputes.
Why Gene Regulation Matters
No organism uses all its genes all the time. Instead, Cells turn genes on and off depending on the situation. The ability to regulate genes therefore underlies all of life's processes, such as growth, metabolism, and the ability to adapt to a changing environment.
If an insecticide killed all of the insect pests in a particular population, could insecticide resistance evolve in this population?
No, because there are no remaining insects in this population to pass on beneficial alleles to the next generation.
What are the pitfalls in the search for homology?
Not all likeness is inherited from a common ancestor.
11.8 Explain how nuclear transplantation can be used to clone animals, and describe the advantages and challenges of reproductive cloning of animals.
Nuclear transplantation has two ways of cloning. One way involves replacing the nucleus of an egg with a nucleus removed from an adult body cell (Reproductive Cloning).Another way is when embryonic stem cells are removed from embryo and grow in a culture (Therapeutic Cloning).It can save a certain endangered species from becoming totally extinct. It can also conduct clinical trials and provide medical research.
repetitive DNA
Nucleotide sequences that are present in many copies in the DNA of a genome. The repeated sequences may be long or short and may be located next to each other or dispersed in the DNA
The absence of ______ in the primitive atmosphere was essential to the origin of life on Earth.
O2
What does the cyanobacterium or green algae contribute?
O2, Organic nourishment, nutrients
Cancer example
One example is the human papillomavirus (HPV), which can be transmitted through sexual contact and is associated with several types of cancer, including cervical cancer.
Like the genomes of most complex eukaryotes,
Only a small amount of total human DNA consists of genes that code for proteins, tRNAS, or RNAS. Most complex eukaryotes have a huge amount of noncoding DNA about 98.5% of human DNA is of this type. Some of this noncoding DNA is made up of gene control sequences such as promoters, enhancers, and microRNAS.
11.3 Distinguish between the lac operon and the mechanism of other operons that control amino acid synthesis in bacteria.
Operon is a unit of bacterial gene expression and regulation, including structural genes and control elements in DNA recognized by regulator gene product. Regulator gene is a gene that codes for a product that controls the expression of other genes. Structural gene is a gene that codes for any RNA or protein product other than a regulator. Lac operon and trp operon are two operons found in E. coli bacterial genome and in many other bacteria. These operon control different functions. Operon is the functional unit of prokaryotic gene expression. Lac operon is involved with the catabolic process of a sugar, but trp operon is involved in the anabolic process of an amino acid Lac operon consists of 3 structural genes and a repressor genes, but trp operon consists of 5 structural genes and a repressor gene. Lac operon gets activated in the presence of lactose, but trp operon gets deactivated in the presence of tryptophan. Lac operon does not use "attenuation" mechanism but trp operon uses "attenuation " mechanism.
Where do other nitrogen-fixing bacteria live in?
Other nitrogen-fixing bacteria live symbiotically in root nodules of plants in the legume family, a large group that includes many economically important species such as beans, soybeans, peas, and peanuts.
Genome Sequencing
Other sequenced animals include the fruitfly (Drosophila melanogaster) and lab rat (rattus norvegicus), both model organisms for genetics research. Among the sequenced plants are Arabidopis thaliana, a type of mustard plant used as a model organism, and rice coryza satival, one of the most economically important crops.
Which situation is an example of sexual selection?
Peahens choose to mate with peacocks that have the brightest tails.
Why do Plant geneticists use chemicals to induce errors in cell division?
Plant geneticists use chemicals to induce errors in cell division and generate new polyploids in the lab. By harnessing this evolutionary process, they can produce new hybrid species with desirable qualities.
11.7 Explain how and why plants are cloned.
Plants are cloned by taking a small cutting of one plant and placing it in a special liquid which allows it to take root and grow again into a genetically identical plant.This process proves that mature plant cells can reverse their differentiation and develop into all the specialized cells of an adult plant.Growers do this to ensure that they are going to get exactly the traits they desire, high fruit yield, and resistance to disease.
What are factors that can reduce gene flow in sympatric populations?
Polyploidy, habitat complexity, and sexual selection
11.13 Explain how populations of cancer cells evolve.
Populations of cancer cells evolve by selection and mutation. For example, tumors evolve my selection and mutation acting on cells in a tissue.
In which geologic era do animals first appear in the fossil record?
Precambrian
14.2 Compare the following, noting examples of each: prezygotic and postzygotic reproductive barriers; allopatric and sympatric speciation
Prezygotic Barrier- Reproductive barrier that prevents mating between species or hinders fertilization of eggs if members of different species attempt to mate. Postzygotic Barrier-A reproductive barrier that prevents development of fertile adults if hybridization occurs. Allopatric speciation - the formation of a new species in populations that are geographically isolated from one another. Sympatric speciation- the evolution of a new species from a surviving ancestral species while both continue to inhabit the same geographic region.
What do Prokaryotes decompose?
Prokaryotes decompose organic matter and, in the process, return elements to the environment in inorganic forms that can be used by other organisms. If it were not for such decomposers, carbon, nitrogen, and other elements essential to life would become locked in the organic molecules of corpses and waste products.
12.5 Evaluate the pros and cons of human gene therapy and how it can be used to treat disease.
Pros of Human Gene Therapy 1)Provides Options - potential to curse individual of a disease. 2)Only has to be given one time - currently gene therapies are given one time! 3)Long-lasting effects - potential to get rid of an individuals symptoms for life. 4)Positive effects passed down through generations - Theoretically, if you remove a faulty gene from a parent/individual, that faulty gene will NOT transfer to the kids Cons of Human Gene Therapy 1)Expensive - For example, Zolgensma a gene therapy to aid spinal muscular atrophy costs $2.1 million for the treatment! 2)Experimental - Gene therapy is new therefore success is not certain. 3)Potentially dangerous - There are 2 concerns when it comes to performance of Gene Therapy. People are worried that the gene therapy may reach other cells in which will cause harmful affects. Also people are concerned that reproductive cells could be changed and can be passed on to individuals offspring. 4)Ethical issues - privacy, consent, equity, and discrimination should be dealt with before proceeding with genetic screening, and a participant must be comfortable with the agreements of gene screening. 5)May cause infection - Its possible that the inactivated viruses could infect an individual receiving therapy. How Human Gene Therapy can be used to treat disease -Gene theapy edits the genes inside an individuals body to treat and event stop a disease
It has been suggested that the first self-replicating macromolecules were __________.
RNA
Why is RNA thought to have been the first genetic material?
RNA is capable of self-replication.
Repressors act by blocking the binding of _____ to the promoter.
RNA polymerase
Post zygotic Barriers
Reduce hybrid variability: Hybrid zygotes fail to develop or fail to reach sexual maturity. reduced hybrid fertility: Hybrids fail to produce functional gametes. Hybrid breakdown: Hybrids are feeble.
Genomic with Complex Organisms
Researchers then studied more complex organisms with much larger genomes. Bakers yeast (sacch or omyces cerevisiable) was the first eukaryote to have its full sequence determined, and the roundworm caenorhabditis elegans was the first multicellular organism
Of these steps, which one occurs earliest in the process of producing recombinant DNA?
Restriction enzymes are used to isolate the gene of interest and to cut the plasmid DNA.
What is binomial?
The two-part format for naming a species; for ex, homo sapies=ns
15.7 Explain how Streptococcus mutants contributes to tooth decay and the adaptations that gave S. mutants an advantage over other species.
S. mutans produces biofilm in tooth enamel. The bacteria garments sugar to obtain energy, releasing lactic aside as a by-product which attacks enamel and eventually eats through it. Other bacteria then use the entrance and infect the soft tissue on the interior of the tooth Agriculturalagricultural tooth changes in human history caused oral microbiota diversity to drop dramatically, and S. mutant became the dominant species. We can infer that natural selection in the high-sugar environment favored S.mutans. S mutant has more than a dozen genes that improved their ability to metabolize sugars and survive increased acidity. Also, chemical weapons produced by the bacteria kill harmless bacteria - their competitors for space in the oral cavity.
Genetic engineers are targeting agricultural animals as well as plant crops
Scientists might, for example, identify in one variety of cattle a gene that causes the development of larger muscles (which make up most of the meat we eat) and transfer it to other cattle or even to chickens. Researchers have genetically modified pigs to carry a roundworm gene whose protein converts less healthy fatty acids to omega-3 fatty acids. Meat from the modified pigs contains four to five times as much healthy omega-3 fat as regular pork
What is another control mechanism operating after translation?
Selective breakdowns of proteins. Some proteins that trigger metabolic changes in cells are broken down within a few minuites or hours. This regulation allows a cell to adjust the kinds and amounts of its proteins in response to changes in its environment.
More recently, scientists have improved or replaced next-generation sequencing.
Several groups have been working on "third-generation sequencing," wherein a single, very long DNA molecule is sequenced on its own. The idea is to move a single strand of DNA through a very small pore in a membrane (a nanopore) while administering an electrical current that will detect the nitrogenous base one by one. For each type of base, the electrical current is interrupted for a slightly different length of time, allowing the base sequence to be determined nucleotide by nucleotide.
Phylogeny
Shared evolutionary history
gene-editing techniques
Similar gene-editing techniques produce improved varieties of goats for meat and cashmere wool, pigs (for agriculture and pets), and dogs. A type of Atlantic calmon has been gentically modified to reach market size in hald the normal time (18 months versus 3 years) and to grow twice as large. In late 2015, the FDA approved the sale of the GMO salmon to U.S consumers, declaring that it is as safe and nutritious as traditional salmon. Although it could be years before the GMO salmon reaches store shelves, this is the first time a transgenic animal product was allowed to be sold as food in the United States.
DNA Profiling: Investigating Murder, Paternity, and AncientDNA
Since DNA profiling was introduced in 19886, it has become a standard tool of forensics. For example, after the death of terrorist leader osama bin laden in 2011, US Special Forces members obtained a sample of his DNA. Within hours, a military lab in Afghanistan had compared the tissue against samples obtained from several of bin ladens relatives, including a sister who had died of brain cancer in a Boston hospital in 2010. Although facial recognition and an eyewitness identification provided preliminary evidence, it was DNA that provided a conclusive match, officially ending the long hunt for the notorious terrorist.
Why are moss typically located in wet and shady locations?
So there is an excess of moisture so that they wont dry out
What do heterotrophic protists eat and obtain?
Some heterotrophic protists eat bacteria of other protists; some are fungus-like and obtain organic molecules by absorption
A much broader ethical question is how do we really feel about wielding one of natures powers the evolution of new organisms?
Some might ask if we have any right to alter an organism's genes or to create new organisms. DNA technologies raise many complex issues that have no easy answers. It is up to you, as a participating citizen, to make informed choices.
What is located on the underside of the frond (leaf)?
Sori is the name of the structure holding the spores
What is speciation common?
Speciation is more common for a small, isolated population because it is more likely than a large population to have its gene pool changed substantially by both genetic drift and natural selection.
How does speciation occur?
Speciation occurs with the evolution of reproductive barriers between the isolated population and its parent population.
What are some of the physical environment and climate impacts caused by Pangaea?
Species that had been evolving in isolation came together and competed. As the landmasses joined, the total amount of shoreline was reduced. Ocean basins became deeper, lowering sea level and draining the shallow soastal seas. Then, as now, most marine species inhabited shallow waters, and the formation of Pangaea destroyed a considerable amount of that habitat. It was probably a long, traumatic period for terrestrial life as well. The interior of the vast new continent was cold and dry. Changing Ocean currents also undoubtedly affected land as well as sea life. Many species became extinct, new opportunities arrose for the survivors.
What does the fungus contribute to the relationship?
Spores, moisture, CO2
Based on the color change, what do the cotyledons contain?
Starch; since iodine stains complex sugars
Define structure and Function
Structure - Whats it made of? What it look like? Function - Whats it do ? Whats its job?
operon
Such a cluster of related genes and sequences that control them is called an operon. A unit of genetic regulation common in prokaryotes; a cluster of genes with related functions, along with the promoter and operator that control their transcription.
Thus, a bacterium can adjust its gene expression to changes in the environment
Such regulation is at the heart of metabolism, the chemical reactions that transform energy and matter within all cells.
What is bioremediation?
The use of living organisms to detoxify and restore polluted and degraded ecosystems
Define Pre zygotic Barrier using the terms Temporal, Habitat, and Behavioral isolation.
Temporal isolation: Mating or fertilization occurs at different seasons or times of day. Habitat isolation: Populations live in different habitats and do not meet. Behavioral isolation: Little or no sexual attraction exists between populations. Mechanical isolation: Structural differences prevent fertilization. Gametic isolation: Female and male gametes fail to unite in fertilization.
Consider the accompanying figure, which outlines cloning by nuclear transplantation. Why does the clone NOT resemble the surrogate mother?
The DNA for the clone comes from the genetic donor, not the surrogate.
What information about a target sequence of DNA is required to carry out polymerase chain reaction (PCR)?
The DNA sequence at the ends of the DNA to be amplified must be known.
12.9 Describe how the Human Genome Project and the field of bioinformatics can provide insights into evolutionary relationships.
The Human Genome Project, Field of Bioinformatics, and Database can provide insights into evolutionary relationships. Here is what the Human Genome Project, Field of Bioinformatics, and Databases are used for: -determine how past populations change genetically and how they migrated -used to determine when populations become extinct -serves as a comparison to understand the genomes of extinct species of humans and how those humans are related to us -being used to study the origins of genetic diseases in humans -used to study gene patterns in studies of gene-environment interaction -being used in studies of epigenetic -used in studies of active gene patterns to test if a medicine has efficacy -used to catch criminals -used to determine risks for some diseases -used to determine where in the recent past ancestors came from
What formed Pangaea?
The Permian mass extinction, at about the time the merging continents formed Pangaea, claimed about 96% of marine species and took a tremendous toll on terrestrial life as well.
What would enable a single RNA transcript to be translated into different polypeptides?
The RNA transcript can be spliced more than one way.
12.13 Describe the results of DNA profiling of the human Y chromosome.
The Y chromosome is passed down intact from father to son, so you can learn quite a bit about history from it. Scientists have learned: -nearly 16 million men currently living may be descended from Genghis Khan, -nearly 10% of Irish men were descendants of Niall of the Nine Hostages, a warlord who lived during the 1400s, and -the Lemba people of southern Africa are descended from ancient Jews.
How are the cells in different body tissues able to perform different functions?
The cells exhibit different patterns of gene expression.
What is microbiota?
The community of microorganisms that live in an on the body of an animal
Bioinformatics definition
The computational power provided by the tools of bioinformatics allows the study of whole sets of genes and their interactions, as well as the comparison of genomes from different species.
What is the biological species concept?
The definition of a species as a population or group of populations the members of which have the potential to nature to interbreed and produce fertile offspring.
genetic engineering
The direct manipulation of genes for practical purposes.
What is an example of the correlation between structure and function?
The distinctive beaks adapted for the specific diets of the different species of finches are an example of the correlation between structure and function.
What is Eukarya?
The domain of eukaryotes, organisms made up of eukaryotic cells; includes all of the protists, plants, fungi, and animals
How do endospores react in different temperatures and hospitable environments?
The endospore can survive all sorts of trauma and extreme temperatures-not even boiling water kills most of these resistant cells. And when the environment becomes more hospitable, the endospore can absorb water and resume growth.
What is convergent evolution?
The evolution of similar features in different evolutionary lineages, which can result from living in very similar enviornments
What is phylogeny?
The evolutionary history of a species or group of related species.
What helps explain the observation that cancers can run in families
The fact that multiple genetic changes are required to produce a full-fledged cancer.
Lichens are important ecologically as pioneer species. What is a pioneer species?
The first species to inhabit a barren land
What is allopatric speciation?
The formation of a new species in populations that are geographically isolated from one another. In allopatric speciation, the inota;; block to gene flow is a geographic barrier that physically isolates the splinter population.
What is sympatric speciation?
The formation of a new species in populations that live in the same geographic areas. Sympatric specation is the orgin of a new species without geographic isolation. The splinter population becomes reproductively isolated even though it is in the midst of the parent isolation.
What does the Fossil record reveal?
The fossil record reveals that five mass extinctions have occurred over the last 540 million years. In each of these events, 50% or more of Earth's species died out. Of all the mass extinctions, those marking the ends of the Permian and Cretaceous periods have been the most intensively studied.
What is the function of Sori?
The function is to release spores to reproduce the gametophyte
What can the fossil record tell us?
The great events in the history of life have been and when they occurred.
Why are homologous structures one of the best sources of information for phylogenetic relationships?
The greater the number of homologous structures between two species, the more closely the species are related.
Eukaryotic cells probably arose through __________.
associations between different prokaryotes
Some aquatic invertebrates such as insects and snails feed on biofilms. Scientists that study metal-contaminated streams have documented that some biofilms in stream environments absorb zinc from stream water during daylight hours and release the zinc into the stream during the night. What might the scientists hypothesize about zinc concentration in the stream?
The highest zinc concentrations in stream water might occur only at night.
To identify clades, scientists compare an ingroup with and outgroup; Define ingroup and outgroup.
The ingroup is the group of species that is actually being analyzed. The outgroup is a species or group of species known to have diverged before the lineage that contains the groups being studied.
Why are Islands an isolating mechanism?
The islands of Cape Vede, the Folklands, Galapagos, Tahiti, and New Zeland all inspired Dawin with their unique flora and fauna. Each of these islands had plants and animals similat to, yet distinct from, continental varieties. On the Galapagos Islands, for example, there are 17 species of finches. These 17 different species evolved from one mainland species that reached the island chain early in its history and found numerous habitats empty of competitors. Islands dont even have to be land masses surrounded by water. For example mountains separated by large stretches of desert have cool and moist mountain tops. Each mountain top is isolated from the others by the desert, so species adapt there in solation from other nearby species.
How does a bacterium know if lactose is present or not? In other words, how does the presence or absence of lactose influence the activity of the genes that code for the lactose enzymes?
The key is the way the three lactose digesting genes are organized: They are adjacent in the DNA and turned on and off as a single unit. This regulation is achieved through short stretches of DNA that help turn all three genes on and off at once, coordinating their expression.
Primers
The key to amplifying one particular segment of DNA an no others is the use of primers- A short stretch of nucleic acid bound by complementary base pairing to a DNA sequence and elongated with DNA nucleotides. During PCR, primers flank the desired sequence to be copied. For each experiment, specific primers are chosen that are complementary to sequences that flank the target sequence, marking the start and end points or the segment of DNA to be amplified. Beginning with a single DNA molecule and the appropriate primers, automated PCR can generate hundreds of billions of copies of the desired sequence in a few hours.
A eukaryotic gene was inserted into the DNA of a bacterium. The bacterium then transcribed this gene into mRNA and translated the mRNA into protein. The protein produced was useless and contained many more amino acids than the protein made by the eukaryotic cell. Why?
The mRNA was not spliced as it is in eukaryotes.
biotechnology
The manipulation of living organisms to perform useful tasks. Biotechnology refers to DNA technology, which consists of modern laboratory techniques for studying and manipulating genetic material.
What is another clue to distinguishing homology from analogy?
The more complex two similar structure are, the less likely it is they evolved independently
Judging by the names, what is the basis of algae classification?
The number based on the pigment/s they carry
Gene expression
The overall process by which genetic information flows from genes to proteins is called gene expression. The control of gene expression makes it possible for cells to produce specific kinds of proteins when and where they are needed, allowing cells to respond quickly and efficiently to information from the environment.
Which phenomenon (or lack of) will prevent significant genetic drift?
The population size is large.
Why are GM crops profitable?
The production of GM crops is often more profitable because the modifications improve yields and increase the size of harvest.
DNA cloning
The production of many identical copies of a specific segment of DNA
Why DNA Technology Matters
The products and services provided by genetic engineering have a significant impact on our lives and our society. DNA technologies have many practical applications, from the food we eat to the drugs we take to other products we use every day. Furthermore, such technologies are used to gather evidence for forensic, historical, and scientific investigations.
forensics
The scientific analysis of evidence for crime scene investigations and other legal proceedings
What is artificial selection?
The selective breeding of domesticated plants and animals to promote the occurrence of desirable traits in the offspring.
What is analogy?
The similarity between two species that is due to convergent evolution rather than to descent from a common ancestor with the same trait.
What is the source of genetic variation in a population?
The source of genetic variation is mutation, a change in the nucleotide sequence of DNA
Recent scientific studies of the impact of microbiota on the amount of fat versus lean body mass (i.e., body composition) are described in your text. How do those studies illustrate the importance of microbiota communities in our bodies?
The studies suggest that intestinal microbiota may be involved in regulating our digestive processes.
What is molecular biology?
The study of biological functions, structures, and heredity at the molecular level.
What is biogeography?
The study of the past and present distribution of organisms.
genomics
The study of whole sets of genes and their interactions within a species, as well as genome comparisons between species.
proteomics
The systematic study of the full protein sets (proteomes) encoded by genomes. The number of different proteins in humans far exceeds the number of different genes (about 100,000 proteins versus about 21,000 genes). And because proteins, not genes, actually carry out the activities of the cell, scientists must study when and where proteins are produced and how they interact to understand the functioning of cells and organisms.
15.6 Investigate how researchers study the effects of microbiota on human obesity.
There was a study where microbiota from human donors was transplanted into mice. Donors are categorized into lean & obese & effects of the mice studied in each group are compared. researchers found that their hypothesis was supported and mice that received microbiota from an obsessed donor became more obsessed & vice versa
If a population is in Hardy-Weinberg equilibrium and remains in equilibrium, which of the following will be true?
There will be no mutations.
Mitosis exactly duplicates the chromosomes
Therefore, every cell in your body has the same DNA as the zygote. Every somatic (body) cell contains every gene. However, the cells in your body are specialized in structure and function; a neuron, for example, looks and acts nothing like a red blood cell. But if every cell contains identical genetic instructions, how do cells develop differently from one another. Gene regulation is the answer.
What is Natural selection, genetic drift, and gene flow responsible for?
They are major mechanisms responsible for the evolution of all populations. Together, they shape populations of beetles as well as humans.
Why, of all cell types, do embryonic stem cells (ES cells) have the greatest potential for use in the treatment of disease?
They are undifferentiated cells that have the potential to differentiate into all of the different specialized cells of the body.
It is possible for a cell to make proteins that last for months; hemoglobin in red blood cells is a good example. However, many proteins are not this long-lasting. They may be degraded in days or even hours. Why do cells make proteins with such a short life span?
This enables cells to control the amount of protein present.
In lab class, a plasmodial slime mold is used as a demonstration organism. One of the students does not understand why the plasmodium is not considered multicellular. How would you explain it to her?
This mass of cytoplasm is undivided by membranes and contains many nuclei.
The potential benefits of knowing many human genomes are enormous
Thus far, more than 2,000 disease-associated genes have been identified. A recent example involved Behcet's disease, a painful and life-threatening illness that involves swelling of blood vessels throughout the body. Researchers have long known that this disease is found most commonly among people living along the ancient trade route in Asia called the silk road. In 2013, researchers conducted a genome-wide search for genetic differences among Turkish people with and without the disease. The nearby genes are implicated in the immune systems ability to destroy invading microorganisms, to recognize infection sites, and to regulate auto immune diseases.
What is temporal isolation, give an example?
Time-based; for example, western spotted skuns breed in the fall, but the eastern species breed in late winter. Temporal isolation keeps the species from mating even where they coexist on the Great Plains.
How to Clone a Gene
To start, the biologist isolates two kinds of DNA: bacterial plasmids that will serve as vectors (gene carriers) and DNA from another organism that includes the gene of interest. This foreign DNA may be from any type of organism, even a human. 1-The DNA from the two sources is joined, resulting in recombinant DNA plasmids. 2-The recombinant plasmids are then mixed with bacteria. Under the right conditions, the bacteria take up the recombinant plasmids. 3-Each bacterium, carrying its recombinant plasmid, is allowed to reproduce through cell division to form a clone of cells, a population of genetically identical cells descended from a single original cell. In this clone, each bacterium carriers a copy of the gene of interest. When DNA cloning involves a gene-carrying segment of DNA, it is known as gene cloning. As the bacteria multiply. the foreign gene that is carried by the recombinant plasmid is also copied. 4-the transgenic bacteria with the gene of interest can then be grown in tanks, producing the protein in marketable quantities. The products of gene cloning may be copies of the gene itself. to be used in additional genetic engineering projects, or the protein products of the cloned gene, to be harvested and used.
What is the function of a repressor protein?
To turn off transcription by binding to the operator.
Contrast prokaryotes and eukaryotes
Unlike prokaryotic genes, however, most eukaryotic genes are not grouped into operons. Instead, each eukaryotic gene usually has its own promoter and other control sequences.
How do reproductive isolation develop?
Usually before populations become reproductively isolated, they first become geographically isolated. For example, 12,000 years ago, a glacier covered much of North America. This glacier most assuredly isolated madowlark populations from each other. Each isolated population continued to adapt through natural selection to its particular environment. The result was that when the glaciers retreated, and the meadow lark populations once again came into contact with each other, changes in mating behavior limited eastern and western interbreeding.
Which of the following colonial organisms exist as intermediates between unicellular and multicellular life?
Volvox
What is the typical habitat of a moss?
Wet and Shady Locations
14.7 Differentiate between taxonomy, cladistics, and systematics; the two-kingdom, five-kingdom, and three-domain systems of classification; homologous and analogous structures.
What is cladistics based on? the Darwinian concept of decent with modification from a common ancestor species have some character in common with their ancestors, but they also differ from them. What does cladistics focus on? the changes that define the branch points in evolution. What does the cladistics approach to phylogeny clarify? Clarifies evolutionary relationships that were not alway apparent in other taxonimic classifications. For instance, biologists tratitionally placed birds and reptiles in separate classes of vertebrates.
What kind of prokaryotes are shown in the figure?
bacilli
In what type of organism was the CRISPR-Cas9 system discovered?
bacteria
Restriction enzymes are obtained from ________.
bacteria
The first targets of genomics research were
bacteria, which have relatively little DNA.
12.3 Explain how recombinant DNA techniques and the CRISPR-Cas9 system can be used to clone and edit genes.
What is the CRISPR-Cas9 system? -The CRISPR-Ca9 system is a new DNA technology allows the nucleotide sequence of specific genes to be edited in living cells. In short, the CRISPRCas9 system was discovered as a natural component of prokaryotic cells, just like Restriction enzymes. Restriction enzymes are enzymes isolated from bacteria that cut DNA molecules at specific sequences. How to clone genes Recombinant DNA techniques clone genes by first finding a cell containing a gene of interest (Gene we want to replicate). Inside the nucleus, you will see "foreign" DNA. Within that, DNA is the one Gene of interest. The other big piece of the puzzle is a bacterium that will serve as our DNA factory. The Bacterium contains a Bacterial chromosome, also known as the squiggly chromosome. More importantly, the Bacterium includes a small circular piece of DNA (Plasmid). Now that we have two sources (cell containing Gene of interest and Bacterium), our goal is to combine the DNA. To achieve the purpose of combing DNA, The Bacterial Plasmid is cut open, and the Gene of interest is inserted into it (restriction enzyme). Once the DNA from the two sources is combined and sealed together, we've created recombinant DNA Plasmids! This recombinant Plasmid is then put back into another bacterium. The recombinant Bacterium then grows and divides to make new bacteria. All of these newly produced bacteria will carry the recombinant Plasmid within them. We now have many recombinant bacteria, all carrying the target gene that we wish to clone (Gene of interest). How and why does the CRISPR-CAS9 system edit genes? CRISPR/CAS9 edits genes by precisely cutting DNA and then letting natural DNA repair processes take over. The system consists of the Cas9 enzyme and a guide RNA. Why use the CRISPR-CAS9 system? Some applications for the CRISPR/CAS9 system are correcting genetic defects, preventing and treating the spread of disease/s, and improving the growth and resilience of crops. What is the function of the guide RNA in the CRISPRCas9 system? It guides the complex to the proper location in the genome.
14.1 Explain the biological species concept and speciation, providing past and present examples as well as limitations when applied to all types of living organisms.
What is the biological species concept? -The definition of a species as a population or group of populations the members of which have the potential to nature to interbreed and produce fertile offspring. Why cant we apply the biological species concepts to all situations? -basing the definition of species on reproductive compatibility excludes organisms that only reproduce asexually. And because fossils are obviously not currently reproducing sexually, they cannot be evaluated by the biological species concept. When is the biological species concept useful? -when we ask: what prevents a member of one group from successfully interbreeding with a member of another group? What is Speciation? -the length of time between when a new species forms and when its populations diverge enough or produce another species
Gene Regulation in Bacteria
When a nutrient is plentiful, bacteria do not squander valuable resources to make the nutrient from scratch. Bacterial cells that can conserve resources and energy have a survival advantage over cells that are unable to do so. Thus, natural selection has favored bacteria that express only the genes whose products are needed by the cell.
How does a key event in the orgin of many species occur?
When a population is somehow cut off from other populations of the parent species.
11.10 Brief how mutations in proto-oncogenes and tumor suppressor genes can lead to cancer.
When a proto-oncogene mutates (changes) or too many copies of it, it will become a "bad" gene that may grow to entirely become on or activated while it isn't alleged to be. The molecular increases out of control when this happens, resulting in cancer. Tumor suppressor genes are everyday genes that sluggish down molecular division, restore DNA mistakes, or inform cells to die (a procedure called apoptosis). When tumor suppressor genes don't work properly, cells can develop out of control, resulting in cancer.
12.4 Compare and contrast how genetically modified organisms are used in society.
With lower crop yields without GMO traits, commodity prices rise. Some benefits of genetic engineering in agriculture are increased crop yields, reduced costs for food or drug production, reduced need for pesticides, enhanced nutrient composition and food quality, resistance to pests and disease, greater food security, and medical benefits to the world's growing population.
Read the following scenario to answer the following question.Endotoxins are commonly found in the air, both inside and outside our homes. These "air endotoxins" can come from sources that include house dust mites, agricultural and industrial dust, and dust from indoor pets. Air endotoxins are typically found in low amounts, but production of them can increase dramatically under specific environmental conditions such as dampness, mold, and sewage. Many scientific studies have been conducted investigating possible links between indoor endotoxin levels and asthma, chronic bronchitis, and other upper respiratory diseases. Interestingly, some studies have found positive correlations between indoor endotoxin exposure and severity of some of these diseases while other studies have suggested that some air endotoxin exposure can actually decrease the risk of developing asthma in children. Additionally, data suggests that industrial workers who are exposed to endotoxins in the air can develop irreversible lung damage.In 2005, Hurricane Katrina devastated the eastern coastline of the United States. The state of Louisiana, and in particular the city of New Orleans, experienced tragic loss of human life and homes due to the failure of the levee system. Intense flooding destroyed homes and created severe exposure to wet, moldy surfaces. At that time there were no regulations in existence on the amount of exposure that individuals should have to air endotoxins. Scientists from the Natural Resources Defense Council who wanted to determine if endotoxin levels had risen in New Orleans, conducted tests across 12 outdoor areas, 9 of which had been significantly flooded while the other 3 were less affected. Two indoor areas were also sampled for endotoxin levels. No significant differences were found in endotoxin levels between the flooded and non-flooded areas or between the indoor and outdoor areas. However, a limited number of samples were collected, and they were taken after a recent dry spell. Endotoxin levels at all sites were found to be higher than national average levels but were lower than levels typically associated with long-term changes in lung function. What is a logical conclusion to draw from this study?
Workers that come to these areas where there was flooding damage should be advised to wear protective respiratory gear.
A genetic defect in humans results in the absence of sweat glands in the skin. Some men express this defect all over their bodies, but in women it is usually expressed differently. A woman with this defect typically has small patches of skin with sweat glands and other patches without. This pattern of sweat-gland distribution can best be explained by __________.
X chromosome inactivation
Lab 11 Plants
Yes
11.12 Evaluate how personal habits and individual choices can affect a person's risk of developing cancers.
Yes, personal lifestyle choices can affect your likelihood of acquiring DNA mutations. For example, a person who repeatedly tans in a tanning booth with no sunblock is exposing him/herself to a high amount of UV light, which may cause mutations. Or the risk of acquiring DNA mutations is very high for someone who chooses to smoke cigarettes. These are personal choices that can affect the amount of DNA mutation that occurs throughout a person's life.
Why cant we apply the biological species concepts to all situations?
basing the definition of species on reproductive compatibility excludes organisms that only reproduce asexually. And because fossils are obviously not currently reproducing sexually, they cannot be evaluated by the biological species concept.
Why do Homologous structure indifferent species may in form and function but exhibit fundamental similarities?
because they evolved from the same structure in a common ancestor.
Applied Genomics
a 2013 study used DNA sequencing to prove that cancerous skin cells that had spread to the brain had done so after fusing with red blood cells provided by a bone marrow donor. These results provided researchers with new insight into how cancer spreads throughout the body. Sequence data also provided strong evidence that a Florida dentist transmitted HIV to several patients and that a single natural strain of west nile virus can infect both birds and people. Applied Genomics can also be used to investigate criminal cases. In 2001, a 63-year old Florida man died from inhalation anthrax, a disease caused by breathing spores of the bacterium Bacillus anthraces. Because he was the first victim of this disease in the United States since 1976 (and coming so soon after the 9/11 terrorist attacks the months before), his death was immediately considered suspicious. By the end of the year, four more people had died from inhaling anthrax. Law enforcement officials realized that someone was sending anthrax spores through the mail. The united States was facing an unprecedented bioterrorist attack. In the investigation that followed, one of the most helpful clues turned out to be the anthrax spores themselves. Investigators sequenced the genomes of the mailed anthrax spores. They quickly established that all of the mail spores were genetically identical to a laboratory subtype stored in a single flask at the US Army Medical Research Institute of Infectious Diseases in Fort Detrick, Maryland. Based in part on this evidence, the FBI named an army research scientist as a suspect in the case. Although never changed, the suspect committed suicide in 2008, and the case officialy remains unsolved.
Two other illnesses that have been treated with gene therapy are
a degenerative disease of the nervous system and a blood disorder involving a hemoglobin gene. Research on gene therapy continues, with tougher guidelines for safe and effective application
What are pathogens?
a disease-causing virus or organism
The development of a malignant tumor is accompanied by
a gradual accumulation of mutations that convert proto-oncogenes to oncogenes and knock out tumor-suppressor genes. The requirement for several DNA mutations explains why cancers can take a long time to develop. It may also help explain why the longer we live, the more likely we are able to accumulate mutations.
What are species?
a group of populations whose members have the potential to interbreed with one another in nature and produce viable, fertile offspring.
Which of the following would most likely spoil salted fish?
a halophile
What is molluscs?
a large and diverse phylum of animals.
STR analysis
a method of DNA profiling that compares the lengths of STR sequences at specific sites in the genomes. The standard STR analysis procedure used by US law enforcement agencies compare the number of repeats of specific four-nucleotide DNA sequnces at 13 sites scattered through the genome. Each repeat site, which typically contains from 3 t o50 four-nucleotide repeats in a row varies widely from person to person. In fact, some STRS used in the standard procedure have up to 80 variations in the number of repeats. In the United States the number if repeats at each site is entered into a database called CODIS (combined DNA Index Sysyem) administered by the Federal Bureau of Investigation. Law enforcement agencies around the world can acess CODIS to search for matches to DNA samples they have obtained from crime scenes or suspects.
For a proto-oncogene to become an oncogene
a mutation must occur in the cells dna
What are mutations?
a mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene
What is sympatric speciation?
a new species arises within the same geographic are as its parent species.
What is an autoclave?
a pressure cooker that applies high-pressure steam at a temp of 250 degrees f. This tool is used to ensure that all cells, including endospores, are killed when laboratory equipment is sterelized.
A reproductive barrier that prevents individuals from closely related species from interbreeding is an example of ________.
a prezygotic barrier
Natural selection can be defined as ________.
a process in which organisms with certain inherited traits are more likely to survive and reproduce than individuals with other traits
What is a basic function?
a process of refinement rather than the sudden appearance of complexity.
repressor
a protein that blocks the transcription of gene or operon.
activator
a protein that switches on a gene or group of genes by binding to DNA. Activators act by making it easier for RNA Polymerase to bind to the promoter. The use of activators is efficient because a typical animal or plant cell needs to turn on (transcribe) only a small percentage of its genes, those required for the cell's specialized structure and function. The default state for most genes in multicellular eukaryotes seems to be off; research indicates that a typical human cell expresses only about 20% of its protein-coding genes at any given time.
Which of the following would be considered a transgenic organism?
a rat with rabbit hemoglobin genes
Human gene therapy
a recombinant DNA procedure intended to treat disease by altering an afflicted person's genes. In some cases, a mutant version of a gene may be replaced or supplemented with the normal allele, potentially correcting a genetic disorder, perhaps permanently. In other cases, genes are inserted and expressed only long enough to treat a medical problem.
You have been asked to participate in the cleanup of an old mining site. You dislike the idea of handling poisonous acidic soils, so you volunteer to culture the bacterium Thiobacillus. The aspect of the cleanup that you are participating in is __________.
bioremediation
what is another source of stem cells?
blood collected from the umbilical cord and placenta at birth. In 2005, doctors reported that an infusion of umbilical cord blood stem cells appeared to cure some babies of Krabbe disease, a fatal inherited disorder of the nervous syste.
Which is a type of post-transcriptional regulation of gene expression?
breakdown of proteins
What happens during a DNA microarray study?
a researcher collects all of the mRNA transcribed in a particular type if cell at a given moment. This collection of mRNA is mixed with reverse transcriptase, a viral enzyme that produces DNA that is complementary to each mRNA sequence. These fragments are called complementary DNAS. A DNA molecule made in vitro using mRNA as a template and the enzyme reverse transcriptase. A CDNA molecule therefore corresponds to a gene but lacks the introns present in the DNA of the genome; because each one is complementary to one of the MRNAS. The cDNAS are synthesized using nucleotides that have been modified to fluorescence (glow). The fluorescent cDNA collection represents all of the genes being actively transcribed in that particular cell at that particular time. The fluoresently labeled cDNA mixture is added to the DNA fragments of the microarray. If a molecule in the cDNA mixture is complementary to a DNA fragment at a particular location on the grid, the CDNA molecule binds to it, producing a detectable glow in the microarray. Often, the cDNAs from two samples (for example, two tissues) are labeled with molecules that emit different colors and tested on the same microarray. The pattern of glowing spots enables the researcher to determine which genes are being transcribed in one tissue compared with another.
What two enzymes are needed to produce recombinant DNA?
a restriction enzyme and a ligase
To create a DNA profile
a scientist uses PCR to specifically amplify the regions of DNA that include these STR sites. The resulting fragments are then compared. In this case, that comparison reveals that the two samples of DNA could not have come from the same person.
What is an endospore?
a thick-coated, protective cell produced within the prokaryotic cell when the prokaryote is exposed to unfavorable conditions
List three examples of conifers
a-Pine b-fir c-spruce
List two distinguishing characteristics of conifers
a-spiny leaves b-straight central trunk
Under the biological species concept, what criterion is used to assign populations of organisms to the same biological species?
ability to interbreed and produce fertile offspring
Some protists are heterotrophs; what does this mean?
acquiring their food from other organisms
If members of a population have traits that are both heritable and variable among individuals, then __________.
advantageous traits may become more widespread in subsequent generations
All known organisms translate genetic information to protein molecules via the same genetic code. This finding strongly supports the hypothesis that __________.
all organisms are descended from a single common ancestor
Reproductive isolation can result from what two general scenarios?
allopathic ("different country") speciation and sympatric ("same country" speciation.)
clade
an ancestral species and all its descendants - a distinctive branch in the tree of life
Food poisoning from Salmonella occurs because of ________.
an endotoxin produced by Salmonella bacteria
Certain fish had bony fins that later evolved into the arms and legs of land animals. In this context, these bony structures are an example of __________.
an exaptation
In prokaryotes, the production of a single RNA transcript for a group of related genes is under the control of ________.
an operon
What is the definition of a genetically modified organism?
an organism carrying a gene that was acquired by artificial means
Eukaryotes
an organism characterized by eukaryotic cells. Eukaryotes are composed of one or more cells that contain nuclei and many other membrane-bound organelles absent in prokaryotic cells. Eukaryotic cells evolved from ancestral host cells that engulfed smaller prokaryotes.
What is the definition of a "transgenic organism"?
an organism containing a gene from another specie
Mammal hair evolved from the scales of reptiles. On the other hand, the "hair" on many insects, such as bees, has a completely different origin. These facts mean that the hair of mammals and the hair of insects are __________.
analogous structures
Which of the following would be the least useful in determining the evolutionary relationships among various species?
analogous structures
What are the metabolic talents of prokaryotes symbiotic partner with?
animals, plants, and fungi
Which of these groups includes parasitic unicellular organisms with a complex of organelles specialized for penetrating host cells and tissues?
apicomplexans
Methanogens, extreme halophiles, and extreme thermophiles are examples of __________.
archaea
In the US nearly all of corn, soy bean, and cotton crops
are genetically modified
Male tortoiseshell cats ______.
are likely to be exceedingly rare and very likely to be sterile since normal male cats are XY
cell-to-cell signaling and the control of gene expression
are particularly important during early embryonic development, when a single-celled zygote develops into a multicellular organisms. Interactions between the cells of an embryo through the chemical signals coordinate the process of development.
Next-generation and third-generation sequencing techniques
are ushering in a new era of faster, more affordable sequencing
13.3 Compare the ways that Aristotle and Lamarck viewed the properties of living species and why simple observations today provide evidence against Lamarck's evolutionary mechanism.
aristotle believed in a static universe which held that living organisms were created initially and then remained essentially unchanged. Lamarck explained evolution as the refinement of traits that equip organisms to perform successfully in their environments. He proposed that by using or not using its body parts, an individual may develop certain traits that it passes on to its offspring.
Mutations in either or both of two genes
called BRCA1 and BRCA2 are found in at least half of inherited breast cancers. Both BRCA1 and BRCA3 are considered tumor-suppressor genes because the normal versions protect against breast cancer. A woman who inherits one mutant BRCA1 allele has a 60% probability of developing breast cancer before the age of 50, compared with only a 2% probability for an individual lacking the mutations. Tests using DNA sequencing can now detect these mutations. Surgical removal of the breasts and or ovaries is the only preventive option currently available to women who carry the mutant genes.
While examining a human cell that functions normally, you determine that it has 45 functional chromosomes and one chromosome that is almost completely inactive. You immediately decide that it is very likely that this cell ______.
came from a normal human female
Many proto-oncogenes regulate ________.
cell division
The theory of evolution describes natural selection acting on populations of organisms. In the case of cancer, what is the "population" that is susceptible to selection?
cells
Furthermore, what is a mutation?
change in the nucleotide sequence of DNA
Which of these lifestyle choices will increase cancer risk?
changing to a diet low in plant fiber
Clay particles may have played an important role in the origin of life because __________.
clay particles are a suitable surface for the formation of polymers from monomers
What is recombinant DNA technology?
combining genes from different species
Homology is evidence of ________.
common ancestry
Advocates of a cautious approach regarding GM crops
concerned that crops carrying genes from other species might harm the environment or be hazardous to human health (by, for example, introducing new allergens, molecules that cab cause allergic reactions, into foods). A major worry is that transgenic plants might pass their new genes to close relatives in nearby wild areas. We know that lawn and crop grasses, for example, commonly exchange genes with wild relatives through pollen transfer. If domestic plants carrying genes for resistance to herbicides, diseases, or insect pests pollinated wild plants, the offspring might become "superweeds" that would be very difficult to control. However, researchers may be able to prevent the escape of such plant genes in various ways for example, by engineering plants so that they cannot breed. Concern has also been raised that the widespread use of GM seeds may reduce natural genetic diversity, leaving crops susceptible to catastrophic die-offs in the event of a sudden change to the environment or introduction of a new pest.
problems cloning may create
conservationists argue that cloning may detract from efforts to preserve natural habitats. They correctly point out that cloning does not increase genetic diversity and is therefore not as beneficial to endangered species as natural reproduction. In addition, an increasing body of evidence suggests that cloned animals are less healthy than animals produced by fertilization: Many cloned animals exhibit defects such as susceptibility to obesity; pneumonia, liver failure, and premature death.
Example of gene regulation
consider the development of a single-celled zygote into a multicellular organism. During embryonic growth, groups of cells follow different paths, and each group becomes a particular kind of tissue. In the mature organism, each cell type-neuron or red blood cell, for instance has a different pattern of turned-on genes.
A streptobacillus prokaryote __________.
consists of rod-shaped cells arranged in chains
The chromosomes in the human genome (22 autosomes plus the x and y sex chromosomes)
contain approximately 3 billion nucleotide pairs of DNA. If you imagine this sequences printed in letters (A,T,C, and G) the same size you see on this page, the sequence would fill a stack of books 18 stories high. However, the biggest surprise from the Human Genome Project is the relatively small number of human genes - currently estimated to be about 21,000 very close to the number found in roundworm!
Analogous structures are evidence of ________.
convergent evolution
Restriction enzymes
cut DNA at specific nucleotide sequences
Mutations result from
decades of exposure to carcinogens
When plasmids are used to produce a desired protein, the ________.
desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium
All of the species in the list below are seaweeds. Which is the EXCEPTION?
diatoms
Which risk factor is associated with cancer of the colon and rectum?
dietary fat
Your bone cells, muscle cells, and skin cells look different because __________.
different genes are active in each kind of cell
A lizard population that evolves increased tolerance to high temperatures as a result of global climate change is an example of which of the following?
directional selection
What do Prokaryotes guard our body against?
disease-causing intruders
A population of squirrels is preyed on by small hawks. The smaller squirrels can escape into burrows. The larger squirrels can fight off the hawks. After several generations, the squirrels in the area tend to be very small or very large. What process is responsible for this outcome?
disruptive selection
An important challenge to traditional (pre-1860) ideas about species was the observation that seemingly dissimilar organisms, such as hummingbirds, humans, and whales, have similar skeletal structures. This most directly suggested to biologists that __________.
dissimilar organisms might have evolved from a distant, common ancestor
"Sticky ends" are ________ that are produced by the action of ________.
double-stranded DNA molecules with single-stranded ends; restriction enzymes
How cancer develops
more than one mutation is needed to produce a cancer cell. As in many cancers, development of colon cancer is gradual.
Genomics and proteomics
enable biologists to approach the study of life from an increasingly global perspective. Biologists are now compiling catalogs of genes and proteins- that is, listing of all the proteins - that is, listing of all the "parts" that contribute to the operation of cells, tissues, and organisms
What do simple patches of pigmented cells enable?
enable limits, single-shelled molluscs that cling to seaside rocks, to distinguish light from dark. When a shadow falls on them, they hold on more tightly a behavioral adaptation that reduces the risk of being eaten. Other molluscs have eyecups that have no lenses or other means of focusing images but can indicate light direction. In those mollucs that do have complex eyes, the organs probably evolved in small steps of adaptation.
Which organisms would likely be the most difficult to kill if you were you to can your own food?
endospores
What are the 2 main resources needed for synthesizing organic compounds?
energy; carbon
DNA testing (profiling) has been used to determine the guilt or innocence of crime suspects. This works because __________.
every person has a unique DNA sequence
A phylogenetic tree of bird families constructed by cladistic analysis would most clearly show which of the following?
evolutionary relationships among families
What are the two classes of poisons produced by pathogenic bacteria?
exotoxins and endotoxins
What do changes in the rate of development events also explain; give an example?
explain the dramatic differences seen in homologous limb bines if vertebrates. For instance, increased growth rates produced the extra - long finger bones in bat wings.
What does Natural Selection on a microevolutionary mechanism explain?
explains the striking ways in which organisms are suited to their environment.
Which one of the following is a human disease caused by a bacterium?
food poisoning
Human DNA technologies raise legal and ethical questions
for example, how the treatment of dwarfism with injections of human growth hormone (HGH) produced by genetically engineered cells might be extended beyond its current use. Should parent of short but hormonally normal children be able to seek HGH treatment to make their kids taller? If not, who decided which children are "tall enough" to be excluded from treatment? In addition to technical challenges, human gene therapy also provokes ethical questions. Some critics believe that tampering with human genes in any way is immoral or unethical. Other observers see no fundamental difference between the transplantation of organs.
Within a cell, exon splicing can occur in more than one way, generating different mRNA molecules from the same starting RNA molecule
for example, that one mRNA ends up with the green exon and the other with the brown exon.
How do you prove that two samples of DNA come from the same person?
forensic scientists typically compare about a dozen short segments of noncoding repetitive DNA that are known to vary from person to person
Which of the following is thought to have been the first step in the origin of life?
formation of organic monomers
What was the third stage of the process that led to the abiotic origin of life?
formation of pre-cells
The biological species concept cannot be applied to ________.
fossils
In the Hardy-Weinberg formula, what does p2 represent?
frequency of the homozygotes for one allele
What is Gametic isolation?
gametes (egg and sperm) of different species are incompatible preventing fertilization.
DNA packing tends to prevent
gene expression by preventing RNA polymerase and other transcription proteins from binding to the DNA
Which is NOT a requirement of natural selection?
gene flow
The total collection of alleles in a population at any one time makes up that population's ________.
gene pool
What can evolutionary transformations result in?
genes that alter the rate, timing, and spatial pattern of changes in an organisms form as it develops from a zygote into an adult.
A change in the gene pool due to chance results in ________.
genetic drift
The severe reduction in genetic variability seen in the endangered cheetah is probably attributable to __________.
having gone through at least one bottleneck
Although volcanic islands are young, who are they home to?
home to plants and animals known nowhere else in the world.
Among other uses, recombinant DNA technology has provided a mechanism through which we can have nonhuman cells produce __________.
human proteins
What is the probable cause of the current increase in species extinctions?
humans
The world's first genetically engineered pharmaceutical product was ________.
humulin
What is the wheat used for bread a hybrid of?
hybrid of three different parent species and has size sts of chromosomes, two sets from each parent.
Which of these pairs would have exactly the same DNA restriction fragments?
identical twins
PCR can also be used to
identify symptomless carriers of potentially harmful recessive alleles. Parents may thus be informed of whether they have a risk of bearing a child with a rare disease that they do not themselves display.
A new species can arise in a single generation __________.
if a change in chromosome number creates a reproductive barrier
What has allowed biologists to develop and test hypotheses about the evolutionary divergence of major branches on the tree of life?
molecular comparisons between diverse organisms
Why do duplication of a gene or small pieces of DNA through errors of meiosis provide important sources of genetic variation?
if a repeated segment of DNA can persist over the generations , mutations may accumulate in the duplicate copies without affecting the function of the original gene, eventually leading to new genes with novel functions.
DNA profiling determines __________.
if two samples of DNA are from the same person
The control of gene expression is more complex in multicellular eukaryotes than in prokaryotes because __________.
in a multicellular eukaryote, different cells are specialized for different functions
Process of translation
in which an mRNA is used to make a protein-offers additional opportunities for control by regulatory molecules. Red blood cells, for instance, have a protein that prevents the translation of hemoglobin mRNA unless the cell has a supply of heme, an iron-containing chemical group essential for hemoglobin function.
Within a multicellular organism
information must be communicated between cells. For example, a cell can produce and secrete chemicals, such as hormones, that affect gene regulation in another cell. This allows the organism as a whole to alter its activities in response to signals from the environment.
Bioinformatics can also provide
insights into our evolutionary relationships with nonhuman animals. In 2005, researchers completed the genome sequence for our closest living relative on the evolutionary tree of life, the chimpanzee)
The biological species concept can be applied to organisms that __________.
interbreed sexually
Non-coding DNA sequences are referred to as ________.
introns
Other noncoding regions include
introns and repetitive DNA. Some noncoding DNA is important to our health, with certain regions known to carry disease-causing mutations. But the function of most noncoding DNA remains unknown.
The Polymerase Chain reaction
is a method for copying a piece of DNA
The key to automated PCR
is an unusually heat-stable DNA polymerase, first isolated from prokaryotes living in hot springs. Unlike most proteins which denature, or fall apart, at high temperatures-this enzyme can withstand the heat at the start of each cycle.
Humulin
is human insulin produced by genetically modified bacteria. In humans, insulin is a protein normally made by pancreas.
Systematics
is the branch of biology that focuses on the classification of organisms
The most important stage for regulating gene expression
is the determination of whether transcription is initiated or not.
Cancer
is the second-leading cause of death (after heart disease) in most industrialized countries. Death rates due to certain forms of cancer have decreased in recent years, but the overall caner death rate is still on the rise, currently increasing at about 1% per decade.
To date, the "easy" part of gene therapy has been __________.
isolating and cloning the normal gene
Of these steps, which occurs first in the production of a recombinant plasmid?
isolation of a plasmid from a bacterium
After a restriction enzyme binds to its restriction site,
it cuts the two strands of the DNA by breaking chemical bonds at specific points within the sequence, like a pair of highly specific molecular scissors.
Insurance companies having access to genetic information is potentially problematic because __________.
it may encourage discrimination against people with certain genes
After an mRNA is produced in its final form,
its "lifetime" can be highly variable, from hours to weeks to months. Controlling the timing of mRNA breakdown provides another opportunity for regulation. But all mRNAs are eventually broken down and their parts recycled.
You have inserted the gene for human growth factor into the E. coli lactose operon, replacing the lactose structural genes with the gene for human growth factor. What substance must you add to your culture of bacteria to cause it to produce human growth factor for you?
lactose
What is the most frequently observed mechanism of sympatric speciation?
large-scale genetic changes that occur in a single generation
More people die of ________ cancer than of any other cancer.
lung
How do new species arise?
macroevolution the evolution of species.
The polymerase chain reaction (PCR) is a useful technique because it can __________.
make a large amount of DNA from a tiny amount
What does identifying clades make possible?
makes it possible to construct classification schemes that reflect the branching patter n of evolution.
What they produce
males make pollen. females make seeds
Examine the evolutionary tree below. This tree tells us that the amnion is found in ________.
mammals, lizards, snakes, crocodiles, and birds
When they were first sold, aerosol insecticides were highly effective in killing flies and mosquitoes. Today, some 30 years later, a much smaller proportion of these insects die when sprayed. The reason fewer insects are being killed is that __________.
many mosquitoes today are descendants of mosquitoes with insecticide-resistant characteristics
Eukaryotic chromosomes
may be in a more or less condensed state, with the DNA and accompanying proteins more or less tightly wrapped together
What can subsequent errors in cell division produce?
may produce chromosome duplications that result in a diploid set of chromosomes (2n=10).
The type of reproductive barrier that occurs when reproductive structures of different species are physically incompatible is referred to as ________.
mechanical isolation
How have biologist developed other ways to define species?
most of the species named so far have been classified based on measurable physical traits such as number and type of teeth or flower structure. Another approach defines a species as the smallest group of individuals sharing a common ancestor and forming one branch on the tree of life. Yet another approach proposes defining a species soley on the basis of molecular data, a sort of bar code that identifies each species.
What is Continental drift?
movements in the mantle cause the plates to move.
Variation among pre-cells was due to ______.
mutation
The processes of __________ and __________ generate variation, and _________ produces adaptation to the environment.
mutation ... sexual reproduction ... natural selection
"Differential success in reproduction associated with different inherited traits" is just another way of saying __________.
natural selection
Sexual selection is a form of __________.
natural selection
Genomics is a rich source of
ne insights into fundamental questions about genome organization, regulation of gene expression, embryonic development, and evolution.
What are some of the many plant species we grow for food are polyploids?
oats, potatoes, banananas, strawberries, peanuts, apples, sugarcane, and wheat.
Some drugs affect different people in different ways. This may be because __________.
of genetic differences between individuals
The similarity of homeotic genes found in many different kinds of organisms is evidence __________.
of the common ancestry of different life-forms
What name is given to a gene that causes cancer?
oncogene
Safety measure
one saftey measure in place is a set of strict laboratory procedures to protect researchers from infection by engineered microorganisms and to prevent microorganisms from accidentally leaving the laboratory. In addition, strains of microorganisms to be used in recombinant DNA experiments are genetically crippled to ensure that they cannot survive outside the laboratory. As a further precaution, certain obviously dangerous experiments have been banned.
An individual inheriting an oncogene or a mutant version of a tumor-suppressor gene is
one step closer to accumulating the necessary mutations for cancer to develop than is an individual without any such mutations. Geneticists are therefore devoting much effort to identifying inherited cancer mutations so that predisposition to certain cancers can be detected early in life.
DNA microarray in medical research
one study showed that DNA microarray data can classify different types of leukemia into specific subtypes based on the activity of 17 genes. It may become standard practice for every cancer patient to have DNA microarray analysis to discover the specific mutations involved in their cancer.
In an operon, the ______ acts as an on/off switch.
operator
When a certain bacterium encounters the antibiotic tetracycline, the antibiotic molecule enters the cell and attaches to a repressor protein. This keeps the repressor from binding to the bacterial chromosome, and the associated set of genes is transcribed. The transcription of the genes is under the control of a(n) __________.
operator
Which taxonomic level is most inclusive?
order
Humans and chimpanzees have a common ancestor. The human skull and chimpanzee skull are more alike in fetuses than they are in adults. The human skull is an example of a feature that evolved by __________.
paedomorphosis
What are traits that enable individuals to recognize potential mates?
particular odor, coloration, or courtship ritual, can also function as reproductive barriers (behavioral isolation).
Two worms in the same family must also be grouped in the same __________.
phylum
The term "restriction fragments" refers to __________.
pieces of DNA that have been cut into different lengths
Which of the following organisms are most likely to be subject to allopatric speciation?
pine trees in Alaska and pine trees in Maine
During his trip on the Beagle, Darwin found that ________.
plants and animals living on a continent seemed more closely related to each other than to plants and animals living in similar regions on other continents
Many identical copies of genes cloned in bacteria can be produced because of __________.
plasmid and bacterial cell replication
What can act as a vector to introduce new genes into a cell?
plasmids
What kind of protist is shown in the figure?
plasmodial slime mold
Because there are potential risks associated with the use of biotechnology in agriculture, __________.
potential risks associated with biotechnology are evaluated by a variety of U.S. regulatory agencies
What can we classify reproductive barriers as?
pre zygotic or post zygotic, depending on whether they block interbreeding before or after the formation of zygotes (fertilized eggs).
metagenomics
technological advances have also led to metagenomics, the study of DNA from an environmental sample. When obtained directly from the environment a sample will likely contain genomes from many species. After the whole sample is sequenced, computer software sorts out the partial sequences from different species and assembles them into the individual specific genomes, so far, this approach has been applied to microbial communities found in environments as diverse as the sargasso sea and the human intestine. A 2012 study cataloged the astounding diversity of the human "microbiome" - the many species of bacteria that coexist within and upon our bodies and that contribute to our survival. The ability to sequence the DNA of mixed populations eliminates the need to culture each species separately in the lab, making it more efficient to study microbial species.
Read the following scenario to answer the following question.Endotoxins are commonly found in the air, both inside and outside our homes. These "air endotoxins" can come from sources that include house dust mites, agricultural and industrial dust, and dust from indoor pets. Air endotoxins are typically found in low amounts, but production of them can increase dramatically under specific environmental conditions such as dampness, mold, and sewage. Many scientific studies have been conducted investigating possible links between indoor endotoxin levels and asthma, chronic bronchitis, and other upper respiratory diseases. Interestingly, some studies have found positive correlations between indoor endotoxin exposure and severity of some of these diseases while other studies have suggested that some air endotoxin exposure can actually decrease the risk of developing asthma in children. Additionally, data suggests that industrial workers who are exposed to endotoxins in the air can develop irreversible lung damage.In 2005, Hurricane Katrina devastated the eastern coastline of the United States. The state of Louisiana, and in particular the city of New Orleans, experienced tragic loss of human life and homes due to the failure of the levee system. Intense flooding destroyed homes and created severe exposure to wet, moldy surfaces. At that time there were no regulations in existence on the amount of exposure that individuals should have to air endotoxins. Scientists from the Natural Resources Defense Council who wanted to determine if endotoxin levels had risen in New Orleans, conducted tests across 12 outdoor areas, 9 of which had been significantly flooded while the other 3 were less affected. Two indoor areas were also sampled for endotoxin levels. No significant differences were found in endotoxin levels between the flooded and non-flooded areas or between the indoor and outdoor areas. However, a limited number of samples were collected, and they were taken after a recent dry spell. Endotoxin levels at all sites were found to be higher than national average levels but were lower than levels typically associated with long-term changes in lung function. What addition to methodology would be most beneficial to the study?
pre-flood data to compare to post-flood data in order to better compare endotoxin levels
14.3 List, in order, the four broad divisions in the history of Earth and its life, and explain how the boundaries of each division are defined.
precambrian, Paleozoic, mesozoic, and cenozoic.
Three species of frogs—Rana pipiens, Rana clamitans, and Rana sylvatica—all mate in the same ponds, but they pair off according to species because they have different calls. This is a specific example of a __________ barrier, called __________.
prezygotic ... behavioral isolation
The bacteria that cause tetanus can be killed only by prolonged heating at temperatures considerably above the boiling point of water. This suggests that tetanus bacteria __________.
produce endospores
Recombinant DNA technology produces transgenic bacteria with a human gene that codes for a human protein. What problem could be associated with this process?
production of a human protein that does not function normally
In an experiment, a microbiologist put equal numbers of each of the following organisms into a flask of sterile broth consisting mostly of sugar and a few amino acids: prokaryotes, dinoflagellates, diatoms, thermophilic prokaryotes, and green algae. She then placed the flask in the dark. Which of the organisms would be best able to survive?
prokaryotes that obtain energy from organic matter
The earliest cells were most likely __________.
prokaryotic
Consider the following kinds of organisms: dinoflagellates and ciliates. Both of these organisms belong to which one of the following groups?
protists
What is the function of the pine's needles?
purpose is to retain water
Human insulin is produced in large quantities by __________.
recombinant E. coli bacteria grown in large fermentation vats
What type of protein binds to silencers to prevent gene expression from occurring?
repressors
Potatoes and rice have been engineered to produce harmless proteins derived from the cholera bacterium
researchers hope that these modified foods will one day serve as an edible vaccine against cholera, a disease that kills thousands of children in developing nations every year.
What can evolutionary changes result from?
result from alternations in homeotic genes, the master control genes that determine such basic developmental events as where a pair of wings or legs will apperar on a fruitfly.
Bacilli are ______ prokaryotes.
rod-shaped
Electrophoresis is used to __________.
separate fragments of DNA
Gel electrophoresis
separates DNA molecules based on length
What is repeated in the short tandem repeats investigated in STR analysis?
short non-coding sequences of nucleotides repeated many times tandemly (one after another)
"Sticky ends" are ________.
single-stranded ends of fragments of double-stranded DNA
What are finches?
small birds
Birds with average-size wings survived a severe storm more successfully than other birds in the same population with longer or shorter wings. This illustrates __________.
stabilizing selection
Spherical bacteria that occur in clusters are ________.
staphylococci
What is coci that occurs in clusters called?
staphylococci
A vaccine works by ________.
stimulating the immune system to develop lasting defenses
What is coci, including the bacterium that causes strep throat, occurs in chains called?
streptococci
Bird guides once listed the myrtle warbler and Audubon's warbler as distinct species that lived side by side in parts of their ranges. However, recent books show them as eastern and western forms of a single species, the yellow-rumped warbler. Apparently, the myrtle warbler and Audubon's warbler __________.
successfully interbreed and produce fertile offspring
Plate tectonics has been responsible for instances of all of the following EXCEPT ________.
sympatric speciation
The science of naming, identifying, and classifying organisms is called ________.
taxonomy
Two species of water lilies in the same pond do not interbreed because one blooms at night and the other during the day. The reproductive barrier between them is an example of __________.
temporal isolation
important
that all body cells contain a complete set of genes, even if they are not expressing all of them.
In frogs, when the nucleus of an intestinal cell of a tadpole is transferred to an egg whose nucleus has been removed (nuclear transplantation), some of the eggs will develop into normal tadpoles. This demonstrates __________.
that differentiated cells have retained all of their genetic potential
Advocates for GM foods point out
that transgenic crops will become increasingly necessary to combat starvation as more food must be grown on less space.
What is cladistics based on?
the Darwinian concept of decent with modification from a common ancestor species have some character in common with their ancestors, but they also differ from them.
RNA processing includes
the addition of a cap and a tail, the removal of introns (the noncoding DNA segments that interrupt the genetic message), and RNA splicing (the splicing together of exons)
DNA profiles are used to determine whether Sam could be the father of Becky's baby. Sam is not the father if __________ genetic profile shows some bands not present in __________ genetic profile.
the baby's ... Sam's or Becky's
What is taxonomy?
the branch of biology concerned with identifying, naming, and classifying species
Protists
the bridge between unicellular eukaryotes and multicellular plants, fungi, and animals
A particular bacterium can make the amino acid glycine from scratch or absorb preformed glycine from its surroundings. A microbiologist found that glycine binds to a repressor protein and causes the repressor to bind to the bacterial chromosome, turning off an operon. If it is like other operons, the presence of glycine will result in __________.
the cessation of the synthesis of glycine
What does cladistics focus on?
the changes that define the branch points in evolution.
How did these interspecies hybrids overcome the postzygotic barrier of sterility?
the chromosome numbers are doubled
therapeutic cloning
the cloning of human cells by nuclear transplantation for therapeutic purposes, such as the replacement of body cells that have been irreversibly damaged by disease or injury. The purpose of this procedure is not to create a living organism but rather to produce embryonic cells.
What is a microbiome?
the collection of genomes of individual microbial species present in a particular environment, such as the human intestinal tract.
The dog family is the Canidae. Some well-known members of the dog family are the domestic dog, Canis familiaris; the coyote, Canis latrans; and the red fox, Vulpes fulva. Based on this information and the definition of phylogenetic taxonomy, we can conclude that the people who gave these animals these names believed that __________.
the common ancestor of foxes and domestic dogs is more ancient than the common ancestor of coyotes and domestic dogs
Homeotic genes are important for ________.
the development of an organism's body plan
What are speciation events?
the divergent of multiple lineages from one common ancestor.
What do phylogenetic trees represent?
the evolutionary relationships among organisms
What is one of the most significant biological discoveries in recent years?
the fact that similar homeotic genes help direct early development in nearly every eukaryotic organism examined so far, including yeasts, plants, earthworms, frogs, chickens, mice, and humans. These similarities suggest that these homeotic genes arose very early in the history of life and that the genes have remained remarkably unchanged over eons of animal evolution.
13.2 Describe the hierarchical system of grouping species and how the binomial name of a species is created.
the first part is genus- a group of closely related species. Second is used to distinguish between species with a similar genus. Species, genus, family, order, class, phylum, kingdom, domain
Which anatomical features are homologous?
the forelimb of a dog and the forelimb of a cat
When a restriction enzyme cuts a DNA molecule, the cuts are staggered so that the DNA fragments have single-stranded ends. This is important in recombinant DNA work because __________.
the fragments will bond to other fragments with complementary single-stranded ends
When referring to cell division, oncogenes are most like ________ while tumor suppressor genes are most like ________.
the gas pedal on a car; the brakes on a car Submit
What is reproductive isolation?
the inability of a species to breed sucessfully with related species due to geographical, behavioral, physiological, or genetic barriers or differences.
Transgenic organisms can be scientifically or commercially useful only if __________.
the inserted ("foreign") gene is expressed in the host organism
In a typical colon cancer, the first step is ________.
the mutation of a proto-oncogene, producing an oncogene
What is macroevolution?
the origin of new species.
The evolutionary effects of genetic drift are greatest when __________.
the population size is small
DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows __________.
the presence of various-size fragments of DNA
What is nitrogen fixation?
the process of converting atmospheric nitrogen (N2) into a form usable by plants
What does Continental drift also explain?
the puzzling distribution of mansupials, mamals such as kangaroos, koals, and wombats whose young complete their embryonic development in a pouch outside the mothers body.
What is the fossil record?
the sequence in which fossils appear in rock strata is an archive of macroevolution.
What happens when a gene pool is isolated?
the splinter population can follows its own evolutionary course.
gene regulation
the turning on and off of specific genes within a living organism. Regulating gene activity allows for specialization of cells within the body, just as regulating which recipes are used allows for varying menus in multiple restaurants.
What are populations?
the units of evolution
Give an example of a geologic process that can isolate populations
the water level in a large lake may subside until there are several smaller lakes, each with a separate fish population.
Addition to microRNAs,
there is another class of small RNA molecules called small interfering RNAS (siRNAs)
Fossils of plants and animals from South America are very similar to those from West Africa because __________.
these parts of the world used to be physically joined together
What is cyanobacteria?
these photosynthetic cyanobacteria exhibit division of labor
Sequencing the DNA of organisms such as fruit flies and yeast is useful because __________.
they have many genes that are similar to those of humans
"Sticky ends" are very useful in genetic engineering because __________.
they provide a site for complementary base pairing so that pieces of DNA can be linked together
In 2015, the first nanospore sequencer went on the market
this device is the size of a small candy bar and connects to a computer through a USB port. Software allows the immediate identification and analysis of the sequence. This is one of many approaches to increase the rate and cut the cost of sequencing, while allowing the methodology to move out of the laboratory and into the field.
Using the methods of DNA technology, scientists can modify specific genes and move them between organisms as different as bacteria, pkants, and animals
this is true
What is the currently recognized classification scheme?
three-domain system
Read the following scenario to answer the following question.In some zoos, rare crosses between a male lion and a female tiger have produced hybrid offspring called "ligers." Male ligers are sterile but some female ligers are fertile. In the wild, lion and tiger ranges do not naturally overlap, making such a cross unlikely. Furthermore, the solitary behavior of tigers and the social organizations of lions create behavioral differences. Applying the biological species concept, the sterility of ligers reveals that ________.
tigers and lions are separate species
What is the main function of the CRISPR-Cas9 system?
to alter the nucleotide sequences of specific genes in a living cell
Scientists are also using genetic engineering
to improve the nutritional value of crop plants. One example is "golden rice 2", a transgenic variety of rice that carries genes from daffodils and corn. This rice could help prevent vitamin A deficiency and resulting blind fulness, especially in developing nations that depend on rice as a staple crop. Cassava, a starchy root crop that is a staple for nearly 1 billion people in developing nations, has similarly been modified to produce increased levels of iron and beta-carotene (which is converted to vitamin A in the body). However, controversy is apparent with the use of GM foods.
Genetically modified whole animals are used
to produce drugs
Genetically modified mammalian cells are used
to produce erythropoietin (EPO), a hormone used to treat anemia by stimulating production of red blood cells.
What is the function of the cotyledons?
to provide nutrition and food to the embryo
Systems biology is a very efficient way
to study emergent properties, novel properties that arise at each successive level of biological complexity as a result of the arrangement of building blocks at the underlying level. The more more we can learn about the arrangement and interactions of the components of genetic systems, the deeper will be our understanding of whole organisms.
Many substances have been recognized as carcinogens. Of known carcinogens, which is most responsible for causing cancer in humans?
tobacco
________ is(are) responsible for more cancers than any other carcinogen.
tobacco
The one substance known to cause more cases and types of cancer is
tobacco. By a wide margin, more people die from lung cancer (nearly 150,000 Americans in 2017) than from any other form of cancer. Most tobacco-related cancers are due to smoking cigarettes, but smoking cigars, inhaling secondhand smoke, and smokeless tobacco also poses risk. Exposure to some of the most lethal carcinogens is often a matter of choice: Tobacco use, the consumption of alcohol, and excessive time spent in the sun are all avoidable behaviors that affect cancer risk.
What is Bioremediation a tool for?
tool for cleaning up toxic chemicals released into. the soil and water by industrial processes
Gene expression involves the flow of information from genes to proteins, which is accomplished via __________ and __________.
transcription ... translation
Dioxin, produced as a by-product of some industrial chemical processes, is suspected of causing cancer and birth defects in animals and humans. It apparently acts by entering cells and binding to proteins, consequently altering the pattern of gene expression. In this way, dioxin acts by mimicking the action of ___________.
transcription factors
Use the accompanying figure to answer this question. The initiation of transcription requires that enhancers bind to ________.
transcription factors
Researchers have also developed
transgenic plant cells that can produce human drugs. The drug factories of the future may be carrots because they are easily grown in culture and are unlikely to be contaminated by human pathogens (such as viruses).
Which of the following genes inhibit cell division?
tumor-suppressor genes
How many domains is Eukarya divided into?
two kingdoms
One of the most potent carcinogens is
ultraviolet (UV) radiation. Excessive exposure to UV radiation from the sun can cause skin cancer, including a deadly type called melanoma. You can decrease your risk by using sun protection (clothing, lotion, hats).
As a mechanism of evolution, natural selection can be most closely equated with __________.
unequal reproductive success
The so-called sticky ends of a plasmid or bacterial chromosome are __________.
unpaired bases produced by a restriction enzyme
Putting a human gene into the plasmids of bacteria has enabled scientists to __________.
use bacteria as "factories" for protein products, such as insulin
Actual STR analysis
uses more than two sites and uses a different method to visualize the results. The differences in the locations of the bands reflect the different lengths of the DNA fragments. This gel would provide evidence that the crime scene DNA did not come from the suspect.
reproductive cloning
using a body cell from a multicellular organism to make one or more genetically identical individuals
Every Cell in your body-and, indeed, all the cells in the body of every sexually reproducing organism
was produced through successive rounds of mitosis starting from the zygote, the original cell that formed after fusion of sperm and egg.
A student is looking at a protozoan under the microscope. "I know it's supposed to be a ciliate, a flagellate, or an amoeba, but how am I supposed to know which it is?" she complains to her lab partner. "Easy," her partner says. "Just __________."
watch how it moves
Cancer occurs
when cells escape from the control mechanisms that normally limit their growth and division. This escape involves changes in gene expression.
Uncontrolled cell growth (cancer)
when mutation in a tumor-suppressor gene makes its protein defective, cells that are usually under the control of the normal protein may divide excessively, forming a tumor.
When is the biological species concept useful?
when we ask: what prevents a member of one group from successfully interbreeding with a member of another group?
transcription in eukaryotic cells
within a eukaryotic cell, transcription occurs in the nucleus, where RNA transcripts are processed into mRNA before moving to the cytoplasm for translation by the ribosomes.
Can the small changes from generation to generation, typical of evolution by natural selection, account for the large differences that we see between species or between groups of species?
yes
Ch 14 How Biological Diversity Evolves
yes
Lab 10 Post Lab Activity Bacteria, Protista, and Fungi Lab
yes
What are younger and older stratas found?
younger fossils are found in layers closer to the surface, whereas the deepest strata contain the oldest fossils.
