BMB 200 HW 4.2, HW 4.3, HW 5.1

During elongation, tRNA binds initially to the

"A" site on the ribosome.

Given below is a hypothetical wild-type polypeptide containing twelve amino acids (each letter arbitrarily represents one amino acid). Assume that gene X is responsible for its synthesis. L - K - J - I - H - G - F - E - D - C- B - A The amino acid A is at the C terminus, and amino acid L is at the N terminus of this polypeptide. The N terminus is synthesized first and corresponds to the 5' end of the mRNA. Assume a nonsense mutation involving bases 4, 5, and 6 in the coding region of the mRNA (counting from the 5' end of the coding region of the mRNA). What would be an expected amino acid sequence under this hypothetical condition?

-L

Here is a diagram (not to scale) of DNA in the process of replication. Choose the answer below that correctly identifies structures shown in the figure.

1 = 5' end; 2 = leading side; 3 = lagging side; 6 = topoisomerase

Match the name of the protein/enzyme with its correct function during replication. 1) break hydrogen bonds between DNA strands 2) polymerize RNA nucleotides into short fragment 3) remove supercoiling strain from DNA double helix 4) open up replication fork 5) polymerize DNA nucleotides into fragments or entire strands 6) covalently link two DNA fragments together 7) proofread newly synthesized DNA strand

1) Helicase 2) Primase 3) topoisomerase 4) Helicase 5) DNA polymerase 6) Ligase 7) DNA polymerase

Match each process involved in the central dogma to the correct description. 1) Uses DNA template to direct sequence of new DNA. 2) Uses DNA template to direct sequence of new RNA 3) Uses RNA template to direct sequence of amino acids

1) Replication 2) Transcription 3) Translation

Match the molecule with its correct function during translation. Use every choice only once. 1) An enzyme that adds an amino acid monomer to tRNA 2) Contains an anti-codon and specialized three dimensional structure 3) This is not used during translation 4) Is composed of both RNA and protein components 5) Binds to mRNA and AUG start codon to initiate translation 6) Contains a ribosome binding sequence and stop codon

1) amino-acyl synthetase 2) tRNA 3) RNA polymerase 4) Large ribosomal subuni 5) Small ribosomal subunit 6) mRNA

A particular triplet of bases in the coding sequence of DNA is GGG. The anticodon on the tRNA that binds the mRNA codon is

CCC

Which of these terms does not describe the DNA strand used to direct RNA synthesis?

Coding strand

Use this representation to answer the following questions. DNA template strand 5' ____________________________ 3' DNA coding strand 3' ____________________________ 5' Given the locally unwound double strand above, in which direction does the RNA polymerase move?

3' → 5' along the template strand

What is the start codon on the mRNA for prokaryotic translation?

AUG

An important process in the synthesis of new DNA is proofreading and repair. unwinding of the double helix. protection of single-stranded regions from nuclease action. all of these

All of these

DNA replication is a challenging process because: DNA strands must be separated New DNA is always synthesized from the 5' → 3' direction but the two template strands run in opposite directions The cell must guard against replication errors All of these

All of these

Which of the following is associated with post-translational processing of proteins? A) Folding into the 3-dimensional shape B) Breaking large proteins into several components with differing functions C) Forming disulfide bonds D) Modification of specific amino acids E) All of these

All of these

Which of the following is necessary for chain termination in protein synthesis? A) termination codons of mRNA B) release factors C) GTP D)all of these

All of these

All the following describe the general mechanism of DNA synthesis, except: From the perspective of the DNA template strands, one strand is made 5' → 3' while the other strand is made 3' → 5'. The strands become separated during synthesis. Synthesis occurs in both directions from the starting site of synthesis. Synthesis of DNA is a very accurate process. All of these are correct.

All of these are correct

As in RNA and DNA synthesis, the synthesis of proteins follows the following steps, except: A) Activation of monomers B) Initiation C) Elongation D) Termination E) All of these are involved in all polymer synthesis

All of these are involved in all polymer synthesis

Splicing reactions for exons involve the following mechanisms, except: A) Small nuclear RNAs B) Ribozymes C) Lariat mechanisms D) All of these are involved in splicing reactions

All of these are involved in splicing reactions

Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction?

DNA polymerase III

Which of the following correctly describes a difference between RNA & DNA polymerases?

DNA polymerases usually require a primer (i.e., they can only continue a strand, not start one), while most RNA polymerases do not.

Which of the following is not an advantage of degeneracy in the genetic code?

More than one amino acid can bind to a tRNA.

You've found this very short (hypothetical) mRNA in prokaryotic cell. Apply the genetic code using the codon chart to translate this mRNA into a short peptide. Use the three letter code to indicate amino acids. 5' UAUUCGGAAAUGAUUGCUUGUCCUUAAAAAGAG 3'

N-Met-Ile-Ala-Cys-Pro-C

Which ends of prokaryotic mRNA are protected from degradation?

Neither end

For a repressible operon to be transcribed, which of the following must occur?

RNA polymerase must bind to the promoter, and the repressor must be inactive.

Which of the following is a protein?

Repressor

The figure represents tRNA that recognizes and binds a particular amino acid (in this instance, phenylalanine). Which codon on the mRNA strand codes for this amino acid?

UUC

A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that binds the mRNA codon is

UUU

Which of the following is not required for the elongation phase of protein synthesis?

fmet-tRNAfmet

The direction of synthesis of a DNA strand is

from the 5' end to the 3' end on both strands.

What type of bonding is responsible for maintaining the shape of the tRNA molecule?

hydrogen bonding between base pairs

E. coli replication on the lagging strand

is initially synthesized as Okazaki fragments

A template strand of a gene has this base sequence: 3'TACAT#CCGATAGGGTCAT5'. Exposure to radiation causes a mutation in this gene. The thymine at the site of the mutation (#) is deleted. This will most likely result in

mRNA codons following the mutation to be misread

Polyadenylation of eukaryotic mRNA

occurs at the 3' end.

Capping of eukaryotic mRNA

occurs at the 5' end.

Using the genetic code, indicate which polypeptides would be synthesized if poly (UGG) were used as a synthetic mRNA?

poly(trp), poly(val), poly(gly)

A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG-ACG 3' (mRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the mRNA so that a dipeptide can form The dipeptide that will form will be

proline-threonine

The energetic driving force for nucleic acid synthesis is

removal of pyrophosphate from the incoming nucleotide

The elongation and termination phases of eukaryotic transcription

require several protein factors

A Shine-Dalgarno Sequence is a

sequence of nucleotides in an mRNA that interacts with the small subunit of a ribosome to begin translation.

Okazaki fragments are

short DNA pieces that explain how DNA is synthesized on the lagging strand.

Which category of RNA carries amino acids for the process of translation?

tRNA

The discontinuous aspect of DNA replication (i.e., that occurring on the lagging strand) is fundamentally caused by:

the 5' → 3' polarity restriction

What is the need for a primer strand in DNA replication?

the DNA polymerases require a preexisting strand with a nucleotide having a 3'−OH

In an analysis of the nucleotide composition of DNA, which of the following will be found?

A + C = G + T

The mRNA must contain the following to allow for initiation of protein synthesis in E. coli.

A Shine-Delgarno sequence.

What is the function of GTP in translation?

GTP energizes the formation of the initiation complex, using initiation factors.

What is the maximum number of amino acids that can be specified by a codon consisting of a sequence of two bases?

16

At which position on tRNA is the wobble base of the triplet anticodon?

1st position (5' letter)

A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG-ACG 3' (mRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the mRNA so that a dipeptide can form. The anticodon loop of the first tRNA that will complement this mRNA is

3' GGC 5'

A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding sequence of bases for the mRNA transcribed is

3' UCA 5'.

Suppose you found the following sequence of DNA on the coding strand of the double helix within a gene: 5' CTATGGCA 3' What is the mRNA sequence you could expect to find from this gene?

5' GAUACCGU 3'

An Okazaki fragment has which of the following arrangements?

5' RNA nucleotides, DNA nucleotides 3'

Which of the activities of DNA Polymerase I is most important in removing the primer?

5' → 3' exonuclease.

The following DNA sequence occurs at the start of a DNA strand: 3'AATTGCAGATTCA5'. Which of the sequences below would most likely bind to this sequence to initiate DNA replication?

5'UUAACGUCUAAGU3'

How many codons are possible in a system in which a sequence of three bases specifies a single amino acid?

64

The genetic code is essentially the same for all organisms. From this, one can logically assume which of the following?

A gene from an organism can theoretically be expressed by any other organism

Which of the following is the best description of an operon?

A group of genes under the control of a common promoter

What happens when a stop codon is reached by a ribosome (in the A site)?

A termination protein binds to the codon and is used to release the growing peptide from the P site tRNA. The ribosome then is likely to dissociate.

Here is a diagram (not to scale) of DNA in the process of replication. Choose the answer below that correctly identifies structures shown in the figure. You may use some choices more than once or not at all. A) Helicase B) topoisomerase (DNA gyrase) C) 5' end D) Primer E) Lagging Strand Template

A) #5 B) #6 C) #1 D) #1 E) #3

How do origins of replication differ in eukaryotes and prokaryotes?

Eukaryotes have several origins, while prokaryotes typically have one.

Which of the following statements about eukaryotic and prokaryotic RNA polymerases, is false?

Eukaryotic polymerases have the same number of subunits as prokaryotic ones.

In bacteria, each mRNA will bind to only one ribosome at a time.

False

Post-transcription processing of mRNA in prokaryotes is required.

False

Specificity of aminoacyl-tRNA synthetases is always based on the anticodon.

False

Wobble allows a single codon to code for more than one amino acid.

False

Activation of amino acids always takes place

In the Cytoplasm

Which of the following, when taken up by the cell, binds to the repressor so that the repressor no longer binds to the operator?

Inducer

Given below is a hypothetical wild-type polypeptide containing twelve amino acids (each letter arbitrarily represents one amino acid). Assume that gene Xis responsible for its synthesis. L - K - J - I - H - G - F - E - D - C- B - A The amino acid A is at the C terminus, and amino acid L is at the N terminus of this polypeptide. The N terminus is synthesized first and corresponds to the 5' end of the mRNA. Assume that a frameshift mutation results in an insertion of a base between the ninth and tenth positions of the coding region of the mRNA (counting from the 5' end of the coding region of the mRNA). What would be an expected amino acid sequence under this hypothetical condition? Different letters indicate a change in an amino acid.

L-K-J-R-S-T-U-I-Y-E-S-Q

Which of the following is not a function of initiation factors in E. coli?

Lead the initial tRNA to its correct position on the large subunit of the ribosome.

There is a mutation in the repressor that results in a molecule known as a super-repressor because it represses the lac operon permanently. Which of these would characterize such a mutant?

It cannot bind to the co-inducer.

Why might a point mutation in DNA make a difference in the level of protein's activity?

It might substitute an amino acid in the active site.

What is the function of the sigma (σ) subunit of RNA polymerase in E. coli?

It recognizes promoters where transcription should begin.

Which of the following is not a function of elongation factors in E. coli?

Keep the ribosomal subunits bound together

Single strand binding proteins are important for this activity:

Prevent single-stranded DNA from rewinding and protect it from degradation.

What is meant by the description "antiparallel" regarding the strands that make up DNA?

The 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand

The tRNA shown in the figure has its 3' end projecting beyond its 5' end. What will occur at this 3' end?

The amino acid binds covalently

A nonsense mutation is one in which:

The mutant protein is shorter than normal.

​​Assume this sequence of bases occurs somewhere in the middle of a protein coding region of mRNA and the reading frame begins with the C at the 5' end: 5' ....CUUGCUAGAUAU....3' Which of the following statements are true? Choose all that apply.

The tRNA with the anti-codon 3' GAA 5' will be the first to enter the A site for this region of the mRNA. The amino acid alanine will be incorporated into the protein. The amino acid tyrosine would be the "C-terminal" amino acid if the polypeptide stopped with this region of the mRNA.

What is the need for a primer in transcription?

There is none

Which of the following statements concerning tRNAs is false?

They are unique in that they are transcribed by DNA polymerases

Alternative splicing of exons is a mechanism to get more than 1 protein from the same gene

True

One major difficulty in replicating linear DNA molecules is replacing the segment of DNA occupied by the RNA primer on the telomeres at the ends of the DNA.

True

The DNA polymerases in eukaryotes have similar functions to those found in bacteria, but they are not identical.

True

The initiation of eukaryotic translation can be a control point in overall gene expression.

True

The major difference between RNA initiation in eukaryotes and prokaryotes is the number of factors involved in the process.

True

The proofreading of DNA is especially good because "the identity of each base pair is checked before the enzyme moves on to the next base pair."

True

The ribosome is actually a ribozyme

True

Transfer RNAs contain an anti-codon loop meant to match (base pair) with a codon on an mRNA

True

Which of the following codons does not code for an amino acid?

UAA

Initiation of RNA biosynthesis involves

conversion of the closed-promoter complex to the open-promoter complex

The majority of protein synthesis occurs in the

cytoplasm

The template for protein synthesis is:

a mRNA strand

The most commonly occurring mutation in people with cystic fibrosis is a deletion of a single codon. This results in

a polypeptide missing an amino acid

Semiconservative replication implies that

each of the new double stranded DNA molecules contains one of the original intact strands and one completely new strand.

A frameshift mutation could result from

either an insertion or a deletion of a base

The initial step in the formation of an aminoacyl-tRNA is

activation of the amino acid by reaction with ATP

The enzyme telomerase solves the problem of replication at the ends of linear chromosomes by which method?

adding numerous short DNA sequences such as TTAGGG

When the ribosome reaches a stop codon on the mRNA, no corresponding tRNA enters the A site. If the translation reaction were to be experimentally stopped at this point, which of the following would you be able to isolate?

an assembled ribosome with a polypeptide attached to the tRNA in the P site

An aminoacyl-tRNA is initially bound to the ribosome

at the A site on the 50S subunit

Where and how are Okazaki fragments synthesized?

at the lagging strand, oriented in a 5' → 3' direction

Choose all that apply. What is/are the universal feature(s) of DNA replication?

basepairing partners of nucleotides semi-conservative replication release of PPi from incorporated nucleotides polymerization in the 5' to 3' direction

Accuracy in the translation of mRNA into the primary structure of a polypeptide depends on specificity in the

bonding of the anticodon to the codon and the attachment of amino acids to tRNAs

Most repressor proteins are allosteric. Which of the following binds with the repressor to alter its conformation?

co-inducer

A lack of which molecule would result in the cell's inability to "turn off" genes?

co-repressor

The leading and the lagging strands differ in that

the leading strand is synthesized in the same direction as the movement of the replication fork, and the lagging strand is synthesized in the opposite direction.

The promoter site is

the site on DNA at which RNA polymerase binds to initiate transcriptio

The standard free energy change for the following reaction is about zero. amino acid + ATP + tRNA → aminoacyl-tRNA + AMP + PPi The driving force for this reaction in the cell is

the subsequent hydrolysis of pyrophosphate, which releases energy

Use this representation to answer the following questions. DNA template strand 5' ____________________________ 3' DNA complementary strand 3' ____________________________ 5' In the transcription event of the previous DNA, where would the promoter be located?

to the right of the template strand

After peptide bond formation takes place, what step is necessary for continuation of protein synthesis?

translocation of the ribosome

Which of these statements correctly describes what happens in the three ribosome sites during the elongation phase of translation?​

​The incoming charged tRNA arrives in the A site; a peptide bond is formed between the amino acids in the E and A sites.

Which of the following statements concerning RNA transcription is/are FALSE?​

​The template strand is read in the 5' to 3' direction. Transcription requires the use of a primer.