Chapter 15

The way that proteins fold into beta pleated sheets and alpha helices is dependent on their

Primary structure

Consider an image of an mRNA being translated. What is the sequence of the anticodon, from the 3' to 5' end, of the tRNA in the A site? What is next amino acid added to the growing polypeptide chain? Use the codon and codon table.

- UGC - Thr

Which of the statements about the genetic code are most accurate?

- An initiation codon sets the reading frame. - The genetic code is generally‑non‑overlapping.

When researchers obtain genomic sequence data from organisms with little known genetic information, they often search for open reading frames (ORFs) to classify potential genes. Suppose scientists have collected the sequence 5′−TAATGCCTAGTACCGGACTGAGTCAGTGTCTA−3′ 3′−ATTACGGATCATGGCCTGACTCAGTCACAGAT−5′ Select the reading frame that corresponds to each translational product. You may want to use the Codons table and the Amino Acid Abbreviations table. Stop codons are noted as a dash (-). Which reading frame is most likely a part of a larger ORF??

- Reading frame 3

Proteins are composed of _____ linked together by _____bonds.

- amino acids - peptide

Which of these is the first step of translation elongation?

A charged tRNA binds to the A site.

Which of the events occur during eukaryotic translation elongation?

A tRNA binds a codon and the ribosome adds amino acids from each tRNA to the polypeptide chain.

When mRNAs are being translated simultaneously by multiple ribosomes, the structure is known as a(n)

polyribosome.

Which of these is not involved in the initiation of translation in bacteria?

tRNA carrying the next amino acid that will occupy the A site