CHE 4342 Final Multiple Choice

अब Quizwiz के साथ अपने होमवर्क और परीक्षाओं को एस करें!

Which of the following molecules is NOT involved in Pentose Phosphate Pathway? A) Glucose-6-phosphate B) Fructose-6-phosphate C) Glyceraldehyde-3-phosphate D) 3-Phosphoglycerate E) 6-Phosphogluconate

D) 3-Phosphoglycerate

Which of the following molecules is NOT involved in Pentose Phosphate Pathway? A) Glucose-6-phosphate B) Fructose-6-phosphate C) Glyceraldehyde-3-phosphate D) 3-Phosphoglycerate E) 6-Phosphogluconate

D) 3-Phosphoglycerate

If the transcript's sequence is 5'-CUAAGGGCUAC-3', what is the sequence of the DNA template? A) 3'-GUAGCCCUUAG-5' B) 3'-GTACGGGAATG-5' C) 5'-GTAACCCTTAG-3' D) 5'-GTAGCCCTTAG-3' E) 5'-GUTACCUGUAG-3'

D) 5'-GTAGCCCTTAG-3'

Which of the following components would be condensed to form acetoacetate? A) acetyl CoA and acetyl-CoA B) HMG-CoA and acyl-CoA C) acetone and betahydroxybutyrate D) malonyl-CoA and acyl-CoA E) DHAP and glycerol-3-phosphate

A) acetyl CoA and acetyl-CoA

Heme oxygenase converts heme to __________ and releases ___________ and __________. A) biliverdin, Fe3+, CO B) bilirubin, heme, H2O2 C) Fe3+, bilibrubin, heme D) Both A and B. E) None of the above.

A) biliverdin, Fe3+, CO

The first step in pyrimidine biosynthesis is the formation of A) carbamoyl phosphate. B) carbamoyl aspartate. C) β-aminoisobutyrate. D) dihydroorotate. E) none of the above

A) carbamoyl phosphate.

Activators and repressors bind to target DNA sites called A) enhancers and silencers, respectively. B) CpG islands. C) epigenic centers. D) all of the above E) none of the above

A) enhancers and silencers, respectively.

Which of the following describes a sequence which will ultimately activate glycogen breakdown in a muscle? A) epinephrine binds β receptors. > cAMP > PKA > phosphorylase kinase > glycogen phosphorylase B) epinephrine bind α receptors > Ca2+ increase > phosphorylase kinase > glycogen phosphorylase C) glucagon > glucagon receptors > cAMP > PKA > phosphorylase kinase > glycogen phosphorylase D) PP1 binding to unphosphorylated Gm > dephosphorylates glycogen phosphorylase and phosphorylase kinase E) All of these will activate glycogen breakdown in a muscle.

A) epinephrine binds β receptors. > cAMP > PKA > phosphorylase kinase > glycogen phosphorylase

Which of the following would NOT result in the relaxation of supercoiled DNA? A) heating the DNA to induce denaturation B) nicking one strand C) treatment with pancreatic DNaseI D) treatment with type II topoisomerase E) treatment with type I topoisomerase

A) heating the DNA to induce denaturation

Knoop's experiments with fatty acids A) involved the novel use of chemical labels to elucidate metabolic mechanisms. B) demonstrated that fatty acids are broken down by two carbons at a time by oxidation at the ω carbon. C) demonstrated a distinct difference in the mechanism of odd chain versus. even chain fatty acid oxidation. D) A and B E) A, B, and C

A) involved the novel use of chemical labels to elucidate metabolic mechanisms.

Which enzyme is involved in tRNA charging? A. Aminoacyl tRNA synthetase B. RNA Polymerase C. Ligase D. Exonuclease E. DNA Polymerase

A. Aminoacyl tRNA synthetase

Which of the following is true with respect to Helicases? A. Bacteria encircle and translocate on the 5' to 3' direction B. Eukaryotes and archaea translocate on the lagging strand C. Translocation polarity is conserved D. Helicases do not require ATP hydrolysis E. Structure among Helicases is not conserved

A. Bacteria encircle and translocate on the 5' to 3' direction

What compound does the fifth carbon on a pyrimidine come from? a. Asparagine b. glutamine c. aspartate d. glutamate e. glycine

c. aspartate

Which of the following is NOT necessary for a plasmid to be a successful cloning vector? a. An origin of replication b. A selectable marker c. Multiple cloning sites d. Can be easily isolated e. Restriction sites produce blunt ends

e. Restriction sites produce blunt ends

4. Which of the following forms of DNA damage result in DNA base adducts? a. Ultra-violet Light b. Ionising Radiation c. Alkaylating agents d. None of the above

Ultra-violet Light

B form DNA is characterized by I. Left Handed II. C-2' endo sugar pucker conformation III. Anti glycosyl bond conformation a. I only b. II only c. I & II d. II & III e. I, II & III

d. II & III

Drosha is an enzyme that cuts I. miRNA II. pre-miRNA III. pri-miRNA a. I, II b. I only c. II only d. III only e. I, II, III

d. III only

When NADPH is needed what is converted in the pentose phosphate pathway? a. Fructose-6-phosphate b. GAP c. Glucose-6-Phosphate d. Ribose-5-Phosphate e. Ribulose- 5-phosphate

d. Ribose-5-Phosphate

Glycine is converted to what utilizing ____? a. N using transanimation b. P with dehydration c. H deamination d. S with PLP dependent reaction e. T by keto and gluco breakdown

d. S with PLP dependent reaction

Which of the following steps in protein synthesis (translation) does not cause any energy? a. Initiation b. Translocation c. Transpeptidation d. Termination e. They all cause some ATP or GTP

c. Transpeptidation

3.) Which of these correctly shows the order of a typical PCR method? a Denaturation, hybridization, elongation, repeat b Denaturation, elongation, hybridization, repeat c Restriction cutting, denaturation, hybridization, elongation d Denaturation, restriction cutting, hybridization, elongation e Elongation, denaturation, hybridization, screening

a Denaturation, hybridization, elongation, repeat

The first cycle of PCR produces __ ___ DNA molecules. a. 8 double stranded b. 2 single stranded c. 2 double stranded d. 4 single stranded e. 8 single stranded

2 double stranded

If a specific strand of DNA were to be damaged by UV light, which repair process would be most effective in repairing the damaged DNA? A) Base-Excision Repair (BER) B) Nucleotide-Excision Repair (NER) C) Mismatch Repair (MMR) D) Error-prone (SOS) repair E) Double Strand Break (DSB) repair

A) Base-Excision Repair (BER)

4) Which is the correct order of the 5 enzymes that are used during the Urea Cycle? A) Carbamoyl Phosphate Synthetase>Ornithine Transcarbamolyase>Argininosuccinase Synthetase >Argininosuccinase>Arginase B) Carbamoyl Phosphate Synthetase>Ornithine Transcarbamolyase>Argininosuccinase Synthetase >Arginase> Argininosuccinase C) Ornithine Transcarbamolyase> Carbamoyl Phosphate Synthetase >Argininosuccinase Synthetase >Argininosuccinase>Arginase D) Ornithine Transcarbamolyase >Carbamoyl Phosphate Synthetas>Argininosuccinase Synthetase >Arginase >Argininosuccinase E) Carbamoyl Phosphate Synthetase>Ornithine Transcarbamolyase >Argininosuccinase>Argininosuccinase Synthetase >Arginase

A) Carbamoyl Phosphate Synthetase>Ornithine Transcarbamolyase>Argininosuccinase Synthetase >Argininosuccinase>Arginase

In order to perform PCR, which of the following describes the reagents that must be included in the reaction mixture? A) DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase B) DNA fragment, primers flanking the region of interest, dNTPs, ddNTPS, DNA polymerase C) DNA fragment, one primer, dNTPs, DNA polymerase, DNA ligase D) DNA fragment, primers flanking the region of interest, dNTPs, DNA Ligase E) none of the above

A) DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase

A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation. If the original sequence is as follows, which example below represents a silent mutation? GUACAAGCAUGAAGUUUGGUAAGCG A) GUGCAAGCAUGAAGUUUGGUAAGCG B) GUACAAGCAUGAAAUUUGGUAAGCG C) GUACAAGCAUGAAGUUGGGUAAGCG D) GUACAGGCAUGAAGUUUGGUAAGCG E) GUACAAGCAUGAAGUUUGGUAACCG

A) GUGCAAGCAUGAAGUUUGGUAAGCG

Where do C4, C5, and N7 of the purine come from? A) Glycine B) Formate C) Aspartate Amide D) CO_2 E) Glutamine amide

A) Glycine

Increased levels of epinephrine in the blood will I. activate adenylate cyclase in liver and muscle cells. II. stimulate glycogen synthesis. III. inhibit glycolysis in the muscle cell. IV. stimulate gluconeogenesis in the muscle cell. A) I only B) I, II C) I, II, III D) II only E) I, II, III, IV

A) I only

Which of the following is required for entry of fatty acids into the oxidation pathway? I. priming via the enzyme acyl CoA synthetase II. conservation of free energy from ATP hydrolysis by use of a thioester linkage III. transport to the cytosol for oxidation via a carnitine carrier protein IV. hydrolysis of carnitine palmitoyl transfer protein A) I, II B) I, II, III C) I, II, III, IV D) III, IV E) I, III

A) I, II

How does the transcriptional machinery gain access to the nucleosome-sequestered DNA? I. Methylation of DNA prevents histone binding. II. Chromatin-remodeling complexes allow sections of DNA to be transiently exposed to transcription factors. III. The transcription proteins have higher affinity for DNA and push the histones away from binding sites. A) I, II, III B) I, II C) II, III D) I, III E) II only

A) I, II, III

Which of the following correctly describes the function of the repressor protein controlling expression of the trp operon? A) In the presence of tryptophan, the trp repressor tryptophan complex binds the operator inhibiting transcription. B) In the absence of tryptophan, the trp repressor tryptophan complex binds the operator inhibiting transcription. C) In the presence of tryptophan, the trp repressor tryptophan complex binds the operator enhancing transcription. D) In the absence of tryptophan, the trp repressor tryptophan complex binds the operator enhancing transcription. E) None of the above.

A) In the presence of tryptophan, the trp repressor tryptophan complex binds the operator inhibiting transcription.

How is fatty acid biosynthesis distinct from β oxidation? A) The growing acyl chain is attached to acyl-carrier protein rather than to CoA. B) It is an oxidative process. C) It takes place in the cell membrane. D) It is dependently regulated and employs the same enzymes. E) It utilizes water as hydrogen donor.

A) The growing acyl chain is attached to acyl-carrier protein rather than to CoA.

In glycogen synthesis, the intermediate between glucose-1-phosphate and glycogen is A) UDP-glucose. B) UDP-glycogen. C) glucose-1,6-bisphosphate. D) glucose-6-phosphate. E) glucose.

A) UDP-glucose.

Which of the following correctly describes the formation of CTP? A) UTP + Glutamine + ATP + H2O → Glutamate + ADP + Pi + CTP B) UMP + ATP + H2O + Glutamine → CMP + Glutamate + ADP + Pi C) TTP + N5,N10-Methylenetetrahydrofolate → CTP + Dihydrofolate D) UMP + Glutamine → Glutamate + CTP E) CMP + Glutamine + ATP → CTP + Glutamate + ADP + Pi

A) UTP + Glutamine + ATP + H2O → Glutamate + ADP + Pi + CTP

The Kv channel is transiently closed by ___________. A) a spherical globular segment on the N-terminus B) a C-terminal segment activated by proteolysis C) proteoglycan residues D) an ion larger than the selectivity filter blocking entry E) tightly-bound Ca2+

A) a spherical globular segment on the N-terminus

Which of the following is the starting metabolite in ketone body biosynthesis? A) acetyl CoA B) malonyl CoA C) propionlyl CoA D) acetyl CoA and propionyl CoA E) acetyl CoA and malonyl CoA

A) acetyl CoA

A person trying to get their "summer bod" recently went on a ketogenic diet (low glucose conditions). What are some of the effects in their body? A. Breath that smells like Acetone B. Lowered Acetylacetate concentration C. Inability to utilize fatty acids as a source of ATP D. Higher levels of pyruvate E. No NADH production

A. Breath that smells like Acetone

Which enzyme catalyzes the rate-limiting step in the Urea Cycle? A. Carbamoyl Phosphate Synthetase B. Ornithine Transcarbamoylase C. Argininosuccinate Synthetase D. Phosofructokinase

A. Carbamoyl Phosphate Synthetase

Which of the following is the rate limiting enzyme in the Pentose Phosphate Pathway? A. Glucose 6 Phosphate Dehydrogenase B. 6 - Phosphogluconolactonase C. Ribulose - 5 - phosphate isomerase D. Ribulose - 5 phosphate epimerase E. Transketolase

A. Glucose 6 Phosphate Dehydrogenase

Which of these are correct factors that play a role in chain length control? I. The interior cleft that accommodates growing polyketides. II. Tailoring using enzymes. III. The exterior cleft accommodates the growing polyketides A. I, II B. II only C. I only D. II, III E. II only

A. I, II

Which of the following are part of the transcription complex in Eukaryotes? I) IIF II) IIE III) IF-2 IV) RNA polymerase II A. I, II, IIV B. II, III C. I, III, IV D. I, II, III, IV

A. I, II, IIV

Which of the following definitions are wrong? I. Transition mutation is a mutation were a purine is switch with another purine II. Transversion is a mutation were a purine is switch with pyrimidine III. Transition is a mutation were a purine is switched with a pyrimidine IV. Transversion is a mutation were an analog of a base is inserted in place of the base A. I,II B. I,III C. II.III D. III.IV E. II only

A. I,II

Arginine is a unique amino acid because A. It can be synthesized by mammals but a lot of it is used in the urea cycle, so humans need to get it from plants and bacteria B. It cannot be synthesized by mammals C. We can get it from our diets D. It is made in the urea cycle so we do not need to get it from our diet E. None of the above

A. It can be synthesized by mammals but a lot of it is used in the urea cycle, so humans need to get it from plants and bacteria

Which is the peptide chain of this mRNA: AUGCAGAGAGAGUGUUACUGA? A. Met-Gln-Arg-Glu-Cys-Tyr B. Val-Lys-Ser-Cys-Pro-Trp-Leu C. Met-Phe-Arg-Asn-Ile-Val D. Val-Thr-Ser-Arg-Thr-Tyr-His

A. Met-Gln-Arg-Glu-Cys-Tyr

An interferon response, a form of innate immunity that leads to nonspecific reactions with foreign genetic material, was seen in mammalian cells. What was the cause of this response? A. Off-target effects of CRISPR B. Gene knockout by RNAi C. tracrRNA binding onto genomic target site D. A mutation in the H1 histone linker protein E. Mutation in a chromatin remodeling complex

A. Off-target effects of CRISPR

Which of the following Polymerases have 5' à 3' exonuclease activity? A. Pol I B. Pol II C. Pol III D. Pol I and Pol II E. Pol I, Pol II, and Pol III

A. Pol I

Which of the following Polymerases have 5' → 3' exonuclease activity? A. Pol I B. Pol II C. Pol III D. Pol I and Pol II E. Pol I, Pol II, and Pol III

A. Pol I

A plasmid can contain all of the following except? A. TATA box B. Origin of replication C. Polylinker D. Promotor E. ampR

A. TATA box

A plasmid can contain all of the following except? A. TATA box B. Origin of replication C. Polylinker D. Promotor E. ampR

A. TATA box

Glycogen Synthesis is inhibited by which of the following? I. ATP II. Pi III. ADP IV. G6P A. I and III B. I, III, and IV C. I, II, and III D. IV E. IV and II

C. I, II, and III

Which of following best describes the process for attachment of amino acid to the appropriate tRNAs? (Note: AA = amino acid, Pi = phosphate, PPi = pyrophosphate) A) AA + ATP → AA-P + ADP then AA-P + tRNA → AA-tRNA + Pi B) AA + ATP → AA-AMP + PPi thenAA-AMP + tRNA → AA-tRNA + AMP C) tRNA + ATP → tRNA-P + ADP then tRNA-P + AA → AA-tRNA + Pi D) tRNA + ATP → tRNA-AMP + PPi then tRNA-AMP + AA → AA-tRNA + AMP E) AA + GTP → AA-GMP + PPi then AA-GMP + tRNA → AA-tRNA + GMP

B) AA + ATP → AA-AMP + PPi then AA-AMP + tRNA → AA-tRNA + AMP

Which of the following steps is the flux controlling step of purine biosynthesis? A) Activation of Ribose 5-Phosphate (Step 1) B) Acquisition of N9 (Step 2) C) Acquisition of C8 (Step 4) D) Fumarate Elimination (Step 9) E) Cyclization to IMP (Step 11)

B) Acquisition of N9 (Step 2)

Which of the following pairs of antibiotic and its binding site is correctly matched? A) Tetracycline: E site B) Clindamycin: A and P site C) Chloramphenicol: Exit tunnel D) Streptomycin: Large subunit E) Puromycin: P site

B) Clindamycin: A and P site

Heterochromatin is A) DNA that is tightly condensed and transcriptionally active. B) DNA that is tightly condensed and transcriptionally inactive. C) DNA that is not condensed and transcriptionally active. D) DNA that is not condensed and transcriptionally inactive. E) DNA that is not condensed, but may or may not be transcriptionally active.

B) DNA that is tightly condensed and transcriptionally inactive.

Which of the following disrupts hydrogen bonding between base pairs by protonating some of the bases and decreasing Tm of double-stranded DNA? A) Increasing pH. B) Decreasing pH. C) Increasing monovalent salt concentrations. D) Increasing formamide concentrations. E) None of the above.

B) Decreasing pH.

Which of the following usages of siRNA is INCORRECT? A) Gene knockdowns B) Gene knockins C) Off-target effects D) Therapeutic techniques E) Analysis of signal transduction pathways

B) Gene knockins

Which of the following usages of siRNA is INCORRECT? A) Gene knockdowns B) Gene knockins C) Off-target effects D) Therapeutic techniques E) Analysis of signal transduction pathways

B) Gene knockins

5) Which of the following amino acids is purely ketogenic? A) Phenylalanine B) Lysine C) Proline D) Arginine E) Glycine

B) Lysine

What is the major difference between CRISPR and RNAi? A) The use of small RNAs (sRNA) to maintain genomic stability B) Pre-transcriptional cleavage of DNA versus post-transcriptional gene silencing C) Adaption of the natural biological processes for use in the lab in gene silencing experiments D) The use of siRNA for RNAi versus the use of miRNA for CRISPR E) CRISPR acts on RNA and RNAi acts on DNA

B) Pre-transcriptional cleavage of DNA versus post-transcriptional gene silencing

Which of the following describes the Holliday junction? A) point where DNA base excision repair initiates B) crossover point involving 4-stranded DNA structure in homologous recombination C) insertion point of a gene flanked in transposons D) point where MutS binds to initiate SOS response E) none of the above

B) crossover point involving 4-stranded DNA structure in homologous recombination

The steps required for peptide elongation at the ribosome are, respectively, A) initiation, elongation and termination. B) decoding, transpeptidation, and translocation. C) initiation, elongation, and release. D) aa-tRNA binding, GTP-peptidation, and translocation. E) none of the above

B) decoding, transpeptidation, and translocation.

Which of the following reaction sequences could result in glucose synthesis? A) fumarate → arginine → urea B) fumarate → malate → oxaloacetate C) citrulline → urea → aspartate D) urea → arginine → ornithine E) none of the above

B) fumarate → malate → oxaloacetate

RNA interference is a mechanism of posttranscriptional RNA-dependent A) chromatin-remodeling. B) gene silencing. C) histone methylation. D) coactivation. E) apoptosis.

B) gene silencing.

A genomic library A) is a collection of protein structures from a specific organism. B) is a collection of cloned DNA fragments representing all of an organism's DNA. C) contains only protein-coding DNA sequences. D) is best constructed from very short DNA fragments. E) is built from mRNA by reverse transcription.

B) is a collection of cloned DNA fragments representing all of an organism's DNA.

The neurotransmitters, dopamine, epinephrine, and norepinephrine are synthesized from the amino acid A) tryptophan B) tyrosine C) glutamate D) aspartate E) lysine

B) tyrosine

Which of the following is NOT an enzyme in DNA replication? A. Helicase B. Amylase C. Primase D. Ligase E. Exonuclease

B. Amylase

What are the advantages of alternative splicing? I. Rapid Protein Evolution II. Aid in conservation of gene sequences III. Allow for a single gene to encode many proteins IV. Allow for shorter, but more complex genes A. I and II B. I and III C. I, III, and IV D. III and IV E. II, III, and IV

B. I and III

In order for a plasmid to be a useful cloning vector in lab, it MUST contain i. Ori ii. MCS iii. ampR iv. Polylinker A. I only B. I, II, and IV only C. II and III only D. III only E. I, II, III, and IV

B. I, II, and IV only

In the RNAP closed complex form, which of the following occurs? I. Β & β' form the crab claw II. α does not form the crab claw III. α does form the crab claw. IV. σ binds across the enzyme closing the pincers A. II only B. I, III, IV C. I, IV D. II, IV E. I, III

B. I, III, IV

Which of the following is true of the Kv channels? I. Triggered by a positively charged helix II. T1 domain precedes the transmembrane domain III. As membrane potential is decreased, the S4 helix is pulled to the extracellular side IV. The inactivation ball pulls the channel to the external side of the cell A. I only B. I,II C. I, II, III D. III, IV E. I, II, III, IV

B. I,II

Which protein factor binds to the initiator tRNA and GTP during the translational initiation? A. IF-1 B. IF-2 C. IF-3 D. EF-TU E. RF-1

B. IF-2

Which is the correct order for Odd number fatty acid oxidation? I. Mutase rearranges CO2 to C3 and moves acetyl CoA from C1-C2 to C1-C3 II. Carboxylase reaction occurs III. Racemase rearranges to R configuration IV. Mutase rearranges CO2 to C3 and moves acetyl CoA from C1-C2 to C2-C3 A. I, III, II B. II, III, I C. II, III, IV D. III, I, II E. None of the above

B. II, III, I

Glucogenic amino acids can be converted to which of the following? I) Acetoacetate II) Pyruvate III) Acetyl-CoA IV) α-Ketoglutarate A. I, II, III B. II, IV C. I, III, IV D. I, II, III, IV

B. II, IV

Which of the following is matched incorrectly in regards to ubiquitination? I. Ub activating enzyme conjugates to Ub C-terminus II. Ub conjugating enzyme transfers to E2 with thiol transfer III. Ub protein ligase transfers E2 with a thiol transfer A. I only B. III only C. I, II D. II only E. II, III

B. III only

What is the role of Ub protein ligase (E3) in the ubiquitination process? A. It conjugates to Ub C-terminus B. It transfers activated Ub to Lys of protein to be degraded C. It is transferred to E2 with thiol transfer reaction D. It is adenylated to activate the C-terminus of Ub E. It binds to E1 in the first step of ubiquitination

B. It transfers activated Ub to Lys of protein to be degraded

Which amino acid is a tRNA synthetase with a Rossman Fold structural motif most likely to bind to? A. Tyr B. Leu C. Ala D. Lys E. Cys

B. Leu

Which part of the Argonaut structure catalyzes the cutting of mRNA? A. PAZ B. PIWI C. Dicer D.R2D2

B. PIWI

What is NOT true about DNA damage by oxidation? A. Result from exposure to ionizing radiation B. Repaired via NER C. Guanine is frequently targeted because of its low redox potential D. Leads to mismatched bases E. Leads to base sugar-phosphate damage and breakage

B. Repaired via NER

5. What is NOT a possible effect of RNAi technology? A. Silences genes by destroying mRNA. B. Silences genes by altering nucleotide sequence of mRNA. C. Silences genes by DNA methylation. D. Silences genes by blocking ribosomes from translating mRNA.

B. Silences genes by altering nucleotide sequence of mRNA

When there is a high concentration of glucagon in the body, what is the biological response? A. cAMP-phosphorylation, dephosphorylation of Acetyl-CoA Carboxylase and stimulation of biosynthesis. B. cAMP-dependent phosphorylation stimulates fatty acid oxidation and inhibits biosynthesis. C. cAMP-phosphorylation, dephosphorylation of Acetyl-CoA Carboxylase and inhibition of biosynthesis. D. cAMP-dependent phosphorylation stimulates fatty acid oxidation and stimulation of biosynthesis. E. There is no biological response to a high glucagon concentration in the body.

B. cAMP-dependent phosphorylation stimulates fatty acid oxidation and inhibits biosynthesis.

Which of the following atom in purine is derived from formate? A) C5 B) C6 C) C8 D) N1 E) N9

C) C8

Which of the following atoms in purine is derived from formate? A) C5 B) C6 C) C8 D) N1 E) N9

C) C8

Which of the following would result in single stranded DNA? A) Klenow fragment B) Klentaq I C) DnaB D) DnaG E) pol III

C) DnaB

High citrate concentration is an important signal for which process? A) Polyketide synthesis B) Non ribosomal peptide synthesis C) Fat production D) Amino acid degradation E) β-oxidation

C) Fat production

Which of the following accurately ranks lipoproteins from highest to lowest density? A) chylomicrons > HDL > LDL > IDL > VLDL B) HDL > IDL > LDL > VLDL > chylomicrons C) HDL > LDL > IDL > VLDL > chylomicrons D) chylomicrons > VLDL > IDL > LDL > HDL E) VLDL > IDL > LDL > HDL > chylomicrons

C) HDL > LDL > IDL > VLDL > chylomicrons

The pentose phosphate pathway is regulated by metabolic flux. Which of the following is an example of metabolic flux for this pathway? I. Low concentration of NADPH leads to R5P being converted to GAP and F6P II. Low concentration of NADPH leads to GAP and R5P being converted to R5P III. Low concentration of R5P will divert G6P and F6P to pentose phosphate IV. Low concentration of R5P will keep G6P and F6P in glycolysis A) I only B) II and IV C) I and III D) II only

C) I and III

Which of the following best describes the wobble hypothesis? I. The degree of variance in base pairing is greater at the 5' end of the anticodon, thus accounting for more than one codon. II. The degree of variance in base pairing is greater at the 3' end of the anticodon, thus accounting for more than one codon III. Non-Watson-Crick base pairing is sometimes allowed in the last position of the anticodon-codon pairing. A) I only B) II only C) I and III D) II and III E) III only

C) I and III

n E. coli, which of the following factors function to ensure the proper binding of tRNAf Met during mRNA binding and ribosomal subunit assembly? I. IF-1 II. IF-2 III. IF-3 IV. EF-Ts A) I only B) I, II C) I, III D) II, IV E) I, II, III

C) I, III

9) Which is true about DNA base pairing stability? I: Hydrogen bonding contributes greatly to dsDNA stability II: G/C Van der Waal's interactions are greater than those of A/T III: Cations are important, because they shield phosphates from extra charge A) I and II B) I, II, III C) II and III D) III only E) I and III

C) II and III

The conversion of dUMP to dTMP by thymidylate synthase requires which of the following cofactors? I. thioredoxin II. N5,N10-methylenetetrahydrofolate III. S-adenosylmethionine A) I and II B) I only C) II only D) II and III E) I and III

C) II only

The DNA helix is stabilized by I. hydrogen bonds between phosphate groups. II. stacking interactions. III. an entropically favored interaction between hydrophobic groups. IV. favorable electrostatic interactions. A) I, II, III, IV B) I, II, IV C) II, IV D) III, IV E) II, III

C) II, IV

Which of the following is (are) characteristic of the (Na+-K+)-ATPase? I. It binds Na+ and K+ simultaneously prior to binding ATP II. It is covalently modified by phosphorylation at an Asp residue when Na+ is present. III. Transport of Na+ and K+ occur in a 1:1 ratio, thus maintaining a balanced gradient until opening of the gated portion of the channel. IV. It is essential for excitation of nerve cells. A) I, II, IV B) II, III, IV C) II, IV D) II, III E) II

C) II, IV

Which of the following is TRUE regarding the Shine-Dalgarno sequence? A) It functions as a promoter sequence which recognizes and bonds the sigma factor. B) It is part of the operator sequence used to control translation. C) It is a nucleotide sequence involved in initiation of translation. D) It is a nucleotide sequence involved in termination of translation. E) none of the above

C) It is a nucleotide sequence involved in initiation of translation.

Which of the following statements about aminoacyl tRNA synthetase is correct? A) It binds several different amino acids B) It is a tRNA that covalently binds amino acids C) It is an enzyme that uses energy from ATP to attach a specific amino acid to a tRNA D) It synthesizes tRNA E) It synthesizes specific amino acids

C) It is an enzyme that uses energy from ATP to attach a specific amino acid to a tRNA

Which of the following statements about repetitive DNA sequences is FALSE? A) Both centromeres and telomeres contain repetitive DNA sequences. B) Short tandem repeats, such as (CA)n, may be due to replication slippage. C) Large sections of repetitive sequences are observed in prokaryotic and eukaryotic cells. D) Familial relationships can be determined by analysis of repetitive DNA. E) Repetitive sequences are found in some protein-coding genes.

C) Large sections of repetitive sequences are observed in prokaryotic and eukaryotic cells.

The body produces ketone bodies in periods of... A) High protein levels B) High carbohydrate levels C) Low carbohydrate levels D) Low protein levels E) Low nucleic acid levels

C) Low carbohydrate levels

Which of the following orders of DNA packaging is a correct? A) Nucleosomes → chromosome → 30nm fiber → loops → continued looping B) Nucleosomes → loops → continued looping → 30nm fiber → chromosome C) Nucleosomes → 30nm fiber → loops → continued looping → chromosome D) 30nm fiber → nucleosomes → loops → continued looping → chromosome E) 30nm fiber → loops → continued looping → nucleosomes → chromosome

C) Nucleosomes → 30nm fiber → loops → continued looping → chromosome

Which of the following statement(s) are true: A) Lysosomal proteases degrade only extracellular proteins that enter the cell by endocytosis. B) Proteins with the sequence Lys-Phe-Glu-Arg-Gln are selectively degraded by proteasomes. C) Proteins containing sequences rich in Pro, Glu, Ser, and Thr often have short half-lives. D) The addition of ubiquitin protects segments of a protein from proteolysis. E) All of the above are true statements.

C) Proteins containing sequences rich in Pro, Glu, Ser, and Thr often have short half-lives.

DNA polymerase γ is responsible for which of the following: A) Synthesizing the lagging strand. B) Synthesizing the leading strand. C) Synthesizing mitochondrial DNA. D) Initiating DNA replication. E) None of the above.

C) Synthesizing mitochondrial DNA.

Which of following describes proofreading for the addition of amino acids (AAs) to the growing peptide? A) An RNA component of the ribosome ensures that the correct AA is associated with the A site before addition occurs. B) An RNA component of the ribosome ensures that the correct AA has been added, but before the peptidyl-tRNA is shifted to the P site. C) The EF-Tu • GTP complex ensures that the correct AA is associated with the A site before addition occurs. D) EF-G ensures that the correct AA has been added, but before the peptidyl-tRNA is shifted to the P - site. E) No proofreading of this process occurs.

C) The EF-Tu • GTP complex ensures that the correct AA is associated with the A site before addition occurs.

What category of reaction converts orotate monophosphate (OMP) into uracil monophosphate (UMP)? A) a transamination B) a methylation C) a decarboxylation D) a carboxylation E) none of the above

C) a decarboxylation

In most organisms, replication proceeds in a ______ manner from the ______. A) discontinuous; leading strand B) unidirectional; chromosome ends C) bidirectional; replication origin D) bidirectional; chromosome ends E) discontinuous; chromosome ends

C) bidirectional; replication origin

When a section of DNA is damaged and polymerization cannot proceed, _____ repair can reconstitute the damaged replication fork. A) mismatch B) nucleotide excision C) recombination D) photoreactivation E) base excision

C) recombination

How many GTPs are hydrolyzed during 1 cycle of translational termination? A. 0 B. 1 C. 2 D. 3 E. 4

C. 2

Histone Octomer is made up of 2 copies of which histones? A. H1,H2,H3,H4 B. H1, H2A,H2B,H3 C. H2A,H2B,H3,H4 D. H1,H2A,H2B,H4 E. H2A, H2B, H3A, H3B

C. H2A,H2B,H3,H4

Which of the following are challenges in polyketide drug development? I. Polyketides are expensive II. Polyketides are difficult to analogue III. Technology for discovering and making polyketides are constantly changing A. I only B. II only C. I and II D. I, II, and III E. None of the above

C. I and II

Which of the following is(are) the muscle cell's response to hormones? I. Epinephrine binds to the Beta-adrenoreceptor and promotes glycolysis II. Insulin binds to the insulin receptor and promotes glycogen synthesis III. Epinephrine binds to the Alpha-adrenoreceptor and promotes glycogen degradation IV. Glucagon binds to the glucagon receptor and promotes glycogen degradation A. I only B. II only C. I, II only D. I, II, III only E. I, II, III, IV

C. I, II only

Glycogen Synthesis is inhibited by which of the following? I. ATP II. Pi III. ADP IV. G6P A. I and III B. I, III, and IV C. I, II, and III D. IV E. IV and II

C. I, II, and III

Which is a source of feedback regulation for purine synthesis? I) ADP inhibiting the production of 5-Phosphoribosylamine II) GMP activating the production of XMP III) ATP activating the production of GMP IV) PRPP stimulating the production of 5-Phosphoribosylamine A. I only B. I, II, III, IV C. I, III, IV D. II, IV, III

C. I, III, IV

Which is a source of feedback regulation for purine synthesis? I) ATP stimulating the production of Carbamoyl aspartate II) CTP activating the production of Carbamoyl aspartate III) UDP activating the production of Carbamoyl phosphate IV) CTP inhibiting the production Carbamoyl aspartate A. I only B. II, III C. I, IV D. II, IV

C. I, IV

High concentrations of Citrate will result in i. Inhibition of Acetyl CoA Carboxylase (1st enzyme in Fatty Acid Biosynthesis) ii. Shuttling of Acetyl CoA into cytoplasm iii. Signal for B-Oxidation to occur iv. Heightened production of ATP A. IV only B. I, II, and IV only C. II only D. II and III only E. None of the above

C. II only

Which is not a reaction of the urea cycle? I. Condensation and Activation of NH3 II. Transfer carbamoyl group III. Condensation with bicarbonate IV. Elimination with fumarate V. Hydrolysis of ornithine to urea and arginine A. I, III B. II, IV C. III, V D. II, III, V E. I, III

C. III, V

There was a mutation found on EF-TU. What will be an effect seen in the cell? A. Inability for the 50S subunit to bind to the 30S subunit B. fMet-tRNA will not be incorporated into the ribosome C. Incomplete binding of aa-tRNA to ribosome D. Increased GTP hydrolysis E. Heightened rate of translocation seen in the ribosome

C. Incomplete binding of aa-tRNA to ribosome

7. The rate of synthesis of GMP ___________ with high ________. A. Decreases; [CTP] B. Breaks down; proteases C. Increases: [ATP] D. Does not change; [GTP]

C. Increases: [ATP]

Ribosomal drugs target the following except A. Ribosome assembly B. Peptidyl Transferase C. Prevents crosslinking of peptidoglycan to form a rigid cell wall D. Block tRNA binding E. Block peptide chain exit

C. Prevents crosslinking of peptidoglycan to form a rigid cell wall

During transcription in E. coli, the RNA polymerase Holoenzyme binds to what location on the gene? A. Operator B. Shine Dalgarno Sequence C. Pribnow box D. TATA box E. Start Site

C. Pribnow box

During transcription in E. coli, the RNA polymerase Holoenzyme binds to what location on the gene? A. Operator B. Shine Dalgarno Sequence C. Pribnow box D. TATA box E. Start Site

C. Pribnow box

What products are glucogenic amino acids degraded to? A. Pyruvate, fatty acids, ketone bodies B. Succinyl-coA, fatty acids, ketone bodies, malonic acid C. Pyruvate, a-ketogluterate, succinyl-coA, fumarate, oxaloacetate D. Pyruvate, fumarate, oxaloacetate, glucose, malonic acid E. Oxaloacetate, fumarate, malonic acid, ketone bodes, succinyl-coA

C. Pyruvate, a-ketogluterate, succinyl-coA, fumarate, oxaloacetate

Which of the following is not true about the Na+-K+ ATPase pump? A. The Na+-K+ ATPase pumps Na+ out and K+ in coupled to ATP hydrolysis B. ATP is utilized in phosphorylation of Asp to trigger a conformational charge that pumps 3Na+ out C. Two potassium ions (2K+) bind to the intracellular side D. Hydrolysis of PO4 returns to original shape and transports K+ out of the cell E. None of the above

C. Two potassium ions (2K+) bind to the intracellular side

For the regulation of pentose phosphate pathway which of the following is not correct A. When NADH is needed excess R5P is converted to glycolytic intermediates GAP and F6P B. Flux through the pentose phosphate pathway and the rate of NADPH production is controlled by the rate of the G6P dehydrogenase reaction C. When there are excess glycolytic intermediates like F6P and GAP more pyruvate is made D. Excess ATP and NADH will favor the pentose phosphate pathway and nucleotide synthesis E. None of the above

C. When there are excess glycolytic intermediates like F6P and GAP more pyruvate is made

Which of the following is step in the elongation portion of translation? A. Small subunit recognizes mRNA. B. Initiator tRNAMET base pair with start codon on mRNA. C. tRNA moves to the P site. D. Large Subunit joins to the small subunit E. Protein initiator factors are recruited.

C. tRNA moves to the P site.

What happens when a stop codon is reached by a ribosome? A) A termination tRNAter binds to the codon and is used to release the growing peptide from the P site tRNA. The ribosome then is likely to dissociate. B) A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter reaches the P site, the ribosome is signaled to release the protein. The ribosome then is likely to dissociate. C) A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter reaches the P site, the ribosome dissociates. A separate peptidyl transferase then releases the protein from tRNAter. D) A release factor binds to the codon and is used to release the growing peptide from the P site tRNA. E) A release factor binds to the codon and the ribosome dissociates. A separate peptidyl transferase then releases the protein from the last tRNA to which was attached

D) A release factor binds to the codon and is used to release the growing peptide from the P site tRNA

Which of the following are NOT ways to activate the E3 Ub protein ligase in ubiquitination? A) Phosphorylation by protein kinase B) Allosteric transition caused by ligand binding C) Allosteric transition caused by protein subunit addition D) Adenylation of the ubiquitin molecule E) None of the above (all are ways to activate the E3 Ub protein ligase)

D) Adenylation of the ubiquitin molecule

Which of the following is NOT part of the PCR protocol? A) Denaturing the single stranded DNA B) Extending the primers using the Taq polymerase C) Oligonucleotide primers flank to a targeted DNA sequence D) All are included in the PCR protocol E) None are included in the PCR protocol

D) All are included in the PCR protocol

Which of the following are ribosomal functions? A) Mediate interactions of nonribosomal proteins that are required for polypetide chain initiation, elongation, and termination. B) Catalyze peptide bond formation between the incoming amino acid and the growing polypeptide chain. C) Responsible for the translocation of mRNA so that codons are read sequentially. D) All of the above. E) None of the above.

D) All of the above.

What is the overall reaction of an amino acid being attached to a tRNA via aaRS? A) Aminocyl-AMP + ATP ↔ aminocyl-tRNA + AMP + PPi B) Amino acid + AMP ↔ aminocyl-AMP + PPi C) Aminocyl-ADP + tRNA ↔ aminocyl-tRNA + ADP + PPi D) Amino acid + tRNA + ATP ↔ aminocyl-tRNA + AMP + PPi E) None of the above.

D) Amino acid + tRNA + ATP ↔ aminocyl-tRNA + AMP + PPi

Which of the following statements about the structure and conformation of DNA is FALSE? A) DNA binding proteins distort DNA structure B) Changes in ionic strength can alter DNA structure C) Specific sequences can cause deviations in conformation. D) Changes in DNA conformation result from energy minimizations and do not relate to in vivo conditions. E) All of the above are true.

D) Changes in DNA conformation result from energy minimizations and do not relate to in vivo conditions.

Which of the following statements is true regarding ion channels? A) Protein structure studies indicate a flexible pore size capable of transporting ions of varying size. B) Ions require waters of hydration for sufficient passage through the entire channel. C) Ion channels maintain sodium and potassium ion concentrations that are greater in the extracellular fluid than in the cytosol. D) Channel rigidity minimizes energy states for appropriately sized ions. E) None of the above is true regarding ion channels.

D) Channel rigidity minimizes energy states for appropriately sized ions.

What is the function of Colipase? A) Hydrolyzes phospholipids to yield binding protein lysophospholipids and free fatty acids. B) Transports lipid digestion products through the lymphatic system and then the bloodstream to the tissues. C) Transports through the bloodstream free fatty acids released from adipose tissue stores. D) Helps bind lipase to the lipid-water interface. E) Forms micelles that take up nonpolar lipid degradation products and helps transport them through the intestinal wall.

D) Helps bind lipase to the lipid-water interface.

DNA ligase can be activated by which of the following? I. The coupled hydrolysis of NAD+ to (NMN+) + AMP. II. The coupled hydrolysis of ATP to AMP + PPi. III. The coupled hydrolysis of GTP to GMP + PPi. A) I only B) II only C) III only D) I, II E) I, III

D) I, II

Proteins targeted for destruction via the ubiquitin pathway include I. proteins with a destabilizing N-end rule component. II. proteins with a PEST sequence. III. proteins that contain the RING finger E3 component named E3a. IV. protein with polyubiquitin proteins. A) I only B) II only C) I, II, III D) I, II, IV E) II, IV

D) I, II, IV

If cAMP levels are high I. Glycogenolysis will occur in muscle cells but not liver cells. II. Glucose released from muscle glycogen will enter glycolysis. III. Glucose released from liver glycogen will exit liver cells via the GLUT4 transporter. IV. Glucose will enter liver cells resulting in glycogen synthesis. A) I, II, IV B) I, II C) II, III, IV D) II only E) III only

D) II only

Which of the following is TRUE regarding the enzyme acetyl-CoA carboxylase? I. It catalyzes the first committed step in fatty acid oxidation. II. It requires S-adenosylmethionine. III. It produces malonyl CoA IV. It uses acetyl CoA A) I, II, III, IV B) I only C) I, III, IV D) III, IV E) III only

D) III, IV

Which of the following statements about glycogen is true? I. Glycogen is a polymer of glucose in α(1→6) linkages with α(1→4) linked branches every 8-14 residues. II. UDP-glucose is produced from glycogen by the action of the enzyme phosphorylase. III. In glycogen breakdown, glucose residues are sequentially removed from the nonreducing ends. IV. The breakdown of glycogen in skeletal muscle ultimately supplies glucose-6-phosphate, which can enter glycolysis to generate ATP. A) I, II, III, IV B) I, II C) II, III, IV D) III, IV E) III only

D) III, IV

6) Asparagine is considered to be a/an ____________ amino acid, which means that it __________. A) Essential; not made within the human body B) Glucogenic; made regularly within the human body C) Nonessential; not made within the human body D) Nonessential; made regularly within the human body E) Essential; made regularly within the human body

D) Nonessential; made regularly within the human body

In E. coli, base-pairing between an mRNA's ______ and the 3′ end of the 16S rRNA permits the ribosome to select the proper initiation codon, thus minimizing ______. A) start codon; abortive initiation B) Shine-Dalgarno sequence; abortive initiation C) start codon; frameshift mutations D) Shine-Dalgarno sequence; frameshift mutations E) none of the above

D) Shine-Dalgarno sequence; frameshift mutations

Which of the following pairs of DNA damage and its repair pathway is incorrectly matched? A) Alkylating agents: Base-excision repair B) Replication errors: Mismatch repair C) Bulky adduct: Nucleotide-excision repair D) Single-strand break: Recombinational repair E) 8-Oxoguanine: Base-excision repair

D) Single-strand break: Recombinational repair

Which best describes the synthesis of purine nucleotides? A) The basic ring structure, orotate, is synthesized and then linked to PRPP. This is then modified to produce either GMP or AMP. B) The basic ring structure, inosine, is synthesized and then linked to PRPP. This is then modified to produce either GMP or AMP. C) The basic ring structure, orotate, is synthesized stepwise on PRPP. This is then modified to produce either GMP or AMP. D) The basic ring structure, inosine, is synthesized stepwise on PRPP. This is then modified to produce either GMP or AMP. E) The basic ring structure, orotate, is synthesized and then linked to PRPP. This is then modified to produce either UMP or CMP.

D) The basic ring structure, inosine, is synthesized stepwise on PRPP. This is then modified to produce either GMP or AMP.

A circular 25000 base pair DNA molecule with no supercoils will have _____ helical twists if it is B-DNA. A) about 2.5 B) about 25 C) about 250 D) about 2500 E) about 25000.

D) about 2500

The lifetime of a protein in cells actively involved in metabolism A) is longer in eukaryotes than in prokaryotes. B) ranges from months to years. C) is independent of the function and activity of the protein. D) can change in response to changes in metabolic hormone levels. E) none of the above

D) can change in response to changes in metabolic hormone levels.

Which of the following is not an example of a passive-mediated transporter? A) aquaporins B) the Kv ion channel C) GLUT1 D) lactose permease E) none of the above

D) lactose permease

Posttranslational modifications to proteins include all of the following, except A) glycosylation. B) phosphorylation. C) amino acid derivatization. D) peptide joining. E) proteolysis.

D) peptide joining. E) proteolysis.

Small circular DNA molecules used to carry foreign DNA fragments are called ________. A) mRNAs B) bacteriophage C) clones D) plasmids E) nucleotides

D) plasmids

Lactose permease uses a ___________ gradient generated ______ to cotransport lactose across the cell membrane. A) potassium; via the Na+/K+ pump B) potassium; via oxidative metabolism C) proton; via the Na+/K+ pump D) proton; via oxidative metabolism E) chloride; within the intestinal lumen

D) proton; via oxidative metabolism

The apparent correlation between histone modification and control over gene expression is termed A) architectural model. B) polymorphism. C) chromatin remodeling. D) the histone code E) the nucleosome code

D) the histone code

Ketones bodies are ways to store which molecule A. Glucose B. Amino acids C. Fatty acids D. Acetyl Co-A E. S-adenosylmethionine

D. Acetyl Co-A

Ketones bodies are ways to store which molecule A. Glucose B. Amino acids C. Fatty acids D. Acetyl Co-A E. S-adenosylmethionine

D. Acetyl Co-A

What makes Dicer an effective enzyme? A. Its ability to bind all ssRNA strands B. The absence of a nucleotide overhang C. Its binding following the incorporation of the RISC complex D. Correspondence between the PAZ and RNase III distance with length of siRNA fragment E. Its activation of Slicer

D. Correspondence between the PAZ and RNase III distance with length of siRNA fragment

An enzyme that inhibits Thiamine Pyrophosphate in the Pentose Phosphate pathway would see what effects? A. An increase in GAP production B. A buildup of Fructose-6-Phosphate C. Increased ATP production D. Feedback inhibition of the production of 1,3-bisphosphoglycerate and NADH E. No effects

D. Feedback inhibition of the production of 1,3-bisphosphoglycerate and NADH

D. Hydrolysis of PO4 returns to original shape and transports K+ out of the cell

Which of the following correctly describes the regulation of the lac operon? I. Absence of lactose à Repressor binds to operator, prevents transcription of two genes II. Presence of lactose à Repressor binds to operator, prevents transcription of two genes III. Absence of lactose à Binds repressor and releases, allows transcription of operator genes IV. Presence of lactose à Binds repressor and releases, allows transcription of operator genes A. II only B. I and II only C. III and IV only D. I and IV only E. None of the above are correct

D. I and IV only

Plasmids useful as cloning vectors must have the following: I. An origin of replication II. A selective marker such as ampicillin resistance III. Can be able to replicate each time the cell DNA replicates IV. A multiple cloning (MCS) site where insertion of foreign DNA will not disrupt replication or inactivate essential markers A. I, II B. II,III C. II, III, IV D. I, II, IV E. I.IV

D. I, II, IV

Which of the following is(are) true for Type 1 topoisomerase? I. Cuts ssDNA only II. ATP-dependent III. Relaxes only negative supercoils IV. Present in all cells A. I only B. I, II only C. I, II, III only D. I, III, IV only E. I, II, III, IV

D. I, III, IV only

What are glucogenic amino acids. I. Amino acids degraded to acetyl CoA, acetoacetate used to make fatty acids or ketone bodies II. Amino acids degraded to pyruvate, α-Ketogluterate, succinyl CoA, fumarate or oxaloacetate III. Amino acids that are degraded to release ATP A. I,II,III B. I, II C. I only D. II only E. I, III

D. II only

The protein synthesis inhibitor puromycin I. Causes premature chain termination by entering the P site and transferring to the peptidyl chain II. Causes apoptosis III. More resistant to hydrolysis to incorporated the next aa-tRNA IV. Contain ester linkage instead of amide linkage A. I, II, III B. I,II, IV C. II, III,IV D. II, III

D. II, III

D. II,III

Which contributes to the phase transition in the bilayer? I. Transition temperature decreases with chain length, saturation II. Transition temperature increases with cholesterol III. Transition temperature increases with chain length, saturation. A. I, II B. II only C. I only D. III only E. II,III

D. III only

Which is not a step in the PCR protocol? I. Heat to separate strands II. Hybridize primers III. Remove nucleotides to initiate DNA synthesis IV. Rapidly cool to anneal the primers A. I only B. II, III only C. IV only D. III only E. none of the above are wrong

D. III only

What role do the metal ions in DNA polymerase play in its mechanism? A. General base to initiate 3'-OH attack B. Donate electron density to phosphate backbone C. Stabilize negative charge on the N atoms of the base D. Stabilize negative charge on the leaving oxygen of phosphate backbone E. Activate H2O for attack

D. Stabilize negative charge on the leaving oxygen of phosphate backbone

Which of the following statements is wrong? A. The sense strand has the same sequence as the mRNA B. The antisense strand is complimentary to the mRNA C. The antisense strand is transcribed D. The antisense strand is the coding strand

D. The antisense strand is the coding strand

Which is the mRNA component to this segment of DNA: AATCGGTCGAACGCGTA? A. CGCGCGAUCGAUCGA B. AGAGAGCGCGAUAGC C. UUGACGAGCUAGCGC D. UUAGCCAGCUUGCAU

D. UUAGCCAGCUUGCAU

Which of the following is the gated ion channel that opens in response to a change in membrane potential called? A. Mechanosensitive B. Ligand - gated C. Sigal -gated D. Voltage - gated E. Na+ - K+ ATPase pump

D. Voltage - gated

The pentose phosphate pathway converts glucose to the ribose-5-phosphate needed for DNA synthesis. What other PPP product is required for DNA synthesis? A) Glutamine B) Fumarate C) Asparate D) NAD+ E) All of the above.

E) All of the above.

Which posttranscriptional modification(s) below occur in eukaryotes? A) Endonucleolytic cleavage B) 5' Cap C) Splicing D) Polyadenylation E) All of the above.

E) All of the above.

Gated ion channels I. exist because active transporters cannot maintain the gradient at a rate equal to non-gated ion flow. II. remain open unless acted on by an external stimulus. III. remain open to all ions that are smaller than the pore diameter. IV. can transport varying ions. A) I, II B) I, III C) II, III D) II, IV E) I

E) I

The RISC effector complex can cause I. Post-transcriptional cleavage of mRNA II. Translational repression of the mRNA III. Transcriptional silencing A) Only I B) Only II C) I, II D) II, III E) I, II, III

E) I, II, III

Which of the following statement(s) about DNA polymerase III (Pol III) is (are) TRUE? I. DNA polymerase III has greater accuracy than RNA polymerase. II. Pol III is the primary replicase of E. coli. III. Pol III does not contain 5' to 3' exonuclease activity. A) I, II. B) II, III. C) III only. D) I only. E) I, II, III.

E) I, II, III.

Which of the following best describes the function of the glycogen debranching enzyme in glycogenolysis? A) It cleaves α(1→6) branch points releasing glucose-6-phosphate. B) It cleaves α(1→6) branch points releasing glucose-1-phosphate. C) It cleaves α(1→6) branch points releasing glucose. D) It transfers an α(1→4) linked trisaccharide unit to the nonreducing end of an alternate branch, then cleaves the α(1→6) branch point releasing glucose-1-phosphate. E) It transfers an α(1→4) linked trisaccharide to the nonreducing end of an alternate branch, then cleaves the α(1→6) branch point releasing glucose.

E) It transfers an α(1→4) linked trisaccharide to the nonreducing end of an alternate branch, then cleaves the α(1→6) branch point releasing glucose.

Which of the following pairs of DNA damaging agents and repair processes is correct? A. X-Ray damange and Nucleotide-excision repair B. Replication errors and Base-excision repair C. Alkylating agents and Recombinational repair D. UV light and Mismatch repair E. cis-Pt and Recombinational repair

E. cis-Pt and Recombinational repair

Which of the following statements about lipid metabolism is FALSE? A) Franz Knoop experiment used chemical labels to trace metabolic pathways. B) Fatty acids are progressively broken down in a 2-carbon mechanism. C) Fatty acids are activated by acyl-CoA synthetase. D) The final product of fatty acid oxidation is acetyl-CoA. E) Ketone bodies are produced in low concentrations of acetyl-CoA.

E) Ketone bodies are produced in low concentrations of acetyl-CoA.

During translation, the reaction catalyzed by peptidyl transferase is coupled to which of the following? A) ATP → ADP + Pi B) ATP → AMP + PPi C) GTP → GDP + Pi D) GTP → GMP + PPi E) Release of the tRNA in the P site

E) Release of the tRNA in the P site

The mechanism of the condensing enzyme (KS) of fatty acid synthase is best described as A) base catalysis using a glu residue in the active site B) acid catalysis using a glu residue in the active site C) base catalysis using a cys residue in the active site D) acid catalysis using a cys residue in the active site E) covalent catalysis using a cys residue in the active site

E) covalent catalysis using a cys residue in the active site

Which of the following would likely result in the formation of RNAi? A) injection of antisense RNA from a human into human cells B) injection of sense RNA into C. elegans C) injection of antisense RNA from yeast into a human D) all of the above E) none of the above

E) none of the above

What is the correct function of helicases? A. Unwind duplex DNA coupled with ATP hydrolysis B. Translocate unidirectionally C. Bacteria translocate in 5' to 3' direction D. Eukaryotes translocate in the 3' to 5' direction E. All of the above

E. All of the above

Which of the following are NOT true concerning lysosomes? A. It performs non-selective, basal degradation. B. It performs degradation under starvation C. It selects for "KFERQ" proteins D. It is active at pH 5.0 E. All of the above are true

E. All of the above are true

Which step in Purine Biosynthesis is NOT regulated by ATP? A. Activation of ribose-5-phosphate to PRPP B. Acquisition of C4, C5, and N7 to GAR C. Acquisition of N3 to FGAR D. Formation of imidazole ring to AIR E. Cyclization to IMP

E. Cyclization to IMP

Which of the following modifications to a membrane bilayer would increase the transition temperature? A. Increase the cholesterol content B. Substitute all 16-carbon lipids with 13-carbon lipids C. Increase the number of lipids with double bonds. D. Increase the salt concentration E. Decrease the cholesterol content

E. Decrease the cholesterol content

SUMOylation can do all of these except: A. Inhibit interactions B. Facilitate interactions C. Change conformations D. Targets Lys E. Degradation

E. Degradation

Which of the following are spontaneous forms of DNA damage? I. Base tautomerization II. Base deamination III. Oxidative DNA damage A. I only B. II only C. I and III only D. I and II only E. I, II and III

E. I, II and III

Which of the following is not a building block of cholesterol synthesis? A. Acetyl COA B. HMG-COA C. Mevalonate D. Lanoesterol E. Palmitate

E. Palmitate

Which protein factor is bound by GDP during the translational termination? A. IF-1 B. IF-2 C. RF-1 D. RF-2 E. RF-3

E. RF-3

Which of the following statements is false? A. Right handed DNA is called the A form and has a helix rise per base pair of 2.6Å. B. B DNA is right handed and has a suger pucker conformation of C-2' endo. C. The diameter of Z form DNA is ~18Å, while the diameter of A form DNA is ~26Å. D. The glycolsyl bond conformation for Z DNA is syn for purines and anti for pyrimidines. E. The Base tilt normal to the helix axis is 7° for B DNA and 6° for Z DNA.

E. The Base tilt normal to the helix axis is 7° for B DNA and 6° for Z DNA.

E. cis-Pt and Recombinational repair

Which of the following is incorrect with regards to tRNA structure a) 3'-terminal phosphate b) 7bp stem loop c) 3-4bp stem with 5-7 base loop with dihydrouridine d) 5bp stem with anticodon loop (anticodon arm) e) 5bp step with loop containt pseudouridine (T-arm)

a) 3'-terminal phosphate

Which amino acid residues are ideal for acetylation post-translational modifications I. Lysine II. Arginine III. Threonine IV. Serine a) I only b) I & II c) IV only d) II, III & IV e) I, II, III & IV

a) I only

RISC... a) Requires ATP hydrolysis to assemble b) Contains the Argonaute, Slicer, and Dicer c) Slices up mRNA that is complimentary to the bound miRNA d) Occurs in posttranslational gene silencing e) Has a substrate known as Slicer that acts as a molecular ruler f) Is a fun board game of global domination

a) Requires ATP hydrolysis to assemble

The Pentose Phosphate Pathway will produce F6P & GAP when: a) The cell wants to synthesize pyruvate b) The cell wants to synthesize nucleotides c) The cell wants to synthesize both pyruvate and nucleotides d) The cell wants to undergo the Pentose Phosphate Pathway e) None of the above

a) The cell wants to synthesize pyruvate

8. The N1 in the purine ring is contributed by which molecule? a. Aspartate b. Glycine c. Glutamate d. Glutamine e. Arginine

a. Aspartate

The N1 in the purine ring is contributed by which molecule? a. Aspartate b. Glycine c. Glutamate d. Glutamine e. Arginine

a. Aspartate

The most deleterious type of DNA damage occurs due to: a. Double strand breaks. b. Insertions and deletions of nucleotide bases. c. Oxidative damage due to x-ray and radioactive decay. d. Base deamination. e. Single strand breaks.

a. Double strand breaks.

When demand of ATP is low in fatty acid biosynthesis there is a buildup of Acetyl- CoA stored as what? a. Fat b. Protein c. Sugar d. Ketone Bodies e. None of the Above

a. Fat

Which one of the following enzymes is the rate-limiting step in the Pentose Phosphate Pathway? a. Glucose 6-Phosphate Dehydrogenase b. 6-Phosphogluconolactonase c. 6-Phosphogluconate Dehydrogenase d. Ribulose-5-Phosphate Isomerase e. Transketolase

a. Glucose 6-Phosphate Dehydrogenase

What topoisomerase only relaxes negative supercoiled DNA? I. Type 1A II. Type 1B III. Type 2 a. I b. II and III c. II d. I and III e. all of them

a. I

Which of the following describes the correct order of initiation factor binding during translation? a. IF-3, IF-2, IF-1 b. IF-2, IF-1, IF-3 c. IF-1, IF-2, IF-3 d. IF-1, IF-3, IF2 e. IF-3, IF-1, IF-2

a. IF-3, IF-2, IF-1

Which of the following is TRUE regarding the catabolism of amino acids? a. Leucine and Lysine are the only purely ketogenic amino acids. b. An amino acid can be either glucogenic or ketogenic, but not both. c. A glucogenic amino acid will degrade into ketone bodies d. The products of amino acid catabolism form intermediates for the Urea cycle. e. All ketogenic amino acids will degrade to pyruvate.

a. Leucine and Lysine are the only purely ketogenic amino acids.

Simultaneous transport of two or more moecules in the same direction can occur with. a. Symport translocation b. Uniport translocation c. Antiport translocation d. Ligand-gated ion channels e. None of the above

a. Symport translocation

The Prinbow box is to as the Shine Dalgarno sequence is to . a. Transcription, translation b. Translation, transcription c. mRNA processing, translation d. replication, translation e. initiation, elongation

a. Transcription, translation

Which of the following are true of the pentose phosphate pathway? i. This pathway is a shunt in glycolysis ii. It requires large amounts of ATP iii. The reducing agent is NAD+ as opposed to NADP+ iv. 6-phosphoglucono-beta-lactone is the result of the enzyme glucose-6-phosphate synthetase a. i only b. i, ii, and iv c. i, iii, and iv d. iv only e. iii and iv

a. i only

6. Which of the following statements of RNAi is FALSE? a. miRNA is triggered by dsRNA, while siRNA is triggered by ssRNA b. miRNA is preceded by pri-miRNA that is then cleaved by Drosha, while siRNA is preceded by dsRNA that is cleaved by Dicer c. siRNA is exogenous while miRNA is endogenous d. All of the above are false statements

a. miRNA is triggered by dsRNA, while siRNA is triggered by ssRNA

What point in the pentose phosphate pathway does the rate-limiting step occur? a. step 1: Glucose-6-Phosphate Dehydrogenase b. step 6: Transketolase c. Step 3: Phosphogluconate dehydrogenase d. Step 5: Ribulose-5-phosphate epimerase e. Step 7: Transaldolase

a. step 1: Glucose-6-Phosphate Dehydrogenase

With regards to Acetyl CoA carboxylase regulation a) Citrate inhibits the conversion of Acetyl-CoA to Malonyl-CoA b) Acetyl-CoA carboxylase is activated by insulin dependent dephosphorylation c) Acetyl-CoA carboxylase is activated by AMP- & cAMP-dependent phosphorylation d) Malonyl-CoA activates the transfer of Fatty acyl-CoA to the mitochondrion e) Palmitate activates the conversion of Acetyl-CoA to Malonyl-CoA

b) Acetyl-CoA carboxylase is activated by insulin dependent dephosphorylation

Which is true regarding β-Oxidation of fatty acid chains? a) For each complete cycle of a saturated chain, 1 FADH2, 1NADPH, and 1 Acetyl-CoA is yielded. b) Odd numbered fatty acid chains yield a 3 carbon long Propionyl-CoA molecule that is converted to Succinyl-CoA and sent into the TCA cycle. c) Odd numbered fatty acid chains yield a 3 carbon long Propionyl-CoA molecule that is converted to Acetyl-CoA and sent into the TCA cycle. d) For each complete cycle of an unsaturated chain, 1 FADH2, 1NADH, and 1 Acetyl-CoA is yielded. e) Palmitoyl-CoA is a necessary intermediate to undergo condensation with Serine in order for the reaction to move forward.

b) Odd numbered fatty acid chains yield a 3 carbon long Propionyl-CoA molecule that is converted to Succinyl-CoA and sent into the TCA cycle.

Which of the following is incorrect with regards to the overall scheme of the RNAi process. a) RDE-4 binds dsRNA & recruits RDE-1 b) RDE-2 & RDE-1 recruit DCR-1 c) DCR-1 degrades dsRNA to siRNA d) RISC binds target mRNA via base pairing e) RISC complex degrades mRNA

b) RDE-2 & RDE-1 recruit DCR-1

On what carbon does B DNA pucker? a. 1' b. 2' c. 3' d. 4' e. 5'

b. 2'

The most highly regulated step in Purine Biosynthesis is? a. Activation of ribose 5-phosphate b. Acquisition of N9 c. Acquisition of C4, C5, and N7 d. Acquisition of C8 e. Formation of imidazole ring

b. Acquisition of N9

The erythromycin class of antibiotics a. Blocks peptidyl transferase b. Blocks the exit tunnel c. Prevents a-site binding d. Increases the rate of protein synthesis e. Becomes incorporated into the growing polypeptide chain

b. Blocks the exit tunnel

4. Which of the following statements is FALSE regarding hormones? a. In muscle, insulin activates Phophoprotein Phosphatase-1, which leads to increased glycogen synthesis b. In muscle, glucagon deactivates Phophoprotein Phosphatase-1, which leads to increased glycogen breakdown c. In liver, glucagon from pancreas will stimulate production of 2nd messenger cAMP in the liver, which leads to glycogen breakdown d. In liver, insulin from pancreas gets in the liver, which leads to glycogen synthesis e. Hormones control metabolism in the liver, when glucose level is high, insulin is produced to stimulate glycogen synthesis

b. In muscle, glucagon deactivates Phophoprotein Phosphatase-1, which leads to increased glycogen breakdown

Which of the following statements is FALSE regarding hormones? a. In muscle, insulin activates Phophoprotein Phosphatase-1, which leads to increased glycogen synthesis b. In muscle, glucagon deactivates Phophoprotein Phosphatase-1, which leads to increased glycogen breakdown c. In liver, glucagon from pancreas will stimulate production of 2nd messenger cAMP in the liver, which leads to glycogen breakdown d. In liver, insulin from pancreas gets in the liver, which leads to glycogen synthesis e. Hormones control metabolism in the liver, when glucose level is high, insulin is produced to stimulate glycogen synthesis

b. In muscle, glucagon deactivates Phophoprotein Phosphatase-1, which leads to increased glycogen breakdown

What makes an amino acid KETOGENIC? a. It feeds into Pyruvate b. It feeds into Acetyl CoA c. It feeds into Succinyl CoA d. It feeds into Oxaloacetate e. B and C are both correct

b. It feeds into Acetyl CoA

Phosphorylase kinase (PK) is used in the regulation of glycogen synthesis and breakdown. If a. PK phosphorylates glycogen phosphorylase, which becomes inactive and breakdown occurs. b. PK phosphorylates glycogen phosphorylase, which becomes active and breakdown occurs. c. PK phosphorylates glycogen synthetase, which becomes inactive and synthesis occurs. d. PK phosphorylates glycogen synthetase, which becomes active and breakdown occurs. e. PK phosphorylates glycogen phosphorylase, which becomes active and synthesis occurs.

b. PK phosphorylates glycogen phosphorylase, which becomes active and breakdown occurs.

One of the signals for degradation is a RING finger domain, what does RING stand for and what does the domain entail? a. Really Intense New Gene; possesses 8 metal binding residues and coordinates a zinc ion (Zn2+) b. Really Interesting New Gene; possesses 8 metal binding residues and coordinates a zinc ion (Zn2+) c. Really Intense New Gene; includes solely single subunit proteins d. Really Interesting New Gene; includes solely multisubunit proteins e. Really Interesting New Gene; possesses 8 metal binding residues and coordinates a cobalt ion (Co+)

b. Really Interesting New Gene; possesses 8 metal binding residues and coordinates a zinc ion (Zn2+)

Which of the following describes the correct order of transcription factor binding during transcription? a. TFIIH, TFIIE, TFIIB, TFIIF and RNAPII, TFIID, TFIIA b. TFIID, TFIIA, TFIIB, TFIIF and RNAPII, TFIIE, TFIIH c. TFIIA, TFIIB, TFIID, TFIIE, TFIIF and RNAPII, TFIIH d. TFIIF and RNAPII, TFIIH, TFIID, TFIIA, TFIIB, TFIIE e. TFIIE, TFIIF and RNAPII, TFIIB, TFIIA, TFIIH, TFIID

b. TFIID, TFIIA, TFIIB, TFIIF and RNAPII, TFIIE, TFIIH

What role does topoisomerase play in DNA replication? a. Topoisomerase unwinds the double helix. b. Topoisomerase relaxes supercoils that occur during replication. c. Topoisomerase joins Okazaki fragments and seals nicks in the sugar-phosphate backbone. d. Topoisomerase removes RNA primmer and inserts the correct bases. e. Topoisomerase stabilizes the DNA strands while they are separated.

b. Topoisomerase relaxes supercoils that occur during replication.

If Trp level is high in E. coli, what will occur? a. Trp will bind to a repressor, which inhibits the repressor from binding to the Trp operator b. Trp will bind to a repressor to activate it so it can bind to the Trp operator and block DNA polymerase from binding c. Trp will bind to the Trp operator and block DNA polymerase from binding d. Trp will bind to a repressor, which causes it to bind to the operator and blocks transcription of the lac operon e. None of the above

b. Trp will bind to a repressor to activate it so it can bind to the Trp operator and block DNA polymerase from binding

What amino acid could be a product of methionine breakdown? a. alanine b. cysteine c. serine d. asparagine e. glutamine

b. cysteine

Which of the following is true in regards to ubiquitinylation and SUMOylation? i. Poly-ubiquitinylation marks the protein for degradation ii. SUMOylation occurs like ubiquitinylation iii. SUMOylation has three mechanisms of action: to inhibit interactions, facilitate interactions, or change conformation iv. SUMOylation usually targets glycine a. i only b. i, ii, and iii c. iii and iv d. ii and iii e. all of the above

b. i, ii, and iii

What translocation mechanism is used in glucose transport? a. antiport b. symport c. uniport d. indirect port e. b& c

b. symport

During the E1 Na+/K+ pump conformation: a) ADP is hydrolyzed to AMP & Pi to promote the transport of 3 Na+ ions out of the cell b) 2K+ ions are bound and transported into the cell c) A high-energy aspartyl phosphate intermediate facilitates 3 Na+ ions movement out of the cell d) The binding affinity for K+ is high e) The binding site is exposed to the exterior of the cell

c) A high-energy aspartyl phosphate intermediate facilitates 3 Na+ ions movement out of the cell

Which of the following is true of both purine and pyrimidine de novo synthesis? I. Uses aspartate as a source of carbons. II. Contains amides from glutamine. III. Engages in feedback inhibition and activation IV. Has an step in which ribose-5-phosphate is activated. a) I, II b) II, III c) II d) I, IV e) I

c) II

What is true about translation? a) Scans 3'5' for the AUG codon b) The peptide chain is released after the tRNA moves to the E-site c) If an incorrect tRNA is added, tRNA rejection occurs after GTP hydrolysis d) During transpeptidation, a high energy ester bond in the A-site drives the reaction forward e) EF-G is only used during the elongation phase of translation

c) If an incorrect tRNA is added, tRNA rejection occurs after GTP hydrolysis

In the classic Fraz Knoop experiment with Beta-oxidation fatty acids are broken down by? a. Acetyl-CoA b. TCA cycle c. 2-carbon mechanism d. all of the above e. none of the above

c. 2-carbon mechanism

DNA replication in vivo occurs: a. Continuously b. Discontinuously c. Bidirectionally d. Unidirectionally e. In the cytoplasm

c. Bidirectionally

Which of the following is NOT a signal for protein degradation? a. RING finger domains b. PEST elements c. C-End Rule d. Destruction Box e. N-End Rule

c. C-End Rule

1. Which of the following is a FALSE statement regarding glycogen breakdown? a. Glycogen breakdown cleaves 𝛼(1→6) linkages to form 𝛼 (1→4) linkages b. Glycogen breakdown involves the formation of a Schiff base c. Glycogen breakdown uses UTP in place of ATP d. Phosphoglucomutase converts G1P to G6P

c. Glycogen breakdown uses UTP in place of ATP

Transcription factors are proteins that bind I. Enhancers II. TATA- Box III. mRNA a. I only b. II only c. I, II d. II, III e. I, II, III

c. I, II

5. What is the correct order of fatty acid biosynthesis? a. Ketosynthase → ketoreductase → thiol esterase → dehydratase → enol-reductase b. Thiol esterase → ketosynthase → ketoreductase → dehydratase → enol-reductase c. Ketosynthase → ketoreductase → dehydratase → enol-reductase → thiol esterase d. Ketoreductase → dehydratase → enol-reductase → Thiol esterase → ketosynthase e. Dehydratase → enol-reductase → thiol esterase → Ketosynthase → ketoreductase

c. Ketosynthase → ketoreductase → dehydratase → enol-reductase → thiol esterase

What is the correct order of fatty acid biosynthesis? a. Ketosynthase → ketoreductase → thiol esterase →dehydratase → enol-reductase b. Thiol esterase → ketosynthase→ ketoreductase→ dehydratase→ enol-reductase c. Ketosynthase→ketoreductase → dehydratase→ enol-reductase → thiol esterase d. Ketoreductase → dehydratase →enol-reductase → Thiol esterase → ketosynthase e. Dehydratase → enol-reductase → thiol esterase → Ketosynthase → ketoreductase

c. Ketosynthase→ketoreductase → dehydratase→ enol-reductase → thiol esterase

Regulation of the urea cycle with allosteric activation of carbamoyl phosphate synthetase occurs by which of the following? a. Arginine b. Ornithine c. N-Acetylglutamate d. Nitric acid e. None of the above

c. N-Acetylglutamate

8. Which of the following statements most accurately describes wobble theory? a. Any deviation in any position results in "wobbly", weaker base pairing that can be broken more easily b. The first two amino acid positions typically exhibit wobble, while the third position must bind in Watson/Crick base pairing c. The third position typically exhibits wobble, while the first two positions adhere to W/C base pairing d. Any deviation in the third position prevents the tRNA from reading the codons, resulting in "wobble" in translation as the ribosome is forced to slow protein synthesis

c. The third position typically exhibits wobble, while the first two positions adhere to W/C base pairing

Which of the following describes the correct order of events for splicing of introns? a. mRNA produced in nucleus, Addition of poly-A-tail on 3'end, Capping of the 5'end, Exported out of nucleus, Splicing of intron b. mRNA produced in nucleus, Capping of the 5'end, Splicing of intron, Addition of poly-A-tail on 3'end, Exported out of nucles c. mRNA produced in nucleus, Capping of the 5'end, Addition of poly-A-tail to 3'end, Splicing of intron, Exported out of nucleus d. mRNA produced in nucleus, Splicing of intron, Capping of the 5'end, Addition of the poly-A-tail on 3' end, Exported out of nucleus e. mRNA produced in nucleus, Exported out of nucleus, Capping of the 5'end, Addition of the poly-A-tail on 3'end, Splicing of intron

c. mRNA produced in nucleus, Capping of the 5'end, Addition of poly-A-tail to 3'end, Splicing of intron, Exported out of nucleus

If DNA ligase was inhibited, what would not occur? a. primers could not be placed b. nucleotides could not be added c. okazaki fragments could not be joined d. supercoils could not be relaxed e. proofreading could not occur

c. okazaki fragments could not be joined

The glucogenic degradation of aspartate to oxaloacetate is what kind of reaction? a. decarboxylation b. oxidation c. transamination d. condensation e. dehydrogenase

c. transamination

A lack of transaldolase in the Pentose Phosphate Pathway would result in what? a) Decrease in Erythrose-4-Phosphate b) Increase of Fructose-6-Phosphate c) Increase in Glyceraldehyde-3-Phosphate d) A and B e) All of the above

d) A and B

What is true regarding double stranded DNA? a) Mg2+ is important in stabilization b) Engage in wobble base interactions. c) Is cut by type 1 topoisomerases d) All of the above e) None of the above

d) All of the above

What is false about CRISPR? a) Utilizes Cas9 as molecular scissors b) Uses crRNA in vivo c) Does not cause double stranded breaks d) Can perturb gene expression by blocking translation e) Has many families of CRISPR genes

d) Can perturb gene expression by blocking translation

What amino acid falls into the criteria below? I. Converted to α-Ketoglutarate. II. Essential III. Has a neutral isoelectric point a) Arginine b) Aspartic Acid c) Asparagine d) Histidine e) Proline

d) Histidine

Glycogen contains the following linkages I. α 1-4 II. β 1-4 III. α 1-6 IV. β 1-6 a) I b) II c) II & IV d) I & III e) I, II, III & IV

d) I & III

Which of the following does not occur in Eukaryotic transcription? a) Formation of RNA Polymerase Holoenzyme b) Binding of TFIIE to RNA Polymerase II c) Action of RNA Polymerase III in the nucleoplasm d) Rho Dependent termination e) Antisense strand conversion to mRNA

d) Rho Dependent termination

1. Which of these ingredients is not required to perform PCR? a. A primer b. A dNTP c. A DNA polymerase d. A DNA ligase e. A template

d. A DNA ligase

Which of these ingredients is not required to perform PCR? a. A primer b. A dNTP c. A DNA polymerase d. A DNA ligase e. A template

d. A DNA ligase

Of the following involving DNA damage, which are true? a. Replication errors are repaired via mismatch repair b. Spontaneous reactions causing DNA damage (alkylating agents, oxygen radicals, etc.) are repaired via Base-excision repair c. UV light damage to DNA is repaired via recombinational repair (HR, EJ) d. A and B e. None of the above are true

d. A and B

Signals for degradation include a. N-end rule b. PEST elements c. Destruction Box d. All of the Above e. None of the Above

d. All of the Above

1. Cloning vectors must have a. Origin of replication b. Selectable marker c. Multiple cloning sites d. All of the above e. None of the above

d. All of the above

Which of the following is an intermediate in the conversion of ribose-5-phosphate to GTP following protein synthesis? a. XMP b. GTP c. IMP d. All of the above are true e. None of the above are true

d. All of the above are true

The Na+-K+ ATPase pump is a(n) ______ while the Glucose-Na+ pump is a(n)______. a. Symport, antiport b. Antiport, antiport c. Symport, symport d. Antiport, symport e. peripheral protein, integral protein

d. Antiport, symport

What doe CRISPR stand for? a. Capped RNA Introns Spaced Periodic Repeats b. Coordinated Repeated Introns and Silenced Palindromic RNA c. Coding Regularly Interspaced Structures Promoting Repair d. Clustered Regularly Interspaced Short Palindromic Repeats e. Coupled Ribozymes Interspaced by Silenced Palindromic RNA

d. Clustered Regularly Interspaced Short Palindromic Repeats

Which of the following contain the direct precursors as well as the products to create Geranyl Pyrophosphate in cholesterol synthesis? I. Dimethylallyl Pyrophosphate II. Farnesyl Pyrophosphate III. Loss of Pyrophosphate IV. Isopentenyl Pyrophosphate V. Oxidation of NADPH a. I, II, V b. I, II, III c. II, V d. I, III, IV e. II, III, V

d. I, III, IV

2. 𝛃-oxidation of saturated fatty acids differs from that of unsaturated fatty acids in that... a. Unsaturated fatty acid oxidation produces FADH2 while saturated fatty acid oxidation produces only NADH b. Unsaturated fatty acid oxidation utilizes enoyl-CoA isomerase to convert a cis-bond to a trans-bond, while this isomerase is never used in saturated fatty acid synthesis c. SyccinylCoA is used by only saturated fatty acid oxidation and is not seen in unsaturated fatty acid oxidation d. Saturated fatty acids are more easily oxidized than unsaturated fatty acids as unsaturated fatty acids must be isomerized to prevent reverse reactions

d. Saturated fatty acids are more easily oxidized than unsaturated fatty acids as unsaturated fatty acids must be isomerized to prevent reverse reactions

What property of RNA allows it to have catalytic properties over DNA? a. RNA has an extra -OH functional group b. RNA can form hairpin structures c. Uracil is a better suited base to catalyze reactions d. The bases of RNA are not stacked in the interior of the molecule e. RNA is less prone to degradation

d. The bases of RNA are not stacked in the interior of the molecule

Tetracycline is an antibiotic that targets the small subunit of the bacterial ribosome. How is tetracycline resisted in bacterial cells? a. The small ribosome is mutated b. The large ribosome is methylated c. The bacteria uses a new method of translation (ex. NRPs) d. The cell membrane is mutated to prevent entrance of tetracycline e. It doesn't

d. The cell membrane is mutated to prevent entrance of tetracycline

Which of the following statements involving purine and pyrimidine biosynthesis is false? a. The end product of the purine biosynthesis pathway is IMP b. The end product of the pyrimidine biosynthesis pathway is UMP c. OMP decarboxylase in the pyrimidine biosynthetic pathway is the most catalytically proficient enzyme known to scientists d. The end product of the purine biosynthesis pathway is UMP e. The product from the pentose phosphate pathway is used in these pathways

d. The end product of the purine biosynthesis pathway is UMP

5. Ubiquitination serves an important role in protein degradation. Which of the following statements of ubiquitination is true? a. Ubiquitin binds to a serine residue on the protein designated to be degraded b. Ubiquitin is large, making it favorable for destruction in the cell c. Only polyubiquitin is possible in mammalian cells d. Ubiquination is activated by adenylate

d. Ubiquination is activated by adenylate

In the beta oxidation of unsaturated fatty acids, 2,4-dienoyl-CoA reductase a. Uses NADH to reduce 2,4-dienoyl-CoA b. Uses FADH2 to reduce 2,4-dienoyl-CoA c. Uses ATP to move the 2,3 double bond to the 3,4 position d. Uses NADPH to reduce 2,4-dienoyl-CoA e. Does not use ATP, but moves the 2,3 double bond to the 3,4 position

d. Uses NADPH to reduce 2,4-dienoyl-CoA

Which of the following is not a method for gene regulation in eukaryotes? a. Chromatin b. Histone modifications c. mRNA degradation d. operators e. metabolite riboswitches

d. operators

The activation of the E3 ubiquitin ligase can be caused by: I. Phosphorylation by protein kinase II. Allosteric transition caused by ligand binding III. Allosteric transition caused by protein subunit addition a) I only b) I & II c) I & III d) II & III e) I, II & III

e) I, II & III

With regards to the action of riboswitches: a) The expression platform selectively binding metabolites and the aptamer changes its folding pattern to control gene expression. b) The aptamer selectively binding metabolites and the expression platform changes its folding pattern to control gene expression. c) Are a stealth form of transcription control d) a & c only e) b & c only

e) b & c only

3. Which of the following are spontaneous forms of DNA damage? a. Base tautomerization b. UV radiation c. Base deamination d. None of the above e. A and C

e. A and C

In the pentose phosphate pathway, to make 6-phosphoglucono-δ-lactone using glucose-6-phosphate dehydrogenase from G6P, what occurs? a. A direct hydride transfer to make NADPH b. The reaction is specific for NADPH c. NADP+ inhibits the reaction d. An aldehyde is oxidized to a lactone e. A and D are correct

e. A and D are correct

7. Which of the following are potential antibiotic targets in bacterial cells? a. The cell wall b. The A site of the ribosome c. The P site of the ribosome d. The exit tunnel fo the ribosome e. All of the above

e. All of the above

Which of the following is NOT one of the six common post translational modifications of proteins? a. Phosphorylation b. Alkylation c. Oxidation d. Glycosylation e. Deamination

e. Deamination

The Purine Nucleotide Cycle produces a. Aspartate b. Oxaloacetate c. Pyruvate d. Succinate e. Fumarate

e. Fumarate

5. Which of the following types of DNA damage repair are used to fix double strand breaks? a. Holiday junction processing and mismatch repair b. Nucleotide excision repair and Base excision repair c. Base excision repair and Error-prone (SOS) repair. d. Nonhomolgous end joining and mismatch repair e. Homologous recombination and nonhomologous end joining.

e. Homologous recombination and nonhomologous end joining.

The R2 dimer on ribonucleotide reductase contains I. metal coordination II. hexamerization III. specificity sites a. I &II b. I & III c. I, II & III d. III e. I

e. I

9. Which of the following statements about translation is/are true? i. ATP hydrolysis drives the addition of charged tRNA molecules to the A-site. ii. Both the A and P site interacts with mRNA. iii. The growing polypeptide chain is released from the E site of the ribosome. a. I, II, III b. I, III c. II, III d. I only e. II only

e. II only

Which of the following are biological polymers? I. Lipids II. RNA III. Proteins IV. Polysaccharides a. I, II b. I, II, II c. I, IV d. I, II, III, IV e. II, III, IV

e. II, III, IV

Which one of the following about Glucose Transporter is FALSE? a. It has glucose binding sites on both sides of the membrane b. Glucose enters outside from C1 face and inside with C6 face c. Its transport occurs in either direction based on concentrations d. It does not require any ATP e. It is always driven by the concentration of Na+

e. It is always driven by the concentration of Na+

______ use fats with high concentration of acetyl-coA when the body is derived of sugar. a. Insulin b. Glucagon c. Glycogen d. Glucose e. Ketone Bodies

CHE 4342 Final Multiple Choice

संबंधित स्टडी सेट्स

TEST: VOLUME, MASS, AND DENSITY

MGT Chapter 10 SmartBook

HIST2111 chapter 1

Personal Finance Ch. 10

SOC 119 FINAL

Week 6-7 Cranial Nerves - Lecture

Elbow

Astronomy Chapter 2

ILROB 1220 Part 1 Textbook

Chapter 4 Business 1301

Module 1

Course 1 Week 2 - All About Analytical Thinking

stats exam chapter 3

GMS 6551 Final Exam

Chapter 7 IT Project Manager:

Sociology Exam 1 chapter 1,2 & 3

Lecture 3 (Financial Performance Measures - Chapter 10) Textbook Notes

Chapter 15 Quiz

Peds Ch 29

Accounting