Genetics Final

A deletion occurs in the trp operon DNA of E. coli and results in the loss of the attenuation region in the 5 UTR of the RNA. The DNA sequences of the structural genes and the operator/promoter region are not affected by deletion. What effect will this deletion be expected to have on the regulation of this mutant trp operon compared to a wild-type operon? A) In the presence of tryptophan, transcription of the structural genes will be enhanced compared with a wild-type operon. B) In the absence of tryptophan, transcription of the structural genes will be reduced compared with a wild-type operon. C) In the presence of tryptophan, the repressor will bind to the operator/promoter region in the mutant operon more strongly than in a wild-type operon. D) In the absence of tryptophan, RNA polymerase will not bind to the operator/promoter region in the mutant operon. E) In the presence of tryptophan, transcription will be initiated at the second structural gene in the mutant operon.

A

A lac operon of genotype lacI+ lacP+ lacO+ lacZ+ lacY- will produce -galactosidase but not permease when: A) lactose is present. B) lactose is absent. C) in the presence or absence of lactose. D) glucose is present. E) glucose and lactose are both present.

A

A lac operon of genotype lacI+ lacP+ lacO+ lacZ- lacY+ will not produce -galactosidase but will produce permease when: A) lactose is present. B) lactose is absent. C) in the presence or absence of lactose. D) glucose is present. E) glucose and lactose are present.

A

A promoter that affects only genes that are on the same piece of DNA is referred to as a(n) _____-acting promoter. A) cis B) trans C) enhancer D) positive E) negative

A

An in vitro transcription system that contains a bacterial gene initiates transcription from random points on the DNA. Which of the following proteins MOST likely is missing from the reaction? A) sigma factor B) rho factor C) RNA polymerase II D) TATA-binding protein (TBP) E) TFIID

A

An operon is controlled by a repressor. When the repressor binds to a small molecule, it is released from binding to DNA near the operon. The operon is never expressed if a mutation prevents the repressor from binding to the small molecule. The type of control illustrated is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) attenuation.

A

During initiation, the _____ subunit is the first part of the ribosome to associate with the mRNA. A) small B) large C) intermediary D) secondary E) tertiary

A

E. coli lac operon control by lacI is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) attenuation.

A

In eukaryotic cells, where does the basal transcription apparatus bind? A) core promoter B) regulatory promoter C) terminator D) enhancer E) ribozyme

A

In which of the following organisms would transcription be the LEAST similar to archaea? A) E. coli B) yeast C) plants D) mice E) humans

A

Mechanisms that exist to detect and deal with errors in mRNA in order to ensure the accurate transfer of genetic information are collectively referred to as: A) mRNA surveillance. B) proofreading function. C) RNA interference. D) alternative processing. E) RNA transition.

A

Proteins with DNA-binding motifs predominantly bind to the _____ of DNA. A) major groove B) minor groove C) paired nitrogenous bases D) phosphate groups E) deoxyribose sugar

A

Refer to the following sequence: 5 ...GGAGCUCGUUGUAUU... 3 Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile... B) pro-arg-ala-thr-stop C) met-asn-glu-leu... D) glu-leu-val-val-phe... E) leu-glu-gln-his-asn...

A

The 5 and 3 untranslated regions (UTRs) of processed mRNA molecules are derived from: A) exons. B) introns. C) promoters. D) terminators. E) the protein-coding region.

A

The 5 cap on an mRNA is important for all the processes listed below except for the _____ of an mRNA molecule. A) transcription B) intron removal C) stability D) initiation of translation E) ribosomal interaction

A

The amino acid sequence of a polypeptide is referred to as the _____ sequence of the polypeptide. A) primary B) secondary C) tertiary D) quaternary

A

The genetic code is said to be "degenerate" because: A) there are more codons than amino acids. B) there are more amino acids than codons. C) different organisms use different codons to encode the same amino acid. D) some codons specify more than one amino acid. E) there are more tRNAs than amino acids.

A

The nucleotide sequence 5 ...GGAGCUCGUUGUAUU... 3 is changed to 5 GGAGACUCGUUGUAUU 3. Why does or why doesn't the amino acid sequence change? A) The reading frame changes after the mutation (the addition of an A in the fifth position) and so the amino acid sequence is modified after that point. B) The reading frame, starting at the 5 end of this sequence, would be modified because of this change and so the entire amino acid would be different. C) The amino acid is not changed since the coding sequence was not changed at the 5 position. D) A premature stop codon caused by this change would result in a truncated polypeptide. E) Just one amino acid would be changed in the resulting polypeptide.

A

What is the function of allolactose in regulation of the lac operon? A) inducer B) repressor C) activator D) promoter E) regulatory protein

A

What is the function of eukaryotic RNA polymerase I? A) transcription of rRNA genes B) transcription of mRNA genes C) transcription of tRNA genes D) transcription of snRNAs E) initiation of transcription (but not elongation)

A

When a structural gene is under negative inducible control, what would be the result of a mutation that eliminates the repressor protein? A) The structural gene will be constitutively expressed due to the lack of negative inducible control. B) The transcription of the structural gene will not be affected, as a repressor is not required. C) The mutation will lead to activation of an activator upon the lack of a repressor protein, which will allow the transcription to continue. D) Since transcription will require a repressor protein, the transcription will be turned off. E) More cAMP will be produced in a cell to compensate for the lack of a repressor protein.

A

Where are promoters usually located? A) upstream of the start site B) downstream of the start site C) near nucleotide +25 D) near the hairpin loop E) downstream of the terminator

A

Which of the following is generally constitutively transcribed? A) regulatory gene B) structural gene C) operator element D) promoter element E) operon

A

Which of the following mRNA codons will bind to the tRNA anticodon 5 GCU 3, considering wobble-base pairing rules. A) 5 AGU 3 and 5 AGC 3 B) 5' UGA 3 and 5 CGA 3 C) 5 AGC 3 D) 5 CGA 3 E) 5 AGU 3, 5 AGC 3, 5 AGA 3, and 5 AGG 3

A

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

A

Which of the following statements about proteins is INCORRECT? A) All proteins are made up of some combination of 20 essential amino acids. B) Like nucleic acids, polypeptides have polarity. C) A single polypeptide has primary, secondary, and tertiary structures. D) -helix and -pleated sheets do not require a specific sequence of amino acids to form. E) Some proteins contain more than one polypeptide chain.

A

Which of the following statements does NOT describe the events in prokaryotic translation elongation? A) The nucleotides in the Shine-Dalgarno sequence of the mRNA pair with their complementary nucleotides in the 16S rRNA. B) A ribosome with a growing peptide attached to a tRNA in the P site accepts a charged tRNA with the next amino acid into the A site. The charged tRNA enters as a complex with EF-Tu and GTP. C) If the anticodon of the charged tRNA matches the codon, GTP is cleaved and EF-Tu exits and is regenerated to EF-Tu-GTP by EF-Ts. D) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site. E) The ribosome translocates toward the 3 end of the mRNA with the aid of EF-G and GTP hydrolysis. The empty tRNA that was in the P site moves to the E site and exits. The tRNA with the polypeptide that was in the A site moves to the P site.

A

Which of the following statements is NOT true? A) Both DNA and RNA are synthesized in a 5 to 3 direction. B) During RNA synthesis, the DNA template strand is read in a 3 to 5 direction. C) During RNA synthesis, new nucleotides are added to the 3 end of the growing RNA molecule. D) RNA polymerase has 5 to 3 polymerase activity. E) RNA molecules have the same 5 to 3 orientation as the DNA template strands to which they are complementary.

A

Which of the following types of eukaryotic gene regulation takes place at the level of DNA? A) alternation of chromatin structure B) mRNA processing C) RNA interference D) mRNA stability E) posttranslational modification

A

5 ...GGAGCUCGUUGUAUU... 3 This sequence is RNA because: A) it is single stranded. B) it contains U (uracil) and no T (thymine). C) it runs in a 5 to 3 direction. D) it codes for amino acids . E) it is a small molecule.

B

A drug that destroyed small nucleolar RNA (snoRNA) would inhibit which process? A) RNA splicing of pre-mRNA B) translation C) assembly of the nucleosome D) replication E) transcription

B

A microbiologist isolated a mutant strain of E. coli that is extremely susceptible to bacteriophage infection, by a wide range of bacteriophages. Which of the following genes might she explore as a possible site of the mutation that results in this phenotype? A) A gene that encodes a small nucleolar RNA B) A gene that encodes a Cas protein C) A gene that encodes a Piwi-interacting RNA D) A gene that encodes either a miRNA or a siRNA E) A gene that encodes an immune RNA

B

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces particularly high amounts of ß-galactosidase. What is a possible genotype of the cells? A) lacI+ lacP+ lacO+ lacZ- lacY+ lacA+ B) lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ C) lacI- lacP+ lacO+ lacZ- lacY+ lacA+ D) lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ E) lacI- lacP- lacO+ lacZ- lacY+ lacA-

B

A partial diploid E. coli cell of lacI+ lacP- lacOc lacI+ lacY+ / lacIs lacP+lacO+ lacZ+ lacY- will synthesize: A) both lacZ and lacY functional gene products in the absence of lactose. B) neither lacZ nor lacY functional gene products in the presence of lactose. C) both lacZ and lacY functional gene products in the presence of lactose. D) lacY but not a functional lacZ gene product in the absence of lactose. E) lacZ but not a functional lacY gene product in the absence of lactose.

B

A tRNA anticodon is 5 GCU 3. What amino acid does it carry? A) ala B) arg C) ser D) pro E) thr

B

An in vitro transcription system transcribes a bacterial gene but terminates inefficiently. What is one possible problem? A) There is a mutation in the -10 consensus sequence, which is required for efficient termination. B) Rho factor has not been added. C) Sigma factor has not been added. D) A hairpin secondary structure has formed at the 3 end of the mRNA, interfering with termination. E) Histones were added prematurely and interfered with termination.

B

An mRNA has the codon 5 UAC 3. What tRNA anticodon will bind to it? A) 5 AUG 3 B) 5 GUA 3 C) 5ATC3 D) 5 CTA 3 E) 5 CAU 3

B

An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule. The type of control illustrated is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) catabolite repression.

B

Anticodons are found in _____ molecules. A) mRNA B) tRNA C) rRNA D) snRNA E) miRNA

B

Both strands of a DNA molecule are used as a template when which of the following molecules is synthesized? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

B

Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene comprises approximately 190,000 nucleotides and produces an mRNA of 6128 nucleotides in length. What is a possible explanation for the difference in the sizes of the gene and the mRNA? A) The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA production. B) The CFTR gene likely has many introns that are excised prior to translation of the CFTR protein. C) The 5ʹ cap and the poly(A) tail get removed prior to translation of the CFTR protein. D) Methylation of the 5ʹ cap silences portions of the gene, preventing those regions from being transcribed into mRNA. E) The mutation that causes cystic fibrosis creates a new terminator sequence, resulting in a shorter mRNA.

B

During elongation, an incoming charged tRNA enters at the _____ site of the ribosome. A) peptidyl (P) B) aminoacyl (A) C) exit (E) D) Shine-Dalgarno E) Kozak

B

During initiation of translation: A) the initiator tRNAmet binds to the A site of a ribosome. B) specific rRNA base pairs with a sequence in mRNA to position a ribosome at the start codon. C) IF-3 must be recruited to the 30S ribosome in order for the 70S initiation complex to assemble. D) there is no energy expenditure as the tRNA binding to mRNA is via complementary base pairing. E) both 70S and 30S ribosome subunits must simultaneously recognize an mRNA to bind.

B

How many introns are present on a gene that consists of four exons? A) two B) three C) four D) five E) The number cannot be determined from the information provided.

B

In eukaryotes, tRNAs are transcribed in: A) the nucleus and function in the nucleus B) the nucleus but function in the cytoplasm C) the cytoplasm and function in the cytoplasm D) both the nucleus and the cytoplasm and function in the cytoplasm E) the cytoplasm and function in the nucleus

B

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins? A) RNA polymerase I B) RNA polymerase II C) RNA polymerase III D) RNA polymerase IV E) RNA polymerase V

B

In the absence of tryptophan, what happens to the genes within the trp operon? A) The regulator without tryptophan-binding prevents the genes from being transcribed. B) The regulator dissociates from the operator and structural genes get transcribed. C) Lack of tryptophan increases the level of cAMP, which leads to activation of CAP protein and gene expression. D) The active repressor binds to the operator and genes do not get transcribed. E) The active activator binds to the operator and transcription of structural gene takes place.

B

In the presence of both lactose and glucose, which of the following occurs with the E. coli lac operon? A) The lacI gene does not produce repressor. B) The cAMP-CAP complex is not available to bind near or at the lac promoter. C) The lacZ and lacY genes are fully expressed. D) Lactose is converted to glucose and galactose. E) Lactose binds to the operator.

B

Suppose that you perform an experiment where you construct a plasmid that carries a copy of the lac operator region (lacO) but no other part of the lac operon. (The lac repressor can bind to single operator regions.) This plasmid is placed in an E. coli cell, which has a normal copy of the lac operon in its chromosome. When this strain is grown, the number of plasmids reaches about 50 copies per bacterial cell. What is the expected phenotype of such a strain in the absence of glucose? A) The lac operon will be turned on even in the absence of lactose. B) The lac operon will be turned off even in the presence of lactose. C) The lac operon will be regulated normally. D) The lac operon will be initially turned on in the presence of lactose but eventually it will be turned off even though lactose is still present. E) The lac operon will be expressed only if galactose is added to the Moderate.

B

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation? A) The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly. B) The 5ʹ cap could recruit proteins that would help to assemble the ribosomes. C) The 5ʹ cap could assist in the identification of stop codons within the mRNA. D) The 5ʹ cap could serve as a marker for the ribosome to locate promoters. E) The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to the DNA.

B

The _____ is a type of regulator protein that binds to a region of DNA in the promoter of a gene called the operator and prevents transcription from taking place. A) inducer B) repressor C) activator D) inactivator E) terminator

B

The calcitonin gene can encode either the hormone calcitonin or a protein called calcitonin-gene-related peptide depending on which 3 cleavage site is used. In the thyroid gland, cleavage and polyadenylation occur after the fourth exon leading to calcitonin production. However, in the brain, the exact same transcript is cleaved after the sixth exon yielding calcitonin-gene-related peptide. This is an example of: A) multiple capping. B) alternative RNA processing. C) polyadenylation. D) environmental influence. E) mutation.

B

The formation of 1+2 and 3+4 secondary structures of 5 UTR region mRNA from the trp operon is triggered when: A) the tryptophan level inside the bacterial cell is extremely low. B) the tryptophan level inside the bacterial cell is high. C) the repressor protein fails to bind to the operator. D) there is a spontaneous mutation introduced into the 5 UTR. E) the structural gene transcription within the trp operon gets initiated.

B

The genetic code is NOT universal for: A) prokaryotes, which use a different genetic code than eukaryotes. B) a few mitochondrial genes, which substitute one sense codon for another. C) viruses, which use an entirely different genetic code. D) archaebacteria, which have their own genetic code. E) animal species whose cells are more advanced and complex.

B

The trp operon in E. coli contains a 5 UTR sequence that is translated into a small polypeptide of 14 amino acids, which includes two tryptophans. If the two trp codons in the 5 UTR of the RNA are changed to serine codons and the resulting cells are starved for tryptophan but not for any other amino acid, what will be the effect of the mutant codons on the operation of the trp operon? A) The trp repressor will be synthesized in greater amounts. B) Expression of the trp structural genes will be less than with a normal trp operon. C) Expression of the trp structural genes will be greater than with a normal trp operon. D) The leader polypeptide will not be synthesized. E) The expression of the operon will not be affected by these mutations.

B

What is the function of cAMP in regulation of the lac operon? A) It activates a repressor protein. B) It activates an activator protein. C) It inactivates a repressor protein. D) It inactivates an activator protein. E) It causes attenuation.

B

What may be the consequence of a mutation in the gene that encodes eukaryotic Rat1 exonuclease for eukaryotic transcription mediated by RNA polymerase II? A) The transcription may end prematurely, resulting in shorter mRNA transcript. B) The transcription may not be properly terminated, and RNA polymerase II may not be released. C) The transcription may be delayed indefinitely, which may kill the cell. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may not terminate and result in much longer RNA.

B

What may be the consequence of a mutation in the gene that encodes eukaryotic Rat1 exonuclease for eukaryotic transcription mediated by RNA polymerase II? A) The transcription may end prematurely, resulting in shorter mRNA transcript. B) The transcription may not be properly terminated, and RNA polymerase II may not be released. C) The transcription may be delayed indefinitely, which may kill the cell. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may not terminate and result in much longer RNA.

B

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene? A) The result would be no change in the protein, since deletions are very rare. B) A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal. C) Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made. D) Since exons are not coding regions, no changes in the protein would occur. E) No change in the reading frame would occur due to the degeneracy of the genetic code.

B

When binding of the inducer to the repressor causes a conformational change, which then prevents the repressor from binding to DNA, the repressor is called a(n) _____ protein. A) coactivator B) allosteric C) structural D) operating E) responsive

B

Which of the following RNA molecules is required for the process of translation? A) crRNA B) tRNA C) snRNA D) snoRNA E) siRNA

B

Which of the following features of the rho protein is primarily responsible for its ability to cause termination of transcription? A) recognizing unstructured RNA B) helicase activity C) migrating behind RNA polymerase D) RNA-binding activity E) polymerase activity

B

Which of the following is NOT a common DNA-binding motif? A) the helix-loop-helix motif B) the beta sheet-alpha helix motif C) the zinc-finger motif D) the homeodomain motif E) the leucine-zipper motif

B

Which of the following is NOT required for transcription? A) ribonucleotides B) RNA primers C) DNA template D) RNA polymerase E) promoter

B

Which of the following nitrogenous bases is frequently modified enzymatically to become a rare type of nitrogenous base in tRNA? A) adenine B) uracil C) thymine D) cytosine E) guanine

B

Which of the following small RNA types is unique to prokaryotes? A) siRNA B) crRNA C) miRNA D) piRNA E) lncRNA

B

Which of the following statements about gene regulation concerning operons is INCORRECT? A) A negative repressible gene is controlled by a regulatory protein that inhibits transcription. B) For a gene under negative repressible control, a small molecule is required to prevent the gene's repressor from binding to DNA. C) For a gene under positive repressible control, the normal state is transcription of a gene, stimulated by a transcriptional activator. D) A regulator gene has its own promoter and is transcribed into an independent mRNA. E) Presence of operons where genes of related functions are clustered is common in bacteria but not in eukaryotes.

B

Which of the following statements about the formation of the peptide bond between amino acids is INCORRECT? A) The formation of peptide bonds results in the formation of a water molecule. B) The amino group of the first amino acid and the carboxyl group of the second amino acid are involved in forming a peptide bond. C) The carboxyl group of the first amino acid reacts with the amino group of the second amino group to form a peptide bond. D) A polypeptide formed by a series of peptide bonds will result in two distinct free ends, one with a free amino group and the other with a free carboxyl group. E) The number of peptide bonds formed in a polypeptide varies from protein to protein.

B

Translation in prokaryotes and eukaryotes has some similarities but differs in important ways. Which of the following statements about similarities and differences in prokaryotic and eukaryotic translation are TRUE? (Select all that apply.) A) Initiation in prokaryotes and eukaryotes begins with a formylmethionine. B) Prokaryotic and eukaryotic ribosomes are different sizes. C) Prokaryotic ribosomes are sensitive to antibiotics that do not affect eukaryotic ribosomes. D) Prokaryotic and eukaryotic large subunits contain two rRNAs. E) Prokaryotic mRNAs are short-lived. Eukaryotic mRNAs vary in their half-life. F) Recognition of the start codon in prokaryotes and eukaryotes involves the 5 cap, the 3 poly(A) tail, and the Kozak sequence near the start codon. G) Prokaryotic initiation, elongation, and termination factors are different from those in eukaryotes. H) Transcription and translation routinely occur simultaneously in prokaryotes and eukaryotes. I) Elongation involves the formation of a peptide bond between the amino acids that are attached to the tRNAs in the P and A sites of the ribosome in both prokaryotes and eukaryotes.

B,C,E,G,I

A lac operon of genotype lacI- lacP+ lacO+ lacZ+ lacY+ will produce -galactosidase and permease when: A) lactose is present. B) lactose is absent. C) lactose is present or not. D) glucose is present. E) glucose and lactose are both present.

C

An example of a gene product encoded by a regulatory gene is: A) beta-galactosidase enzyme. B) allolactose. C) repressor protein. D) an operator. E) a terminator.

C

Assume that a mutation occurs in the promoter for the lacI regulatory gene and this mutation results in a tenfold increase in the transcription of lacI. What would be the expected consequences of such a mutation? A) The lac structural genes will be fully expressed even in the presence of glucose and absence of lactose. B) The lac operon would be expected to be regulated normally. C) The lac structural genes will not be fully induced even in the absence of glucose and presence of lactose. D) The lac structural genes will be partially expressed in the presence of glucose and fully expressed if lactose is also present. E) The lac structural genes will now be fully expressed in the absence of glucose and lactose but not expressed in the absence of glucose and presence of lactose.

C

E. coli lac operon control by CAP is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) regulated by riboswitches

C

For any sequence of nucleotides, how many reading frames are possible? A) 1 B) 2 C) 3 D) 5 E) 10

C

If a mutation prevents the formation of the antiterminator 2+3 loop in the trp operon, what would be the effect? A) transcription only when tryptophan is absent B) transcription only when tryptophan is present C) constitutive attenuation of transcription D) constitutive transcription E) no effect, as 2+3 loop has no function

C

In prokaryotes, a group of genes that are usually transcribed following a specific stimulus is organized as an "operon" under a single shared promoter. The result of the transcription of the genes in the presence of a stimulus would generate a: A) crRNA. B) miRNA. C) polycistronic mRNA. D) rRNA. E) siRNA.

C

In prokaryotes, rho-independent transcription termination depends on a secondary structure formed in: A) the RNA polymerase that is transcribing the gene. B) the DNA template. C) the RNA that is being transcribed. D) a protein factor that binds to RNA polymerase. E) a protein factor that binds to the RNA that is being transcribed.

C

It is possible for a repressor to negatively regulate the expression of an operon because: A) the repressor induces the expression of the inducer by binding to the promoter that comes before the inducer gene. B) one of the structural genes expressed in the operon negatively regulates the repressor. C) the repressor-binding site overlaps the promoter site of the operon, allowing it to physically block the binding of RNA polymerase. D) the repressor-binding site on the DNA overlaps with the translation start site, thereby preventing the transcription. E) the repressor physically blocks where the activator should be binding on the operator region.

C

Mutations in which of the following regions upstream of the RNA coding sequence are LEAST likely to affect the transcription of a gene? A) -10 consensus sequence within the promoter region B) -35 consensus sequence within the promoter region C) the region between -10 and -35 consensus sequences D) the upstream elements at -40 to -60 position E) Any mutation on the upstream of a gene will definitely have deleterious effect on gene transcription.

C

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start. A) +1 B) -1 C) -10 D) -25 E) -35

C

RNA molecules that are complementary to particular sequences on mRNA are called: A) complementary RNA. B) sense RNA. C) antisense RNA. D) riboswitches. E) ribozymes.

C

Suppose an organism ingests a drug that disassembles its spliceosomes, rendering them nonfunctional. Which of the following would be seen MOST immediately in this organism? A) All translation would stop. B) tRNA bases would no longer be modified into rare bases. C) Introns would not be removed from the pre-mRNA. D) mRNA would not be able to bind the 5ʹ cap. E) rRNA would no longer be appropriately processed.

C

The DNA replication enzyme that most closely resembles RNA polymerase is: A) DNA polymerase I. B) DNA polymerase III. C) primase. D) telomerase. E) helicase.

C

The function of aminoacyl-tRNA synthetases is to: A) transcribe tRNA genes. B) match tRNA anticodons and mRNA codons at the ribosome. C) attach appropriate amino acids to corresponding tRNAs. D) form the peptide bond between amino acids at the ribosome. E) synthesize and transport amino acids to the ribosomes.

C

The polymerase that synthesizes which of the following molecules uses DNA as a template and synthesizes new strands from 5 to 3? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

C

There are enzymes called aminoacyl-tRNA synthetases that attach tRNAs to the appropriate amino acid. Assume that the aminoacyl-tRNA synthetase that attaches tryptophan to its tRNA in an E. coli mutant strain is only partially active. It is active enough for the strain that carries it to be viable but is much less active than that of wild-type cells. What would be the expected effect of this mutation on attenuation in the trp operon? A) Pairing of regions 3 and 4 in the 5 UTR of the RNA will be enhanced so attenuation will increase in the presence of tryptophan. B) Pairing of regions 2 and 3 in the 5 UTR of the RNA will be decreased so attenuation will increase in the presence of tryptophan. C) Pairing of regions 3 and 4 in the 5 UTR of the RNA will be decreased so attenuation will decrease in the presence of tryptophan. D) Attenuation will not change but the trp repressor will be more active and the transcription of the trp operon structural genes will be decreased in the presence of tryptophan. E) Attenuation will be decreased in the absence of tryptophan but will be enhanced in the presence of tryptophan.

C

Translating an mRNA requires two other types of RNA: A) tRNA and mRNA. B) tRNA and miRNA. C) tRNA and rRNA. D) rRNA and siRNA. E) snRNA and snoRNA.

C

What do group I and group II introns have in common? A) Both are found in mitochondrial genes. B) Both are found in bacteriophages. C) Both are known to be self-splicing introns. D) Both are found in protein-coding genes of chloroplasts. E) Both are frequently found in eukaryotic genes.

C

What types of bonds are created between nucleotides during the process of transcription? A) ionic B) oxygen C) phosphodiester D) hydrogen E) both phosphodiester and hydrogen

C

What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron? A) A shorter than normal protein would be produced. B) Replication would be inhibited. C) A longer than normal mRNA would be produced. D) A longer than normal DNA would be produced. E) Transcription would terminate prematurely.

C

What would happen to the lac operon in the absence of allolactose? A) The structural genes within the lac operon will be constitutively transcribed. B) The activator protein will be bound to the operator, which will turn on the structural gene behind it. C) The repressor regulator protein binds to the operator and prevents the transcription of the structural gene. D) The catabolite activator protein becomes inactivated and no transcription occurs. E) The cAMP level rises in the absence of allolactose, which in turn inactivates the transcription.

C

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing. A) 5 base B) middle base C) 3 base

C

Which of the following DNA-binding motifs are composed of three alpha helices? A) zinc-finger motif B) leucine-zipper motif C) homeodomain motif D) helix-turn-helix motif E) helix-loop-helix motif

C

Which of the following events is NOT part of prokaryotic translation initiation? A) IF-3 separates ribosome subunits so that a small subunit can bind mRNA through base pairing of the 16S rRNA and the Shine-Dalgarno sequence on the mRNA. B) An initiator tRNAformylmet binds the initiation codon, with the help of IF-1 and IF-2 complexed with GTP. The tRNAformylmet is positioned in the P site. C) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site. D) IF-3 dissociates, allowing a large subunit to bind the 30S initiation complex.

C

Which of the following is NOT required during the process of tRNA charging? A) amino acid B) tRNA C) GTP D) ATP E) aminoacyl-tRNA synthetase

C

Which of the following is observed in prokaryotes but not in eukaryotes? A) UGG is an example of a stop codon only found in prokaryotes. B) An mRNA can be translated by only one ribosome at a time in prokaryotes. C) The 5 ́ end of a prokaryotic mRNA can be translated while the 3 ́ end is still being transcribed. D) Translation does not require any protein factors in prokaryotes. E) In prokaryotes, ribosomes move along an mRNA in the 3 ́ to 5 ́ direction.

C

Which of the following mechanisms specifically allows detection and rapid degradation of mRNA containing a premature termination codon? A) RNA interference B) no-go decay C) nonsense-mediated mRNA decay D) transfer-messenger RNA mediated ribosomal removal E) nonstop mRNA decay

C

Which of the following molecules is synthesized using triphosphate nucleotides as a substrate for a polymerase enzyme that forms phosphodiester bonds? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

C

Which of the following statements is TRUE regarding transcription in most organisms? A) All genes are transcribed from the same strand of DNA. B) Both DNA strands are used to transcribe a single gene. C) Different genes may be transcribed from different strands of DNA. D) The DNA template strand is used to encode double-stranded RNA. E) The DNA nontemplate strand is used to encode single-stranded RNA.

C

siRNAs and miRNAs function in which of the following processes? A) transcription B) translation C) RNA interference D) RNA editing E) RNA splicing

C

A bacterial protein is encoded by the following mRNA sequence: 5-AUGGUGCUCAUGCCCTAA-3. The second methionine codon (AUG) in this mRNA sequence will: A) serve as the initiation codon. B) encode N-formylmethionine. C) encode methionine that will eventually be removed. D) encode unformylated methionine. E) be skipped as the translation progresses.

D

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail? A) The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail. B) The poly(A) tail facilitates the attachment of the ribosome to the mRNA. C) The poly(A) tail is important for proper nuclear export of the mRNA. D) The poly(A) tail at the 3 end translates to a long stretch of repeated amino acids. E) Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.

D

A mutant E. coli strain is found that synthesizes -galactosidase in the absence of glucose whether or not lactose is present. What two mutations might lead to this outcome? A) lacIs mutation or lacOc mutation B) lacP- mutation or lacI- mutation C) lacP- mutation or lacOc mutation D) lacI- mutation or lacOc mutation E) lacP- mutation or lacIs mutation

D

A mutant E. coli strain, grown under conditions that normally induce the lac operon, does not produce ß-galactosidase. What is a possible genotype of the cells? A) lacI+ lacP+ lacO+ lacZ+ lacY- lacA+ B) lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ C) lacl+ lacP+ lacO+ lacZ+ lacY+ lacA+ D) lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ E) lacI- lacP+ lacO- lacZ+ lacY+ lacA-

D

A yeast strain was exposed to chemical mutagen. As expected, exposure to mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. Which of the following answers would BEST explain this apparent discrepancy? A) The DNA sequence change occurred in a synonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. B) If the protein sequence was not affected, no lethal phenotype manifested. C) The DNA sequence change resulted in an amino acid change, but that amino acid change had no negative effect on protein function (i.e., was a neutral change). D) The DNA sequence change occurred in a nonsynonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. E) All mutations that cause a change in DNA sequence result in a lethal phenotype.

D

Choose the BEST consensus sequence for the following set of nucleotide sequences. TAAGACGCCATGA AAAGTCGCAATCA AAAGTTCCGTTCA AGAGTTGCTATCA AGAGTTGCAA TCA A) Y ACGTRGCA TG/CA B) AYTRTRGCATGA C) AAAGTNGANTCA D) ARAGTYGCNTCA E) ACTNCGYTGARA

D

Codons that specify the same amino acid are said to be: A) wobbly. B) isoaccepting. C) hypothetical. D) synonymous. E) anonymous.

D

During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an mRNA. Arrange the following steps of the capping process in the CORRECT order. 1. Addition of a guanine nucleotide via a 5-5 bond 2. Removal of a phosphate from a ribonucleotide triphosphate at the 5 head of the pre-mRNA 3. Methylation at the 2 position of the sugar in the second and the third nucleotides 4. Methylation at position 7 of the terminal guanine base A) 1, 2, 3, 4 B) 2, 4, 1, 3 C) 4, 1, 3, 2 D) 2, 1, 4, 3 E) 3, 2, 4, 1

D

Guide RNAs are needed in: A) transcription. B) translation. C) RNA interference. D) RNA editing. E) RNA splicing.

D

If the DNA strand 5ʹ-GTACCGTC-3ʹ were used as a template, what would be the sequence of the transcribed RNA? A) 5-GUACCGUC-3 B) 5-GACGGTAC-3 C) 5-CAUGGCAG-3 D) 5-GACGGUAC-3 E) 5-GUCGGUAC-3

D

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT? A) Colinearity means that the linear nucleotide sequence of a given gene corresponds directly to the linear amino acid sequence in the corresponding polypeptide. B) The number of nucleotides in a gene should be precisely proportional to the number of amino acids present in the corresponding polypeptide. C) Colinearity generally holds true for the coding regions of prokaryotic viral genes. D) The vast majority of eukaryotic genes follow the concept of colinearity. E) The exception to colinearity between genes and polypeptides is the presence of untranslated sequences (UTRs).

D

In a transcription reaction, two phosphate groups are cleaved from the incoming: A) deoxyribonucleoside diphosphate. B) deoxyribonucleoside triphosphate. C) ribonucleoside diphosphate. D) ribonucleoside triphosphate. E) ribozyme.

D

Scientists once believed that each gene can encode a single polypeptide. We now know that _____ and _____ allow a single gene to encode more than one polypeptide. A) transcription; translation B) polyadenylation; RNA transport C) DNA methylation; chromatin condensation D) alternative processing; RNA editing E) gene silencing; RNA interference

D

The spliceosome is a large, ribonucleoprotein complex located in the: A) cytoplasm. B) endoplasmic reticulum. C) Golgi aparatus. D) nucleus. E) nucleolus.

D

The trp operon is known to operate by both negative repressible regulation of operator and attenuation. Which of the following statements does NOT support the reason as to why dual control exists to regulate the operon? A) The repression alone is never complete, and some transcription can be initiated. B) Combined mechanism provides a much finer tuning of tryptophan synthesis regulation. C) Attenuation and repression allow the cell to more sensitively respond to the tryptophan level. D) It is most likely due to the fact that the attenuation is the evolutionary relic, which by accident has remained. E) Repression responds to the cellular levels of tryptophan, while attenuation responds to the number of tRNA charged with tryptophan.

D

When a structural gene is under positive inducible control, what would be the result of a mutation that eliminates the activator protein? A) The structural gene will be constitutively expressed due to the lack of inducible control. B) The transcription of the structural gene will not be affected, as an activator is not required. C) The mutation will lead to activation of a repressor upon the lack of an activator protein, which will block transcription. D) Since transcription will require an activator protein, the transcription will be turned off. E) More cAMP will be produced in a cell to compensate for the lack of an activator protein.

D

Which mechanism allows for the production of polypeptides that are not entirely encoded by DNA? A) regulated transcription B) RNA interference C) alternative RNA processing D) RNA editing E) colinearity

D

Which molecule allows the release of mRNA from a stalled ribosome? A) miRNA B) snoRNA C) incRNA D) tmRNA E) siRNA

D

Which of the following facts about riboswitches is INCORRECT? A) Binding of certain molecules to the riboswitches results in the formation of specific secondary structures of mRNA. B) Certain molecules that bind to riboswitches may act as repressors or inducers of transcription. C) Riboswitches are not only found in bacterial cells but also in archaeal, fungal, or plant cells. D) Riboswitches are typically found in the 3 UTR of the mRNA structure. E) The secondary structure that forms riboswitches typically contains a base stem and several branching hairpins.

D

Which of the following statements about protein folding and posttranslational modifications of proteins is CORRECT? A) All nascent polypeptide chains have the intrinsic ability to fold into the active conformation based on the primary structure. B) Only eukaryotic proteins undergo alterations following translation. C) Amino acids within a protein may be modified by molecular chaperones. D) Signal sequence of a protein helps direct a protein to a specific location within the cell. E) Attachment of a protein called ubiquitin directs proteins to enter into the nucleus.

D

Which of the following statements about translation is CORRECT? A) A special tRNA that does not have an attached amino acid binds to stop codons to terminate translation. B) The first three bases at the 5 end of an mRNA are the AUG at which translation begins. C) The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end. D) In eukaryotes, the 5 cap and the 3 poly(A) tail are involved in translation initiation. E) Ribosomes move along an mRNA in the 3 to 5 direction.

D

Which one of the following codons codes for a different amino acid from the rest? A) CUU B) CUC C) UUA D) UUU E) CUA

D

Mutations occurred in one of the inverted repeat sequences within the rho-independent terminator sequence of a bacterium. What would likely be the consequence of this mutation? (Select all that apply.) A) The transcription may end prematurely. B) The transcription may not be initiated at all. C) The transcription may be delayed. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may not terminate and result in much longer RNA.

D, E

A mutation occurs in the trp operon DNA of E. coli and results in the change to the two UGG tryptophan codons in the 5 UTR of the RNA to UAG stop codons. What effect will this mutation be expected to have on the regulation of this mutant trp operon compared to a wild-type operon? A) In the presence of tryptophan, transcription of the structural genes will be reduced compared with a wild-type operon. B) In the absence of tryptophan, transcription of the structural genes will be reduced compared with a wild-type operon. C) In the presence of tryptophan, the repressor will bind to the operator/promoter region with the mutant operon more strongly than with a wild-type operon. D) In the absence of tryptophan, RNA polymerase will not bind to the operator/promoter region with the mutant operon. E) In the presence of tryptophan, transcription of the structural genes will be enhanced compared with a wild-type operon.

E

A partial diploid E. coli cell of lacI+lacP+lacOc lacZ-lacY-/ lacI- lacP+ lacO+lacZ-lacY+ genotype will synthesize: A) both lacZ and lacY gene products in the absence of lactose. B) neither lacZ nor lacY gene products in the presence of lactose. C) lacZ but not lacY gene product in the presence of lactose. D) lacY but not lacZ gene product in the absence of lactose. E) lacY but not lacZ gene product in the presence of lactose.

E

A scientist is studying a gene known as the ABC gene in bacteria. Into a bacterial cell, she inserts an miRNA that is complementary to a portion of the ABC mRNA found in the cell. What result would you predict? A) There will be an increase in the amount of ABC protein made. B) There will be a decrease in the amount of ABC protein made. C) There will be an increase in the transcription of the ABC gene. D) There will be a decrease in the transcription of the ABC gene. E) No change will result from the insertion of the miRNA.

E

An mRNA has the stop codon 5 UAA 3. What tRNA anticodon will bind to it? A) 5ATT3 B) 5 AUC 3' C) 5' ACU 3 D) 5 UUA 3 E) none

E

Below is a list of steps in the processing of ribosomal RNAs. Please select the choice that lists the steps in the CORRECT sequential order. 1. Methyl groups added to specific bases and the 2-carbon atom of some ribose sugars 2. Transcription of the rRNA precursors from DNA 3. Cleavage of precursor rRNA 4. Individual rRNA molecules ready for ribosome assembly 5. Trimming of precursor rRNA A) 3, 1, 2, 5, 4 B) 2, 3, 4, 5, 1 C) 4, 2, 3, 1, 5 D) 1, 3, 5, 4, 1 E) 2, 1, 3, 5, 4

E

If a splice site were mutated so that splicing did not take place, what would be the effect on the amino acid sequence? A) It would be shorter than normal. B) It would be longer than normal. C) It would be the same length but would encode a different protein. D) It would be unable to fold into its correct structure. E) It depends on the mutant mRNA sequence.

E

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the: A) rho factor. B) TFIID. C) TBP. D) omega subunit. E) sigma factor.

E

RNA-mediated repression is carried out by: A) nonsense RNA. B) sense RNA. C) antisense RNA. D) riboswitches. E) ribozymes.

E

The information needed during RNA editing comes MOST directly from: A) pre-mRNA. B) mRNA. C) rRNA. D) tRNA. E) guide RNA.

E

The sequence 5 ...GGAGCUCGUUGUAUU... 3 is changed to 5... GGAGACUCGUUGUAUU... 3. What would be the effect on the amino acid sequence? A) There would be no effect on the amino acid sequence. B) This is an insertion mutation so there would be a premature stop codon. C) The amino acid sequence would be asn-thr-thr-thr-leu. D) The amino acid sequence would be thr-ser-tyr-leu-asn. E) The amino acid sequence would be gly-asp-ser-leu-tyr.

E

There are _____ different codons, which encode 20 amino acids and 3 stop codons. A) 16 B) 20 C) 23 D) 61 E) 64

E

Transcriptional control that acts by regulating the continuation of transcription is called: A) riboswitching. B) antitermination. C) negative control. D) operator mutation. E) attenuation.

E

What is the function of general transcription factors? A) They are DNA sequences to which RNA polymerase binds. B) They direct nucleosome assembly. C) They bind to regulatory promoters to increase the rate of transcription. D) They bind to enhancers to allow minimal levels of transcription. E) They are a part of the basal transcription apparatus.

E

What is the function of peptidyl transferase activity? A) It charges tRNAs. B) It acetylates the end of a protein after translation. C) It cleaves the polypeptide from the last tRNA during termination. D) It moves ribosomes along mRNA during translation. E) It forms peptide bonds.

E

What is the minimum number of different aminoacyl-tRNA synthetases required by a cell? A) 64, one for each codon B) 61, one for each sense codon C) 30, one for each different tRNA D) 50, one for each different tRNA E) 20, one for each amino acid

E

Which amino acid is coded by the stop codons in most organisms? A) met B) pro C) trp D) cys E) none

E

Which of the following E. coli strains will synthesize permease in the presence of lactose and absence of glucose? A) lacI- lacP- lacO+ lacZ+ lacY+ B) lacIs lacP- lacO+ lacZ- lacY+/lacI+ lacP+ lacO+ lacZ+ lacY+ C) lacI- lacP+ lacO+ lacZ+ lacY- D) lacI- lacP+ lacOc lacZ-lacY-/lacI+ lacP- lacO+ lacZ- lacY+ E) lacI+ lacP+ lacOc lacZ+ lacY-/lacI- lacP+ lacO+lacZ- lacY+

E

Which of the following does NOT enhance the binding of the ribosome to the 5 ́ end of the mRNA? A) 5 ́ cap B) 3 ́ poly(A) tail C) cap-binding proteins D) poly(A) proteins E) enhancer

E

Which of the following phenomena is NOT affected by the presence of alternative splicing? A) speciation B) development C) organismal complexity D) tissue specificity E) RNA interference

E

Which of the following rRNA components originates from a separate gene transcript rather than as a cleaved product of a long single precursor rRNA transcript? A) prokaryotic 16S rRNA B) prokaryotic 23S rRNA C) eukaryotic 18S rRNA D) eukaryotic 5.8S rRNA E) eukaryotic 5S rRNA

E

Which of the following regulatory RNA types is different from the rest in terms of its length? A) siRNA B) crRNA C) miRNA D) piRNA E) lncRNA

E

Which of the following secondary structures causes attenuation of structural genes of the trp operon? A) 1+2 loop B) 1+3 loop C) 2+4 loop D) 2+3 loop E) 3+4 loop

E

Which of the following statements CORRECTLY describes the concept of alternative splicing? A) Eukaryotic gene and protein sequences are precisely colinear. B) With the rare exception of RNA editing, every nucleotide contained in a processed mRNA molecule is derived from exon sequences. C) Every other intron is removed in an alternate manner to generate a functional mRNA transcript. D) Only a subset of the same mRNA transcripts is specifically selected for splicing in the nucleus. E) Multiple protein products are often produced from single eukaryotic genes.

E

Which of the following statements about DNA-binding proteins is NOT true? A) Specific amino acids within the motif form hydrogen bonds with DNA. B) These proteins can affect the expression of a gene. C) Most DNA-binding proteins bind dynamically. D) Some of these proteins incorporate a metal ion such as zinc. E) Once bound, most of DNA-binding proteins remain on DNA permanently.

E

Which of the following statements about regulation of gene expression is CORRECT? A) An inducible gene is transcribed when a specific substance is absent. B) A gene is any DNA sequence that is transcribed into an mRNA molecule only. C) All genes are transcribed at all times as long as they have a functional promoter. D) The regulation of gene expression is the same in both eukaryotes and prokaryotes. E) The regulation of gene expression is critical for the control of life processes in all organisms.

E

Which of the following statements describes the "wobble" rules CORRECTLY? A) There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids. B) The number of the genetic code exceeds the number of amino acids available in the cell. C) There are multiple tRNAs that may bind to the same amino acids. D) There are multiple codons that may code for the same amino acids. E) The third base pairing between the tRNA and mRNA is relaxed.

E

Which of the following statements is FALSE regarding TFIID? A) It contains a TATA-binding protein. B) It aids in initiation of transcription. C) It binds to the core promoter. D) It binds to the TATA box. E) It is a transcriptional activator protein

E

_____ probably began the evolution of life on Earth. A) DNA B) RNA promoters C) DNA polymerases D) RNA polymerases E) Ribozymes

E

In transcription, to which end of the elongating strand are nucleotides always added? A) 3 B) 5 C) 3 in prokaryotes and 5 in eukaryotes D) It depends on which RNA polymerase is being used. E) It depends on which DNA strand is being used as the template.

A

Over time, DNA replaced RNA as the primary carrier of genetic information, and the chemical stability of DNA is believed to be the key reason for this. Which attribute of DNA is the reason behind its chemical stability? A) DNA lacks a free hydroxyl group on the 2-carbon atom of its sugar. B) Unlike RNA, DNA is usually double stranded. C) DNA does not usually form hairpin loops. D) One of the two pyrimidines found in DNA does not involve uracil. E) DNA contains thymines, which make it more chemically stable.

A

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 A) 5 ACUGGACAGUCGGCACCACG 3 B) 5 GUAAGAAUACAAC 3 C) 5 UGACCUGUCAGCCGUGGUGC 3 D) 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 E) 5 AGAAUACAACACAGUCGGCACCACG 3

A

To which part on a tRNA would an amino acid attach during tRNA charging? A) 3 acceptor arm B) anticodon arm C) TC arm D) DHU arm E) extra arm

A

Which of the following intron types is present only in eukaryotes? A) nuclear pre-mRNA B) group I intron C) group II intron D) tRNA E) group III intron

A

Which of the following statements BEST explains why only pre-mRNA receives a 5 cap? A) The enzyme that initiates the capping step is known to associate with RNA polymerase II, which generates pre-mRNAs. B) Only pre-mRNAs contain proper sequences for the cap to be added on. C) The tail of the pre-mRNA can recruit the right combination of enzymes for capping. D) Nuclear pore complexes only recognize pre-mRNAs and allow them out to the cytoplasm for the capping process to begin. E) rRNA and tRNAs do not exit the nucleus to receive the cap via enzymes in the cytoplasm.

A

Which of the following statements CORRECTLY describes the facts about introns and exons? A) The number of introns is always less than the number of exons in a gene. B) Introns are degraded in the cytoplasm. C) All eukaryotic genes contain an intron. D) Mitochondrial and chloroplast genes do not contain introns. E) Introns do not contain sequence-specific information.

A

Which of the following statements is TRUE regarding the termination of transcription? A) In some organisms, transcription terminates thousands of nucleotides past the coding sequence. B) Transcription typically terminates precisely at the hairpin loop terminator sequence. C) In prokaryotes, transcription terminates as soon as rho has bound to the RNA. D) In yeast, transcription terminates as soon as Rat1 has bound to the RNA.

A

A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic cell, she inserts an miRNA that is complementary to a portion of the XYZ mRNA found in the cell. What result would you predict? A) There will be an increase in the amount of XYZ protein made. B) There will be a decrease in the amount of XYZ protein made. C) There will be an increase in the transcription of the XYZ gene. D) There will be a decrease in the transcription of the XYZ gene. E) No change will result from the insertion of the miRNA.

B

Which of the following spliceosomal components specifically recognizes and binds to the branch point of the intron during pre-mRNA splicing? A) U1 B) U2 C) U5 D) U6 E) spliceosomal proteins

B

When does sigma factor normally dissociate from RNA polymerase? A) after transcription has terminated B) after the process of initiation C) after the addition of nucleosomes D) after the binding of rho E) following the addition of nucleosomes

B

Which of the following is not necessary for RNA polymerase to recognize the promoter of a bacterial gene? A) sigma factor B) origin of replication C) -10 consensus sequence D) -35 consensus sequence

B

Which of the following statements about bacterial mRNA transcripts is TRUE? A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain untranslated regions. B) The Shine-Dalgarno sequence associates with an RNA component in the small subunit of ribosomes. C) Transcription and translation take place sequentially in bacterial cells. D) Most of bacterial genes contain a large number of introns and small number of exons. E) The 5 end and 3 end of mRNA transcripts are modified in bacteria.

B

Which of the following types of RNA gets translated? A) rRNA B) mRNA C) tRNA D) miRNA E) rRNA, mRNA, and tRNA all get translated

B

An in vitro transcription system that contains a bacterial gene does not initiate transcription. What is one possible problem? A) Histones that were on the DNA when it was isolated from E. coli are blocking access to the template. B) There is a mutation in the inverted repeat sequence that prevents a hairpin secondary structure from forming. C) There is a mutation at -10, where a promoter consensus sequence is located. D) Rho factor has not been added. E) TATA-binding protein (TBP) has not been added.

C

Below is a list of steps of intron removal and splicing during pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Attachment of snRNP U1 to the 5 splice site 2. Transcription of the DNA template into the pre-mRNA molecule 3. Release of lariat structure 4. Splicing together of exons 5. Transesterification reaction at the branch point adenine A) 1, 2, 3, 4, 5 B) 4, 1, 3, 5, 2 C) 2, 1, 5, 3, 4 D) 3, 5, 1, 2, 4 E) 5, 3, 4, 1, 2

C

Below is a list of steps of intron removal and splicing during pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Attachment of snRNP U1 to the 5 splice site 2. Transcription of the DNA template into the pre-mRNA molecule 3. Release of lariat structure 4. Splicing together of exons 5. Transesterification reaction at the branch point adenine A) 1, 2, 3, 4, 5 B) 4, 1, 3, 5, 2 C) 2, 1, 5, 3, 4 D) 3, 5, 1, 2, 4 E) 5, 3, 4, 1, 2

C

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it. B) The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site. C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site. D) Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site. E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.

C

Which class of RNA is MOST abundant in cells? A) mRNA B) tRNA C) rRNA D) snRNA E) miRNA

C

Which mechanism allows for more than one polypeptide to be encoded by a single gene? A) regulated transcription B) RNA interference C) alternative RNA processing D) self-splicing of introns E) RNA methylation

C

Which of the following consensus sequences are NOT found in nuclear introns? A) GU at the 5 splice site at the beginning of the intron B) AG at the 3 splice site at the end of the intron C) CCA at the 3 site downstream of the branch point D) a at the lariat branch point site E) 3 CAGG consensus sequence at the 3 splice site

C

Which of the following statements regarding gene structure is TRUE? A) The amino acid sequence of a polypeptide can be precisely predicted by the nucleotide sequence of the gene that encodes it. B) The number of introns found in organisms is species specific. C) The number of exons and introns generally correlates to the complexity of the organisms. D) Intron cleavage and exon splicing are both mediated exclusively by protein enzymes. E) The number of exons is always less than the number of introns in a gene.

C

Which one of the following statements regarding eukaryotic transcription is NOT true? A) Eukaryotic transcription involves a core promoter and a regulatory promoter. B) There is no one generic promoter. C) A group of genes is transcribed into a polycistronic RNA. D) Chromatin remodeling is necessary before certain genes are transcribed. E) There are several different types of RNA polymerase.

C

During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an mRNA. Arrange the following steps of the capping process in the CORRECT order. 1. Addition of a guanine nucleotide via a 5-5 bond 2. Removal of a phosphate from a ribonucleotide triphosphate at the 5 head of the pre-mRNA 3. Methylation at the 2 position of the sugar in the second and the third nucleotides 4. Methylation at position 7 of the terminal guanine base A) 1, 2, 3, 4 B) 2, 4, 1, 3 C) 4, 1, 3, 2 D) 2, 1, 4, 3 E) 3, 2, 4, 1

D

Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ cap. What would be an expected result? A) Transcription would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. B) Translation would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. C) Transcription would not occur as the transcription factors would not be able to bind to the promoter. D) Translation would not occur as the ribosome would not be able to bind to the mRNA. E) Replication would not occur as DNA polymerase would not be able to bind to the DNA at the origin of replication.

D

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? A) It blocks access of RNA polymerase to the promoter until removed by general transcription factors. B) It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. C) It modifies histones so that nucleosomes can be removed from DNA for transcription. D) It bends and partly unwinds DNA at a promoter. E) It creates a phosphodiester bond between the nucleotides.

D

What is the similarity between miRNAs, siRNAs, and piRNAs? A) All three types originate from transposons or viruses and are found in all organisms. B) They all target and degrade the gene from which they were transcribed. C) All three are generated from a single-stranded RNA that gets cleaved. D) All three can influence chromatin structure, which, in turn, can influence gene expression. E) All three associate with Piwi proteins in order to mediate RNA degradation.

D

When studying a plant's protein production, a scientist found two different proteins. The first one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second one only contained amino acids from exons from 1, 2, and 3. Which of the following is MOST likely responsible for this difference? A) a mutation in the gene that encodes an miRNA B) posttranslational modification C) RNA editing D) alternative RNA processing E) a mutation in the gene that encodes a snoRNA

D

Whereas the nucleotide strand used for transcription is termed the _____, the nontranscribed strand is called the _____. A) promoter; terminator B) terminator; promoter C) transcription apparatus; TATA box D) template strand; nontemplate strand E) nontemplate strand; template strand

D

Which of the following classes of RNAs is unique to eukaryotes? A) messenger RNA (mRNA) B) ribosomal RNA (rRNA) C) transfer RNA (tRNA) D) small nuclear RNAs (snRNAs) E) CRISPR RNAs (crRNAs)

D

Which of the following elements would NOT be found in an mRNA molecule? A) protein-coding region B) 3 untranslated region C) 5 untranslated region D) promoter E) start and stop codons

D

Which of the following intron types requires spliceosomes for removal? A) group I intron B) group II intron C) group III intron D) nuclear pre-mRNA E) tRNA

D

Which of the following is found in the primary product of transcription but not in a mature mRNA molecule? A) start codon B) promoter C) exons D) introns E) stop codon

D

Which of the following molecules is made of nucleotides joined by phosphodiester bonds that connect the 2 OH to the 5 phosphate? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

D

Which of the following observations supports the notion that the gene is simply a set of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide? A) Alternative splicing—a single gene can yield multiple mRNA and protein products. B) A single ribosomal RNA transcript can liberate several RNA molecules via further processing. C) RNAs can be the functional product of a gene without being translated into a protein product. D) Within a protein coding region, each codon represents a specific amino acid that will be linked to form a polypeptide. E) Regulatory elements are part of a gene that regulate timing, degree, and specificity of gene expression but are not transcribed.

D

Which of the following processes does NOT support the observation that the amino acid sequence of a protein may not be the same as that encoded by its gene? A) RNA editing B) alternative splicing C) multiple 3 cleavage sites D) 5 capping E) errors that occurred during transcription

D

Which of the following statements about group I and group II introns is NOT true? A) Both group I and II introns form elaborate and characteristic secondary structures with loops. B) The splicing mechanism of group II introns is similar to that of spliceosome-mediated nuclear pre-mRNA splicing. C) The length of group I and group II introns is much longer than the exons within the structures. D) Group I and group II introns are exclusively found in mitochondrial and chloroplast encoded genes. E) Both group I and group II introns are both found in bacterial genes.

D

Which of the following statements about ribosomes and ribosomal RNA is NOT true? A) Ribosomes typically contain about 80% of the total cellular RNA. B) Ribosomal RNA is processed in both prokaryotes and eukaryotes. C) In eukaryotes, genes for rRNA are usually present within tandem repeats. D) Each ribosomal RNA component is encoded by a separate gene. E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the nucleus.

D

The human gene encoding calcitonin contains six exons and five introns and is located on chromosome 11. The pre-mRNA transcript from this gene can generate either calcitonin or calcitonin gene-related peptide (CGRP) in a tissue-specific manner. Calcitonin produced from the thyroid gland is 32 amino acids long and functions to regulate the calcium while CGRP, which contains 37 amino acids, is produced by the brain cells and involved in transmission of pain. Which of the following processes makes production of two functionally and structurally different proteins from the same gene possible? A) self-spicing introns B) differential transcription C) alternative replication D) 5 capping and polyadenylation E) alternative RNA processing

E

Which of the following is a sequence of DNA where transcription is initiated? A) hairpin loop B) TBP C) initiator D) sigma factor E) promoter

E