Genetics Final

Test cross

-An unknown genotype crossed with a homozygous recessive individual -useful in determining the genotype of a particular organism

Describe the structure of DNA

-sugar phosphate backbone -complementary base pairing -anti-parallel

An organism is homozygous for 8 genes and heterozygous for 3 genes. How many different genotypes would you expect in the gametes from this organism? A) 11 B) 8 C) 3

1*1*1*1*1*1*1*1 = 8 homologous 2*2*2 = 8 (multiple because each condition separate

Questions(1-4) deal with 2 unlinked genes, A and B. 1. From an A/a; B/b organism, which line shows correct genotypes for 4 sperm that could be produced by a single germ cell that segregated its chromosomes normally. You can ignore the effects of recombination. 2. From an A/a; B/b organism, which line shows correct genotypes for 1000 sperm produced by a bunch of germ cells that segregated their chromosomes normally. You can ignore the effects of recombination. 3. From an A/a; B/b organism, which line shows correct genotypes for 4 sperm that could be produced by a single germ cell that suffered nondisjunction of the B sister chromatids in meiosis II. You can ignore the effects of recombination. 4. From an A/a; B/b organism, which line shows correct genotypes for 4 sperm that could be produced by a single germ cell that suffered nondisjunction of the A and a homologs in meiosis I. You can ignore the effects of recombination.

1. A;B A;B a;b a;b 2.A;B A;b a;B a;b 3.A;B/B A a;b a;b 4.A/a; b A/a; b B B

Mary's husband's sister died of the disease at an early age. What is the probability that Mary and her husband could have an affected child? Hint: Draw the pedigree for Mary's husband's family to help you with this question.

1/18

haplosufficient

1/2 the dosage still functions showing the phenotype has if it had full dosage( remember albanism example)

1) This question provides information for both Questions 1 and 2. Tay-Sachs is a recessive lethal disease. It leads to neurological deterioration soon after birth and death usually by the age of 4. This disease is rare in the population overall but is found at relatively high frequency in Ashkenazi Jews from Central Europe. A woman (Mary) whose maternal uncle (her mother's brother) had the disease is trying to determine the probability that she and her husband could have an affected child. Mary's father does not come from a high-risk population. What is the probability that Mary is a carrier? Hint: Draw the pedigree for Mary's family to help you with this question.

1/3

Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. What proportion of the offspring of the above cross do you expect to show the fully recessive phenotype

1/4

Sickle cell anemia is a recessive trait in humans. A male with sickle cell anemia marries a female who is a carrier (i.e. heterozygous for a mutant allele). What is the probability that their first 3 children will NOT have sickle cell anemia?

1/8

Diploid

2 sets of chromosomes--> one from the mother, one from father

Which cell below (#1, #2, #3, or #4) shows the correct line-up of X chromosomes in meiosis I in an XX female heterozygous for the X-linked gene E? You can ignore the effects of recombination. 1: E/e. 2: E/E; e/e. 3. E/e;E/e 4. E/E;e/e

4

Using the letter H for one gene and the letter G for the second gene, correctly write the genotypes (using ; and / symbols) of a cross between 2 dihybrids. What proportion of the offspring of that cross do you expect to show the 1 dominant trait and 1 recessive trait? 1/16 1/8 1/4 6/16 1/2 9/16

6/16

A diploid organism is homozygous for 3 unlinked genes and heterozygous for 6 unlinked genes. (Remember: "unlinked" means they are on different chromosomes.) How many different genotypes would you expect among the gametes produced by that organism? Put a number in the box.

64

The sequence below shows the coding sequence of a gene that encodes a small protein. ATGCACTCCGGATACCATGATTTTGGATAA How many amino acids are in the small protein encoded by this gene? Enter a number in the box provided.

9 ( TAA is a stop codon)

Using the letter H for one gene and the letter G for the second gene, correctly write the genotypes (using ; and / symbols) of a cross between 2 dihybrids. What proportion of the offspring of that cross do you expect to show the fully dominant phenotype? 1/16 1/4 6/16 1/2 9/16

9/16

dihybrid cross

A cross between individuals that have different alleles for the same gene

Aneuploid

Abnormal number of chromosomes. ( aneuploidy associated with cancer and birth defects)

non-homologous chromosomes

Chromosomes that have different genes

Allele

Different forms of a gene

linked genes

Genes located on the same chromosome that tend to be inherited together in genetic crosses.

sister chromatids

Identical copies of a chromosome produced through replication( same genes and same alleles)

A mother homozygous for dominant alleles of the A and B genes and a father heterozygous for both the A and B genes have an offspring with genotype A/a/a; B/b. When did nondisjunction occur? Meiosis I in the mother Meiosis II in the father Meiosis I in the father Meiosis II in the father the A/a/a;B/b offspring is... Haploid Triploid Monosomic Trisomic

Meiosis II in the father Trisomic

Explain the process of meiosis

before the cell divides, it replicates the chromosomes to produce sister chromatids, then 2 rounds of division to produce 4 haploid cells

Gene

composed of intron and exon--> exon= gives rise to the mRNA and protein intron= non-coding dna

Translation

condons translate mRNA into proper sequence for a protein/polypeptide(codons determine RNA sequence).

monohybrid cross

cross between two parents heterozygous for a single gene

What are the parental genotypes in the cross below? round x round --> 100% round a)R/r x R/r b)R/R x R/R c)R/R x R/r d)R/R x R/-

d

unlinked genes

genes on different chromosomes

Genotype vs. Phenotype

genotype refers to the genes(specifically the alleles) an individual has rather than phenotype

Genotypic ratio vs Phenotypic ratio in monohybrid

genotypic: 1:2:1 phenotypic: 3:1

With the genotypes: A/A: which produces functional protein tyrosine producing melanin A/a: which produces 1/2 dosage functional protein and 1/2 non-functional protein which still then produces melanin a/a: only non functional protein so no melanin produced The A gene is 1) halo-insufficent 2)halo-sufficient

haplo-sufficient

Euploid

having the correct number of chromosomes ( euploidy change associated with cancer)

homologous chromosomes

homologous chromosomes have the same genes but could have different alleles

1. In a D/d cell, D and d are on: a)Homologs b)non-homologous c)sister-chromatids d) different strands of dna 2. Is such a cell: a)1n b)2n c)3n

homologs

true breeding/pure breeding

homozygous for a particular trait

How do you generate a haploid gamete from a diploid cell?

meiosis

What does sexual reproduction rely on?

meiosis--> explanation: an individual produces a haploid cell through meiosis; 2 haploid cells, sperm and egg fuse together to produce an offspring so therefore reproduction goes from meiosis

Explain metaphase 1 and metaphase 2

metaphase 1: segregation of homologous chromosomes metaphase 2: segregation of sister chromatids

Non-disjunction

missegregation of chromosomes during meiosis 1 or 2

A semicolon (;) separates genes and their alleles that are on ... a. Homologous chromosomes b.Non-homologous chromosomes c.Sister chromatids

non-homologous chromosomes

ploidy

number of n: 2n --> ploidy= 2; n= ploidy 1; 3n= 3

n

number of set of chromosomes--> humans have 2 sets of 23--> 2n(diploid)

Haploid

one set of chromosomes( otherwise known as gametes--> eggs and sperm/pollen

In probability "or" means __ and "and" means

or = law of sum(add), and means law of product(multiply)

Transcription

process by which RNA polymerase reads DNA, converts it to RNA, then that mRNA gives rise to proteins in translation

central dogma

the genotypes give rise to the phenotypes in living things through proteins

What is genetics?

the study of genes and their variants(alleles)

Trisomy vs Monosomy

trisomy- extra chromosome (2n+1) monosomy- missing chromosome(2n-1)

Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. Is this a test cross? True False

true