Genetics Final
Test cross
-An unknown genotype crossed with a homozygous recessive individual -useful in determining the genotype of a particular organism
Describe the structure of DNA
-sugar phosphate backbone -complementary base pairing -anti-parallel
An organism is homozygous for 8 genes and heterozygous for 3 genes. How many different genotypes would you expect in the gametes from this organism? A) 11 B) 8 C) 3
1*1*1*1*1*1*1*1 = 8 homologous 2*2*2 = 8 (multiple because each condition separate
Questions(1-4) deal with 2 unlinked genes, A and B. 1. From an A/a; B/b organism, which line shows correct genotypes for 4 sperm that could be produced by a single germ cell that segregated its chromosomes normally. You can ignore the effects of recombination. 2. From an A/a; B/b organism, which line shows correct genotypes for 1000 sperm produced by a bunch of germ cells that segregated their chromosomes normally. You can ignore the effects of recombination. 3. From an A/a; B/b organism, which line shows correct genotypes for 4 sperm that could be produced by a single germ cell that suffered nondisjunction of the B sister chromatids in meiosis II. You can ignore the effects of recombination. 4. From an A/a; B/b organism, which line shows correct genotypes for 4 sperm that could be produced by a single germ cell that suffered nondisjunction of the A and a homologs in meiosis I. You can ignore the effects of recombination.
1. A;B A;B a;b a;b 2.A;B A;b a;B a;b 3.A;B/B A a;b a;b 4.A/a; b A/a; b B B
Mary's husband's sister died of the disease at an early age. What is the probability that Mary and her husband could have an affected child? Hint: Draw the pedigree for Mary's husband's family to help you with this question.
1/18
haplosufficient
1/2 the dosage still functions showing the phenotype has if it had full dosage( remember albanism example)
1) This question provides information for both Questions 1 and 2. Tay-Sachs is a recessive lethal disease. It leads to neurological deterioration soon after birth and death usually by the age of 4. This disease is rare in the population overall but is found at relatively high frequency in Ashkenazi Jews from Central Europe. A woman (Mary) whose maternal uncle (her mother's brother) had the disease is trying to determine the probability that she and her husband could have an affected child. Mary's father does not come from a high-risk population. What is the probability that Mary is a carrier? Hint: Draw the pedigree for Mary's family to help you with this question.
1/3
Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. What proportion of the offspring of the above cross do you expect to show the fully recessive phenotype
1/4
Sickle cell anemia is a recessive trait in humans. A male with sickle cell anemia marries a female who is a carrier (i.e. heterozygous for a mutant allele). What is the probability that their first 3 children will NOT have sickle cell anemia?
1/8
Diploid
2 sets of chromosomes--> one from the mother, one from father
Which cell below (#1, #2, #3, or #4) shows the correct line-up of X chromosomes in meiosis I in an XX female heterozygous for the X-linked gene E? You can ignore the effects of recombination. 1: E/e. 2: E/E; e/e. 3. E/e;E/e 4. E/E;e/e
4
Using the letter H for one gene and the letter G for the second gene, correctly write the genotypes (using ; and / symbols) of a cross between 2 dihybrids. What proportion of the offspring of that cross do you expect to show the 1 dominant trait and 1 recessive trait? 1/16 1/8 1/4 6/16 1/2 9/16
6/16
A diploid organism is homozygous for 3 unlinked genes and heterozygous for 6 unlinked genes. (Remember: "unlinked" means they are on different chromosomes.) How many different genotypes would you expect among the gametes produced by that organism? Put a number in the box.
64
The sequence below shows the coding sequence of a gene that encodes a small protein. ATGCACTCCGGATACCATGATTTTGGATAA How many amino acids are in the small protein encoded by this gene? Enter a number in the box provided.
9 ( TAA is a stop codon)
Using the letter H for one gene and the letter G for the second gene, correctly write the genotypes (using ; and / symbols) of a cross between 2 dihybrids. What proportion of the offspring of that cross do you expect to show the fully dominant phenotype? 1/16 1/4 6/16 1/2 9/16
9/16
dihybrid cross
A cross between individuals that have different alleles for the same gene
Aneuploid
Abnormal number of chromosomes. ( aneuploidy associated with cancer and birth defects)
non-homologous chromosomes
Chromosomes that have different genes
Allele
Different forms of a gene
linked genes
Genes located on the same chromosome that tend to be inherited together in genetic crosses.
sister chromatids
Identical copies of a chromosome produced through replication( same genes and same alleles)
A mother homozygous for dominant alleles of the A and B genes and a father heterozygous for both the A and B genes have an offspring with genotype A/a/a; B/b. When did nondisjunction occur? Meiosis I in the mother Meiosis II in the father Meiosis I in the father Meiosis II in the father the A/a/a;B/b offspring is... Haploid Triploid Monosomic Trisomic
Meiosis II in the father Trisomic
Explain the process of meiosis
before the cell divides, it replicates the chromosomes to produce sister chromatids, then 2 rounds of division to produce 4 haploid cells
Gene
composed of intron and exon--> exon= gives rise to the mRNA and protein intron= non-coding dna
Translation
condons translate mRNA into proper sequence for a protein/polypeptide(codons determine RNA sequence).
monohybrid cross
cross between two parents heterozygous for a single gene
What are the parental genotypes in the cross below? round x round --> 100% round a)R/r x R/r b)R/R x R/R c)R/R x R/r d)R/R x R/-
d
unlinked genes
genes on different chromosomes
Genotype vs. Phenotype
genotype refers to the genes(specifically the alleles) an individual has rather than phenotype
Genotypic ratio vs Phenotypic ratio in monohybrid
genotypic: 1:2:1 phenotypic: 3:1
With the genotypes: A/A: which produces functional protein tyrosine producing melanin A/a: which produces 1/2 dosage functional protein and 1/2 non-functional protein which still then produces melanin a/a: only non functional protein so no melanin produced The A gene is 1) halo-insufficent 2)halo-sufficient
haplo-sufficient
Euploid
having the correct number of chromosomes ( euploidy change associated with cancer)
homologous chromosomes
homologous chromosomes have the same genes but could have different alleles
1. In a D/d cell, D and d are on: a)Homologs b)non-homologous c)sister-chromatids d) different strands of dna 2. Is such a cell: a)1n b)2n c)3n
homologs
true breeding/pure breeding
homozygous for a particular trait
How do you generate a haploid gamete from a diploid cell?
meiosis
What does sexual reproduction rely on?
meiosis--> explanation: an individual produces a haploid cell through meiosis; 2 haploid cells, sperm and egg fuse together to produce an offspring so therefore reproduction goes from meiosis
Explain metaphase 1 and metaphase 2
metaphase 1: segregation of homologous chromosomes metaphase 2: segregation of sister chromatids
Non-disjunction
missegregation of chromosomes during meiosis 1 or 2
A semicolon (;) separates genes and their alleles that are on ... a. Homologous chromosomes b.Non-homologous chromosomes c.Sister chromatids
non-homologous chromosomes
ploidy
number of n: 2n --> ploidy= 2; n= ploidy 1; 3n= 3
n
number of set of chromosomes--> humans have 2 sets of 23--> 2n(diploid)
Haploid
one set of chromosomes( otherwise known as gametes--> eggs and sperm/pollen
In probability "or" means __ and "and" means
or = law of sum(add), and means law of product(multiply)
Transcription
process by which RNA polymerase reads DNA, converts it to RNA, then that mRNA gives rise to proteins in translation
central dogma
the genotypes give rise to the phenotypes in living things through proteins
What is genetics?
the study of genes and their variants(alleles)
Trisomy vs Monosomy
trisomy- extra chromosome (2n+1) monosomy- missing chromosome(2n-1)
Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. Is this a test cross? True False
true