JMU BIO240 exam 1 Bloss

How do the observed changes in the ALX1 gene and surrounding region of the genome affect the functions of ALX1, and how are these changes in functions postulated to affect the shape of beaks?

Some changes are in the region upstream of the ALX1 gene that controls where in the organism ALX1 is expressed affecting what cells express this transcription factor. Other changes are found in protein coding portion of the gene that controls where ALX1 binds to DNA. These changes would affect which genes would be turned on by ALX1.

What are some of the properties that make an organism a good model organism?

Some properties that make an organism a good model organism include being safe to handle, being relatively compact in size, and being easy to care for. An organism with short life cycles and relatively simple genomes and genetics is also easier to study for many generations. It is also important for an organism to be easy to give to others, so that researchers don't have to breed new strains every time they want to study it, and it is important that there is a community of scientists studying an organism so that the field of study can grow.

Describe how a DNA sequence change in the regulatory region or CRM for a gene might affect the function of a gene.

A change in the regulatory region or CRM of a gene could change how frequently a gene is transcribed or where and when it is transcribed by changing how the regulatory factors of the gene can interact with the gene.

What might be the evolutionary effect of a change in the cis regulatory module of a gene?

A change to the CRM would change where, when, and how much of a gene is expressed. Over evolution, this could change the function of the gene in the species by changing the expression pattern of the gene.

Define a gene or protein family

A group of genes that are highly related in terms of DNA sequence are known as a gene family. Protein families are sets of proteins transcribed from a gene family. Because the members of a family are related in sequence, they are also related in function.

What are some of the disadvantages of using model organisms to understand biological questions?

A major disadvantage of using model organisms to understand biological questions is that even in a background of broad evolutionary conservation, there are certain features of an organism that may not be universal to all organisms, and a researcher may not be aware of all of these. A researcher's findings therefore may not generalize to a population they are interested in applying them to. Also, some of the features that make an organism an ideal model organism may actually make them less typical of other related organisms.

Most temperature-sensitive mutations are missense mutations. Postulate an explanation for this observation.

A missense mutation will change an amino acid, but not stop or destroy the production of the protein that is produced by the gene. The single amino acid change may cause a slight change in the conformation of the proteins so that it does not function quite as well as it usually would. This slight change in functionality may only be noticed when the cell is put under stressful conditions that require it to function at fully capacity to survive.

What are the three categories of chemical components that make up a DNA molecule, and what is one functional importance of each component?

1. Deoxyribose: Provides a backbone to DNA, polarity, and directionality.2. Phosphate: Two phosphates are released to provide energy to link dNTP subunits together, while the third is used to link the units together. Also provides polarity with the deoxyribose. 3. Nucleotide Base: Four bases--adenine, thymine, cytosine, and guanine--encode all of the information in DNA. These vary, and the sequence provides the information content of DNA.

Here is the sequence of a portion of one strand of DNA. 5' GTCCTAACGACTGATCGT 3'a. What is the sequence of the other DNA strand?

3' CAGGATTGCTGACTAGCA 5' or as it more conventionally written 5' ACGATCAGTCGTTAGGAC 3'

Suppose that this is the sequence from the template strand of DNA. What is the corresponding RNA sequence that would be transcribed using this sequence as the template?

5' ACGAUCAGUCGUUAGGAC3' In other words, it is the same as the sequence in part a except that T is replaced by U.

The RNA sequence in part C is made into cDNA. What is the sequence of the first strand of the cDNA that would be made from this gene?

5'GTCCTAACGACTGATCGT 3' Since it is the reverse complement of the RNA in part c, it has the same sequence as the original strand. Since it is DNA, the U's are replaced by T's.

Phenotype:

A physical trait, appearance or biochemical property of an organism that can be observed or measured in some way. Phenotypes are the result of underlying genotypes and environmental influences. Examples include hair color, blood type and height.

A large number of temperature-sensitive DNA replication mutants have been isolated from a bacterium. The mutants are unable to replicate DNA at 42⁰C but can do so at 30⁰C. If the bacteria are grown at 30⁰C for several generations, then the temperature is raised to 42⁰C, two categories of mutants can be distinguished, referred to as "quick-stop" and "slow-stop". Quick-stop mutants stop replicating DNA immediately once the temperature is raised. Slow-stop mutants replicate DNA for a few more minutes after the temperature is raised and then stop. Give one example, with a brief justification, of a specific cell component that could be disabled in a quick-stop mutant and another, similarly justified example of a component that is defective in a slow-stop mutant.

A possible example of a cell component that could be disabled in a quick-stop mutant would be DNA polymerase, which is integral to DNA replication. Primase is also characterized by quick-stop mutations. A possible example of a cell component that could be disabled in a slow-stop mutant would be topiosomerase, which if disable would eventually stop DNA replication as the DNA became too tangled to continue replication. Mutations in DNA ligase also are slow-stop mutations.

How does this affect your view of how biological processes occur?

A process that arises through tinkering will likely share parts with other processes and will likely not be as ideal as a processes designed from scratch.

What might be the evolutionary effect of a change in the coding region of a gene?

A protein with a slightly different amino acid sequence is formed because the sequence of the gene has changed. Over evolution, this could change the function of this gene and the protein made, because the protein now has a different shape and therefore will not have the exact same function as it had before.

A stem cell is a cell that is not currently differentiated into a specific cell type but that retains the capacity to differentiate into different cell types (such as nerve and skin). How does the existence of stem cells help verify your answer to preceding questions?

A stem cell, like all cells, has the same DNA as all cells. However, a stem cell does not express genes and create RNA that are specific to certain types of cells, making it possible for that cell to differentiate into a variety of specific cell types if the genes for that cell type are expressed.

Describe overall what you expect to find when you examine the Hox gene cluster. In other words, what is the approximate number of genes and how do you expect that they will be arranged?

According to Figure B in Box 3-2, there will be about 8 genes, although this may vary by one or two. The amino acid sequence of the protein encoded by the gene at one end of the cluster will be most similar to the Labial protein in Drosophila, while the protein encoded by the gene at the other end will be most similar to the Abd-B protein in Drosophila. The similarities will be found primarily but not exclusively in the region of the protein that binds to DNA, the homeodomain.

Outline the process by which adaptive radiation occurs. What makes a string of islands or lakes an especially good opportunity to observe adaptive radiation?

Adaptive radiation is when a single species diverges over a relatively short period of evolutionary time into multiple distinct but related species, each of which is suited to a distinct environmental niche. This occurs when conditions or morphology change to open up new ecological niches and subsequent rounds of selection eventually lead to multiple distinct lineages that eventually become reproductive isolated from one another. Reproductive isolation means that members of the diverging groups are either unable to breed with each other due to geographic barriers or morphological differences, or are unwilling to breed with each other due to behavioral differences. Islands and lakes are distinct settings that will likely each impose different environmental pressures, thus leading to selection for distinct morphological or behavioral traits. In addition, islands and lake impose geographic reproductive isolation.

Would additional model organisms be helpful? Why or why not?

Additional model organisms might be helpful because new model organisms might have certain characteristics that make them particularly suitable for studying a specific biological process of interest. New model organisms may also be helpful to add in order to understand certain branches of the tree of life that have been previously less well represented in research studies. Many biologists are taking advantage of the well-established model organisms to study related, but less studied organisms, such as using what has been learned about Drosophila melanogaster to study other insects or arthropods.

What important principle, based in part upon model organisms, allowed them to focus on ALX1 as a candidate gene?

All species store their genetic material as DNA, so differences in traits or phenotypes between organisms must correspond to underlying differences in the DNA sequence.

Look at the arrows connecting the five unifying ideas in Figure P.1 in the Prologue. What course in your college experience might emphasize each of these connections? Would any of them not be important in a particular course?

All the five great ideas are highly interconnected and would likely all play a role in any college course, though depending on the course some great ideas would likely play a larger role than others. For example, a course in in biochemistry will probably emphasize that life is based on chemical principles, while a course in development and evolution might emphasize the connection between natural selection and organized systems.

The genomes for many different species, including dozens of different insects, have now been sequenced. The genome of a praying mantis has apparently not yet been sequenced (as far as we can determine). What information can be learned from sequencing a genome from another insect like a praying mantis that might not already be known? You should answer this generally about the rationale for additional genome sequences for any organism, and more specifically about some particular property of the praying mantis that interests you. Feel free to research the biology of the praying mantis; there are about 2400 different species of praying mantis, any of which could be used to answer this question.

Although the genomes of other insects similar to the praying mantis have been sequenced, we don't know the relationship between the praying mantis and those insects without knowing the praying mantis genome. Comparing the genomes can help us refine our understanding of evolutionary relationships; we might find that two insect species are more closely or more distantly related to each other than they appear. Genome sequencing can be more accurate way to ascertain evolutionary relationships than morphological studies. For example, a 2015 study of the genomes of multiple praying mantis species revealed that highly similar forms of camouflage evolved in two separate events in praying mantis. This information caused researchers to identify an entire new genus of praying mantis species. The praying mantis also has a very distinctive morphology, which gives rise to its name. Understanding the genome of mantids and comparing it to insects with a different body plan could provide insights about the evolution of morphological diversity.

Look carefully at Figure B3-9, and look at a picture of a praying mantis, if you are not familiar with their distinctive body types. Ideally, you want to study all of the Hox genes and their targets to understand the distinctive mantis body type. Practically, you might want to start with the gene or genes that you think might be responsible for the most obvious changes.

Although there are many possibilities and evolutionary change is sometimes unpredictable, which Hox genes will be your starting point and why? The most distinctive morphological features of the praying mantis are probably its very large forelegs and its greatly elongated first thoracic segment. These are affected by the Scr gene and protein, so that might be the first one I would look at. Antp is also known to affect these structures, so I would also want to look at that.

Give an example of such evolutionary tinkering, either one that you see in the chapter or one from other information or courses.

An example would be 'tinkering' with the jaw bones in mammals to produce the bones in the middle ear.

Anabolism and Catabolism:

Anabolism refers to chemical reactions in which larger, more complex molecules (macromolecules) are produced from simpler, smaller subunits. Catabolism refers to the breaking down of macromolecules into smaller subunits that can be taken up, recycled, or excreted as necessary. Anabolic reactions generally require energy while catabolic reactions release energy that is often used to power a variety of other processes. As a memory aid, Anabolism Adds or Assembles.

In 1995, Hamilton Smith, Craig Venter and co-workers published the first complete genome sequence of a self-sustaining organism, that of the bacterium Haemophilus influenzae. Analysis of the genome sequence revealed that the organism does not have a gene that could encode a telomerase enzyme. Explain why this is unlikely to have any consequences for the genome of this organism.

Bacteria have circular genome and therefore have no need for telomerase to replicate and regenerate the ends of their DNA.

One of these regions contains the ALX1 gene but the others have not been investigated. Why might be reasons that sequences in these other regions are also fixed?

Beak shape will not be the only fixed trait that differs between the species. Because the bird species live in different habitats and eat different diets, there will be traits in the species that are selected for in these specific niches. These traits will also be fixed.

A fourth oligonucleotide is used in a different tube in a similar experiment with the same concentration and the same amount of genomic DNA. The results are shown below, with the results from primers A and B included for comparison. How can you explain this result? (HINT: Knowing the sequence of this oligonucleotide would not be useful in answering this question, unless you also knew the sequence of the genomic DNA.)

Because the oligonucleotide is annealing to its targets much more quickly than either A or B, it must have many more copies of the target. This was early evidence that eukaryotic genomes contain repetitive sequences, that is, sequences present many thousands of times.

What is an example of a phenotype (from humans or other organisms) that is primarily, if not entirely, affected by the genes?

Blood type.

The same gene is transcribed at different levels and at different times and locations in two different individuals of a species.

Changing the level, time, or location of transcription can alter the morphology and behavior of the organism. This would probably be due to a difference in the sequence of the cis regulatory module. The difference in transcription level, time and location could create different phenotypes. If one phenotype makes an individual more fit relative to other individuals, then this DNA sequence will increase in frequency in the individuals of the next generation.

Define and compare the terms chromatin, heterochromatin, and euchromatin.

Chromatin is the complex of DNA with associated proteins and RNA molecules that comprise the structure of the eukaryotic chromosome. Chromatin is essential for the packaging of DNA into the tiny space of the nucleus. Heterochromatin stains more intensely than euchromatin due to its denser packing. Most genes are in the euchromatin, which is more accessible to transcription and DNA replication since it is less densely packed.

What might be some of the ways that you could determine the relative contributions of genes and the environment to a particular phenotype?

Compare the same phenotype in closely related individuals, particularly if those individuals grew up in different environments. In humans, identical twins adopted at birth into different families have given us significant insights into the inheritance of many traits and diseases. Conversely, you can look at individuals from the same genetic population who have moved to different environments or cultures, such as comparing a disease risk in Japanese-Americans with the risk in those living in Japan.

Which oligonucleotide yields reannealing curve A, and which one gives reannealing curve B? Explain your reasoning. Oligo 1: 5' CGCTAGGATCGAACCATACTCGGAC 3' Oligo 2: 5' CATAGAATTTACGCATACCTAAGAT 3'

Curve B reanneals faster than curve A under the same conditions. This indicates that that either the oligonucleotide is shorter, or that it has a higher percent of adenine and thymine in its composition than curve A, because adenine and thymine reanneal more quickly than cytosine and guanine due to the bases only having two bonds between them instead of three. Both oligonucleotides are of the same length, but oligo 2 has a higher concentration of A and T bases, so it will reanneal more quickly, just like curve B.

Briefly describe how the specificity of the base pairs has been used for different lab techniques.

DNA hybridization relies on the specificity of base pairs to allow single-strands of DNA (or RNA) to anneal to other strands in a variety of lab techniques. Base pair specificity makes it possible to break double strands of DNA apart and then use each half of the strand to create two new strands that look exactly alike. It also makes it possible to separate out specific DNA sequences by creating "tags" that will only bind to specific sequences of DNA or RNA These "tags" are called oligonucleotides, and are short sequences of DNA that can be used to find specific sequences of DNA or RNA that contain the complementary sequence to the oligonucleotide.

DNA polymerases and RNA polymerases carry out fundamentally similar reactions, albeit with different nucleotides for their substrates. Yet RNA polymerase can initiate the reaction without a primer whereas DNA polymerase cannot. Why is this an important distinction between the two types of polymerases?

DNA polymerase cannot replicate DNA without primase, a relative of RNA polymerases, to initiate replication, whereas RNA polymerase can initiate replication of RNA on its own without being dependent on another polymerase to start the process.

What is one practical reason to be aware that Taq is an error-prone polymerase when working with PCR fragments?

DNA products produced by Taq have a higher rate of errors. When PCR is used to amplify DNA for sequencing (a very common application), some of the changes in the sequence may be Taq errors rather than naturally occurring mutations.

How does the process of DNA replication explain Darwin's principle of "descent with modification"?

DNA replication and repair allow for DNA to be copied and passed onto the next generation (descent) while also leaving a small amount of room for error, which can create new genomic variation. Mutations and new genetic variation in a gamete cause it to have a different DNA sequence than that of the parent. These slight alterations in DNA can sometimes cause slight alterations in the phenotype of the offspring, and these are the "modifications."

Outline an experimental strategy that could be used to distinguish passenger from driver mutations in later stage tumor cells.

Driver mutations are responsible for transformation from normal to unregulated growth. They tend to be mutated genes (oncogenes or tumor suppressor genes) that are common to different types of cancer, or particularly common in one type of cancer. Passenger mutations are other mutations that arise as the cell divides. They tend to affect a more variable set of genes when different types of cancer are compared. A potential strategy would be to compare the DNA of the tumor to multiple other tumors of the same type and of different types. Mutations only common among tumors of the same type or common amongst multiple types of cancer are more likely to be driver mutations, while mutations that are more variable between tumors of the same type or between different types are more likely to be passenger mutations.

Bacterial and eukaryotic cells:

Eukaryotic cells have an internal, membrane-bound nucleus that separates DNA from the cytoplasm. In contrast, the DNA of bacterial cells is housed in the cytoplasm. Both eukaryotic and bacterial cells contain DNA, RNA, and ribosomes. In addition, eukaryotic cells contain mitochondria and plant cells also contain chloroplasts.

Define what "error prone" means.

Error prone means that the polymerase lacks the 3' exonuclease activity and cannot proofread its work and change any mistakes that it makes while it is replicating the DNA.

Describe the process of evolution by natural selection. What are the two key facts (highlighted in this chapter) and the inference that Darwin drew from these facts?

Evolution by natural selection is a process through which traits that are favorable to survival and reproduction accumulate in a population over time. Some variants of a species are more fit, so will leave more offspring. This variation is heritable, so the next generation has a higher number of individuals of the variant that is more fit. Two key facts from which Darwin inferred evolution by natural selection are that 1) individuals vary in the number of offspring that they leave (fitness), and 2) differences in fitness are heritable. From these two observations Darwin inferred that certain traits will increase in frequency over time while other traits will decrease in frequency or even disappear.

How does the recognition that mutations arise at random with respect to fitness affect our view of evolutionary change?

Evolutionary change stems from a random process--mutations--but is not random in the direction it takes. Variation does not occur in response to environmental pressures. Instead, mutations arise completely randomly, and while a few may be selected for, many will be disadvantageous and will be selected against. Organisms cannot "respond" to their environments by creating helpful mutations. Instead, the adaptation of a species to an environment is dependent on whatever mutations happen to occur. All changes that are passed on from generation to generation are passed on because the organisms that carry them have survived and reproduced (they are fit) in the environment they live in. Therefore, random advantageous mutations tend to stay within a population, while disadvantageous mutations are usually do not persist in a population.

3'-5' exonuclease activity

Exonuclease activity refers to the ability of an enzyme (a nuclease) to digest DNA from the ends (exo-). Many polymerases in DNA replication "check" the distance between the old DNA strand and the new strand being synthesized. If the enzyme senses a bulge in the strand, it can go back and remove the improperly paired nucleotide to create the opportunity for inserting the correct base. This type of exonuclease activity is called 3'-5' exonuclease activity because the nucleotides are removed from the 3' end of the growing replicated strand by DNA polymerase. 3'-5' exonuclease activity stops mistakes from being made during replication by giving DNA polymerase the ability to remove any mispaired bases it senses.

How have cells carried out this experimentation?

Experimentation is carried out through random mutation. Mutations result in an altered DNA sequence and this can result in an altered RNA or protein product of the gene, which can lead to a change in the function of the gene. Keep in mind that mutation and evolution do not proceed towards a particular end goal. Rather, random events occur that are either favorable or unfavorable to the cell and are therefore selected for (those carrying the change survive and reproduce more successfully) or against.

Explain, in your own words, Darwin's statement about how the principle of inheritance betrays the original birthplace of a species or a group of species. What are some other examples of this idea?

Genetic information and the traits controlled by genes are inherited from one generation to the next. This means that while differences in some characteristics are selected for to suit a new environment, other characteristics still resemble the original ancestor. For example, though there are differences between finch species on the Galapagos Islands and South America, the species in both locations still look quite similar which 'betrays the original birthplace' of the Galapagos finch species as being from the main land of South America.

What is an example of a phenotype (from humans or other organisms) that is primarily, if not entirely, affected by the environment?

Genetics plays a significant role in most phenotypes but hair length is likely to be primarily influenced by cultural factors. Tattoos, piercings, and scars from previous injuries or surgeries have no genetic basis.

Discuss how it has been important to the evolution of species that biological processes which reduce the size of a genome are less efficient than those which increase the size of the genome. What parts of the sweater analogy are most helpful in thinking about genome evolution and which parts are the less helpful or least applicable?

Genomes contain many elements (genes) that are not currently in use by the organism. However, as the environment changes and new selective pressures arise, these genes may suddenly become useful. These genes can be thought of as old sweaters that you never wear but may once in a while be brought out for ugly sweater party or an extremely cold day. These sweaters may crowd the closet just as unused genes increase the amount of energy required to replicate the genome, but it is more efficient to keep them, as they may one day be beneficial. The sweater metaphor can be tied into the metaphor of evolution as tinkering, since it is easier to tinker and create something valuable when there are more pieces available. Randomly deleting information from the genome also has the potential to be more damaging than randomly adding information. A mechanism that reduced the genome, if it ever arose, would be selected against, so that the individuals who survived to reproduce would pass on genomes without a reduction mechanism. The part of the sweater analogy referring to unused sweaters getting damaged is not as applicable, as these altered genes may serve a new function if the environment changes.

He learns that he can reconstitute the same chromatin structure even if he leaves out one component. Which component could he leave out? (In other words, which of these components is missing when the structure in Part A is assembled?)

He can leave out H1, because it isn't part of nucleosome structure.

(Challenging) It is possible to use "high fidelity" polymerases such as Pfu or Tth in PCR reactions rather than Taq. Most high fidelity polyermases, however, require longer than Taq to complete the elongation step in PCR. Why is that?

High fidelity polymerases stop to excise and replace mismatched bases when elongating strands during PCR, which takes more time than using non-proofreading polymerases such as Taq.

Once the genome has been sequenced and assembled, what are the next steps in determining the locations and functions of genes?

Identify all of the stop codons and the open reading frames. This can be done computationally, and all six reading frames (three on each strand) need to be examined. Still working on the computer, the longest open reading frames should be translated into amino acid sequences, and these compared against the database of known proteins. This will annotate many of the genes and give some idea about the function of the protein that each encodes. One should also isolate RNA (in bulk) from a culture of bacteria, make that into cDNA, and sequence it. Those sequences can be aligned with the sequence of the genome to identify additional genes etc. that might have been missed computationally.

Why might cancer biologists want to be able to distinguish driver from passenger mutations?

If cancer biologists can focus on driver mutations instead of passenger mutations, they can focus on stopping the primary causes of cancer across many people instead of coming up with treatments that will only work for a few people who happen to have the same secondary mutations. As it turns out, some passenger mutations are necessary for the cancer to become metastatic and can provide somewhat better targets for chemotherapy than driver mutations. So it is helpful to know both types.

You make a mutation in a DNA sequence from a mouse and re-introduce that mutated piece of DNA back into the mouse, replacing the DNA that was already present. (The experimental procedures by which these techniques are done in mice go beyond the scope of this book but this kind of experiment is feasible.) The mouse with the mutated DNA sequence looks exactly the same as a mouse with the original DNA sequence. List all of the explanations for why this particular mutation may not have had a functional effect on the mouse.

If the DNA is not known to be from a region that is transcribed, then it may simply be in a region of the genome that is not expressed. If the region is transcribed, then some other explanations might be needed. One explanation is redundancy or a gene family--there may be multiple genes that code for the same protein, so if you knocked one out, there would another gene that could code for a protein with the same function. Another explanation is robustness--the gene may have coded for a polypeptide that was involved in a process that could be carried out another way, possibly with a different group of proteins. The gene might also have coded for a protein that didn't do anything that had an obvious phenotype under the conditions you are using in the laboratory.

Is the non-chromosomal genome essential or dispensable?

In some bacteria the non-chromosomal genome may be dispensable. However, the genes in the mitochondria and chloroplasts are necessary for each organelle to function. Therefore, without the genes of the mitochondria, cellular respiration could not occur and without the genes of the chloroplasts, photosynthesis could not occur. Thus, these non-chromosomal genes are indispensable.

Ethidium bromide inserts between the base pairs

Indel in which bases are inserted or deleted

Explain why the investigators thought it necessary to root the tree with strains isolated prior to 1920 even though the strain of interest was isolated in 2010.

Investigators were interested in the evolutionary relationships between the Haitian cholera strain and strains all over the world. To get the relationships between these things, you need a common ancestor. Therefore, looking back as far as the 1920s is a good idea, since that will be most likely to give you a common ancestor. The root of a phylogenetic tree should be old enough that it is a common ancestor to all of the organisms being compared on the tree so that it can be used to determine the order of evolution of the branches of the tree. From there, you can see how each strain evolved from the common ancestor. Trees show evolutionary time and evolutionary relationships, and can tell you which strains are most closely related.

Suppose that chromosome III from a worm from nature was sequenced and compared to the sequence of the laboratory strain. Approximately how many base pair changes would you expect to see, and why? What other types of genetic changes in the sequences might you see when comparing a natural isolate of C. elegans with the laboratory standard strain?

It is hard to know for sure, but the differences could be extensive between a laboratory strain and a natural isolate. It would not be surprising if 10% or more of the base sequences are different between them; these changes may be clustered in the portions of the chromosome that do not encode genes, but there will definitely be some in the protein-coding portion of genes. In addition to single nucleotide changes, there will be indels of various sizes, and there may be expansions or contractions of a gene family. The transposable elements will definitely be different in both number and location.

Other studies had implicated the BMP4 gene as being important in the shape of birds' beaks, but BMP4 was not among the candidate genes identified here. Speculate about why BMP4 was not found in these studies.

It is possible that BMP4 plays an important role in beak formation that is conserved between the two species, so significant changes in BMP4 are not compatible with life. This study was designed to identify only those components that vary between the two species.

The changes in the ALX1 gene alter its function but do not eliminate its function. Hypothesize why changes that would eliminate the function of ALX1 were not found.

It is possible that function of ALX1 is absolutely critical for beak formation so removing the function completely would be deleterious or lethal, but slight differences in how the gene is used may contribute to differences in beak morphology. Another possibility is that the, like many genes in the genome, ALX1plays a role in another vital process, other than beak formation, such that loss of function would be deleterious or lethal for that reason.

It is now possible to know the entire DNA sequence of an organism, and it is feasible to predict all of its genes. What are some of the ways that this has changed the ways that we can analyze biological questions?

Knowing the genome sequence and being able to predict all the encoded genes means we can sometimes know all the component parts to a system or biological process of interest. This makes it more feasible to analyze how these components are interacting with one another or changing in different scenarios. For example, when a biological signal is sent what happens to all the other components of the signaling pathway upon receipt of the signal? This approach also allows us to look at biological processes more holistically (rather than focusing in on one or two components that happened to be known) leading to a better understanding of processes at a systems level. Knowledge of genome sequences can also give deeper insight into relationships between organisms. By comparing the genomes of species, biologists can trace the diversification of species and identify common ancestors and closely related species with much higher accuracy. In addition, Reference genomes allow researchers to pinpoint mutations within a genome and sometimes predict what gene the mutation is affecting. This has powerful applications for the study and treatment of genetic disorders. In addition, knowing the sequence of an entire genome helps us compare which genes are the same and which are not from one species to another, or even one individual to another. We can therefore think of an organism's traits in terms of nucleotide sequences, which helps us determine the basis of those traits. Researchers can pinpoint mutations within a genome and sometimes predict what gene the mutation is affecting. This has powerful applications for the study and treatment of genetic disorders.

Explain what this means.

Max Delbruck uses the word "experimentation" to describe random mutations that affect the fitness of an organism. Sometimes "experimentation" fails when a mutation results in the decreased fitness or death of the organism. However, a mutation that increases the fitness of an organism is carried on through subsequent generations can be thought of as a successful experiment. We can see the 'results' of such an experiment as changes that persist across generations in the DNA sequence of cell. The cells that exist are the variations or the experimental outcomes of all of the ones that might have one existed but did not survive as well.

Were Mendel's peas (introduced in Chapter 5) an example of a model organism? Explain your reasoning.

Mendel's peas were an example of a model organism because they were used as a relatively convenient way to determine principles of genetic inheritance that apply more broadly to other organisms.

Explain the results they observed after two rounds of replication in N14 media.

Meselson-Stahl found that after two rounds of replication half of the DNA was only of the N14 density, while the other half was of the intermediate density. This was because after the first round of replication where all of the DNA was intermediate density because it was all created from a N15 density old strand and an N14 density new strand, the two strands separated during the next round of replication and an N14 strand was added to both old strands, making some strands of intermediate density and some of N14 density. Thus, they see one band with DNA at intermediate density and then low density bands with the only N14 DNA.

Annotation of metazoan genomes is also more complicated that annotation of bacterial genomes. List some of the challenges encountered in annotation in metazoans that are not encountered with bacteria.

Metazoans may have families of genes that will have similar DNA sequences so a given sequence might align in more places in the genome. Because less of the genome is devoted to protein-coding genes, more extensive work needs to be done to isolate RNA from multiple tissues and at different times. mRNAs are also spliced, and the splicing pattern can be different in different tissues or times, which needs to be examined.

What would be distinctive about the inheritance pattern of such a mutation?

Mitochondria are inherited from the mother only. Therefore, in a family in which the father has a mutation in the mitochondria, none of his offspring would have the mutant phenotype. In contrast, in a family in which the mother has a mitochondrial mutation, all of her offspring would have the mutant phenotype.

Briefly explain why that might be true.

Model organisms tend to be very inbred, so there are few differences in their DNA sequences. Both C. elegans and Arabidopsis can reproduce by self-fertilization, which makes them homozygous at most locations in the genome.

The sequencing robot used has an average sequence length of 300 bp. The bacterium is estimated to have a genome of 5 Mbp. What is the minimum number of sequences that must be assembled to have the complete genome sequence for this bacterium? Assume that an overlap of 30 base pairs is needed at each end to make the assembly.

More than 21,000

How does DNA replication in bacteria differ from DNA replication in eukaryotes?

Most bacteria have a circular chromosome, so unlike eukaryotes, they don't have a specialized mechanism for replicating the end of the chromosome - they just start synthesizing at the replication fork and synthesize around a circle. Most bacteria have a single origin of replication, and replication progresses in both directions around the circle. Eukaryotes have many origins of replication so that replication can happen as quickly as it needs to for these larger genomes. In bacteria, DNA replication is mostly done by DNA polymerase III. In eukaryotes, different polymerases are used at different times. Bacteria also have different checkpoints in the cell cycle than eukaryotes do.

What would you predict might be a phenotypic effect of a mutation that affects a mitochondrial gene?

Most of the genes affecting mitochondrial structure and function are in the nuclear DNA, however 37 genes are found in the mitochondria themselves. Many of these are necessary for process of oxidative phosphorylation, which generates energy. This means that a mutation in the mitochondrial DNA would affect oxidative phosphorylation, perhaps decreasing the efficiency of the process. Therefore a mutation in the mitochondria might affect the ability of a cell to produce ATP.

Shotgun assembly is more complicated for a metazoan (that is, a multicellular organism) genome than in bacteria. List some of the factors that make genome assembly more difficult in metazoans.

Multicellular organisms have many more repeated elements, their genomes are larger, and less of the genome is devoted to protein coding genes. Since metazoans have multiple chromosomes, genome assembly is more complex.

5-bromouracil (BrdU) is incorporated into DNA in place of thymine

No mutation is predicted because both thymine and uracil both pair with adenine. In reality, BrdU pairs more often with G than does either T or U, so some transition mutations from T;A to C:G arise.

Is it possible to determine if this sequence is from the template strand or from the coding strand? Why or why not?

No, this can only be determined when RNA is being transcribed, because the template strand is the strand from which the RNA is transcribed and the coding strand is the one that matches the RNA sequence (except for the replacement of T for U).

A third oligonucleotide is used in a different tube in a similar experiment, with the same concentration and the same amount of genomic DNA. The sequence of this oligonucleotide is shown below. However, its reannealing curve is completely different since it immediately forms double-stranded DNA as soon as the cooling step begins. Explain what is occurring with this oligonucleotide and why it could not be used for further experiments. 5' TACGTACGTACGCGTACGTACGTA 3'

Notice that the sequences at the ends of this oligonucleotide are reverse complements of each other. This oligonucleotide can anneal to itself, because it is its own complementary sequence. Therefore, it will bond to the excess of itself immediately instead of bonding to the genomic DNA.

Monomer subunits assembled into biologically important macromolecules:

Nucleotide bases make up DNA, sugars make up carbohydrates, amino acids make up polypeptides, and fatty acids make up lipids.

In which organelles is DNA found in eukaryotes?

Nucleus, mitochondria, chloroplasts

Okazaki fragment

Okazaki fragments are the short sequences of DNA that are synthesized one at a time as part of the lagging strand to make it possible to synthesize this strand. DNA can only be synthesized 5' to 3', so while one strand (the leading strand) can be synthesized toward the replication fork as it opens, the other strand (the lagging strand) has to be synthesized away from it in fragments.

Design an experimental strategy that would allow an investigator to determine if the codons in mRNA are overlapping or non-overlapping in sequence. You do not need to describe how the experiment would be done, but you should imagine a simple approach and the expected outcomes that could distinguish between the alternative possibilities.

One potential experiment would be to remove a base from the front and seeing whether the protein product contains the majority of the same amino acids or not. If most of the amino acids are the same, then the codons probably overlap. If most of the amino acids are different, then the reading frame has changed and the codons must not overlap.

What are some of the concepts and assumptions illustrated in a phylogenetic tree?

Phylogenetic trees represent genetic changes between organisms over time. Phylogenetic trees are based on the idea that that organisms evolved from common ancestors, and that the divergence of multiple species from a common ancestor is the result of DNA changes in each species that differentiate it from the ancestor. It is assumed that the more differences that are observed between the base sequences of two species, the more time has passed since those species diverged from a common ancestor. In the most basic types of phylogenetic trees the rate of mutation is assumed to be constant, so that the number of base changes corresponds linearly to the amount of time that has passed since those species diverged. Phylogenetic trees also usually use the DNA sequence of one member of a species to represent the entire species, even though not all members of a species have the exact same DNA sequence. Overall, organisms that are more closely related will have DNA that is more similar and will be positioned closer together on the phylogenetic tree. A tree can be used to infer evolutionary relationships between organisms and the order in which organisms have evolved from a common ancestor.

What are functions that are encoded by non-chromosomal genes?

Plasmids sometimes contain genes that give bacteria antibiotic resistance, pathogenicity, or the ability to metabolize unusual substrates. The genes found in the mitochondria and chloroplasts are necessary for the processes of cellular respiration and photosynthesis, respectively.

(Looking ahead) In addition to natural selection, what other processes have an impact on the genetic structures of populations?

Population size, non-random mating, mutation, and migration of populations can all impact the genetic structure of populations. While these concepts will be developed more fully in later chapters, these make some intuitive sense. If the population is very small, its genetic structure is more subject to random fluctuations. If individuals have a mate preference, if new mutations arise, or if individuals move into or out of the population, the genetic structure can change.

Primase

Primase initiates DNA replication by making a short RNA primer complementary to each DNA strand to give DNA polymerase an existing chain to start adding bases. DNA polymerase can only add bases to an existing chain, not start a new chain --it has to have a 3' end to add onto. Primase is related to RNA polymerases and can start synthesizing without a 3' end, so it lays down an RNA primer that DNA polymerase extends.

What are some of these changes that modified an arrow or added an arrow?

RNA can transcribe DNA through reverse transcription.Both polypeptides and RNA play a role in the creation of phenotypes, along with environmental factors.

(Challenging) Why are relatively few changes observed in the core promoter region of a gene?

RNA polymerase is used to transcribe all genes (although there are different types of RNA polymerase) so it must be able to recognize highly similar sequences at the core promoter. Thus, the core promoter of a gene must remain consistent because RNA polymerase must be able to bind to this site, regardless of the gene in question. If the core promoter changes, this cannot happen and the gene cannot be transcribed normally, not matter what the rest of the promoter or the gene looks like.

Many of the techniques that use the specificity of the base pairs in part B for hybridization can be performed at different temperatures, which affect the results. What happens if temperature for hybridization is raised slightly? What happens if the temperature for hybridization is lowered?

Raising the temperature of hybridization slightly decreases the chance of a mismatch between an oligonucleotide probe and the DNA sequence. If the temperature is raised high enough the two strands cannot pair at all. Lowering the temperature slightly increases the chance of a mismatch.

Define redundancy and robustness, and give an example of each.

Redundancy means having more than one version of the same information. Two genes that perform the same function are redundant. Gene families are an example of redundancy, since multiple genes perform a similar function. The fact that more multiple codons code for the same amino acid is also an example of redundancy. Robustness refers to situations in which a change in one component of a system does not lead to changes in overall function. In biology this often means that an alternative pathway can be used to achieve the same objective. The circulatory system is robust, because there are many different paths that blood can take to reach a particular part of the body. There are also often many molecular pathways to carry out a particular process, so that if one gene or protein product gets deleted, there are other ways the process can be completed.

Guanine is the base most susceptible to depurination. Meyer et al noted that, compared to traditional double-stranded sequencing library preparation, their method was particularly valuable for obtaining sequence of relatively G+C rich DNA. Provide a plausible explanation for why this might be the case

Sequences that have experienced depurination are most likely to be the points where the DNA has been fragmented and the overhangs have been created. This procedure makes it possible to sequence the G+C rich overhangs, where previous procedures required them to be removed.

What is meant by the strength of selection, and how does this affect a population?

Strength of selection refers to the rate at which changes in the frequency of a particular allele or genotype occur. The strength of selection determines how quickly a population will change, resulting in adaptation, speciation, or the disappearance of certain characteristics. If strength of selection is strong, the change occurs more quickly than if the trait is under weak selection. The direction of selection refers to whether the alleles are increasing or decreasing in frequency. Positive selection means the frequency of the allele increases, while negative selection means the frequency of the allele decreases.

Telomerase

Telomerase solves the problem of DNA end replication and degradation by continually adding short, repeated sequences to the ends of linear chromosomes when they are replicated. In organisms with linear chromosomes, there has to be a primer at the very end of a chromosome to allow for the synthesis of the very last lagging strand. Once this primer is removed, there is a gap that DNA polymerase cannot fill in. Telomerase uses a built-in RNA primer to extend the end of the chromosome with a repeating base pattern. This pattern doesn't encode useful information--that's the point. It extends the end of the chromosome to place the gap further down in the midst of information that does encode any functions, so that important information on the chromosome won't be lost by a gap.

What does this imply about the common perception that evolution by natural selection produces a "better" organism or system?

The 'tinkering' view implies that organisms will not necessarily be 'the best' just better in a particular situation than they were before.

Why is the Central Dogma so "central" to Biology?

The Central Dogma is so important conveys the idea about information flow from DNA to phenotypes, which underlies inheritance. The transcription of DNA to RNA and then the translation of RNA to polypeptide is the basis of Biology and biological processes.

How would the DNA sequence of a skin cell be different from the DNA of a nerve cell?

The DNA sequence of a skin cell and a nerve cell would not be different. All cells within an organism have the same DNA.

Do the data more closely support the Ocean perturbation or the UN peace-keeper hypothesis and why?

The Haitian strains are most likely from the UN peace-keepers because the tree shows that the strains are most closely related to strains from Asia--specifically Bangladesh, which supports that the Haitian strains evolved from the Bangladesh strains.

What characteristic features of the sequences of the genes (and their predicted protein products) will help you find the Hox gene cluster in the praying mantis genome?

The Hox genes are a distinct class of transcription factors, so you can recognize these genes by the amino acid sequences of the proteins they encode

ALX1 is a transcription factor in the Paired family. Explain what this means.

The Paired family was named for the "Paired" gene in Drosophila, and ALX1 is similar enough in amino acid sequence to Paired that it is regarded as having shared a common ancestor. This family is a group of transcription factors, known to bind to DNA and regulate transcription. The similarity to Paired is found in the amino acid sequence that binds to DNA, and may not extend to other parts of the protein. This gene is a finch ortholog of the Paired gene in Drosophila since the protein produced has high similarity to the protein produced by the gene in flies.

How would the RNA isolated from a skin cell and a nerve cell be different?

The RNA of each type of cell would only be made of the genes that were transcribed and used in that cell. Therefore, a skin cell and a nerve cell may have very different RNA expression profiles even if they are in the same organism.

How have technological and scientific advances in the past 20 years allowed us to explore this statement more fully?

The ability to sequence genomes and compare genome sequences has allowed us to track the history of genetic changes and follow the course of the evolutionary 'experimentation'. Technological advances in genome editing and transgenics have also made it possible for scientists to test the effects of individual DNA changes.

Why is a single-stranded adapter of known sequence required in this protocol?

The adapter sequence must be known so that when the DNA is sequenced, it will be possible to tell where the adapter ends and the DNA being sequenced begins.

Compare and contrast the advantages of each approach.

The advantage of this method is that it allowed the investigators to identify genes that might be important for beak shape, even if their role in beak morphology was not already known. The disadvantage was that the approach identifies many genes that need to be evaluated for potential roles in beak morphology. The investigators did not begin by directly at genes already known to affect beak formation and testing those genes for variation between species, which is another possible approach. The advantage of this alternate approach is that it focuses on genes that are already known to be important for beak shape, which saves time. The disadvantage of this approach is that we aren't completely sure that all the genes involved in specifying a specific trait have already been identified and we aren't sure which are likely to be the most important in species differences. This other approach would therefore not allow investigators to identify new genes that could be involved but were previously not implicated.

alpha-actinin is a gene family in humans with four paralogs. Using on-line resources, try to determine what is known about some of the fundamental properties of each of the four members of this gene family? That is, how have the functions of the four paralogs diverged from each other (or have they)? What is unusual about alpha-actinin-3 in humans?

The alpha actinin genes encode cytoskeleton proteins that can bind to actin as part of microfilaments in both muscle and non-muscle cells. There are four proteins in the family. Alpha actinin 1 is an essential component of the cytoskeleton and is expressed in muscle and non-muscle cells to anchor various structures to each other. Alpha actinin 4 is also a non-muscle isoform, and may be involved in metastatic processes, as well as being involved in some kidney functions. The alpha actinin-2 and -3 isoforms are expressed specifically in muscles. Alpha actinin 2 functions to crosslink actin and titin molecules in both cardiac and non-cardiac muscle, and is a necessary component for the functions of these muscle cells. Alpha actinin-3 is expressed only in fast twitch muscle cells where it anchors actin filaments in muscle tissue. Alpha-actinin-3 is specifically associated with rapid contractions and recovery, and is sometimes called the "sprinter gene". About half or more people have a form of the gene that encodes a functional protein; while between 25-50% of people have a form of that gene that does not make a functional protein. Extensive studies have shown that people with the functional form of the gene are better at activities that require rapid, strong muscle activities, such as sprinting, weight-lifting, and so on. People with the non-functional form of the gene are better at activities that require endurance, such as long-distance running. Essentially all Olympians in strength sports have the functional form of the gene, whereas nearly all Olympians in endurance sports have the non-functional form of the gene.

What are the differences in the organization of the genome within a bacterial and eukaryotic cell? How might the differences in cellular organization of the genome affect some of the basic processes of gene expression and transmission?

The bacterial genome is generally a single, large DNA molecule in the cytoplasm of the bacterial cell, and is usually circular and super coiled for space efficiency. Bacteria must keep their DNA molecule relatively small, due to the confined space of the cell, which could limit the robustness of its genome or its complexity. Some bacteria also contain small, circular molecules of DNA known as plasmids. Bacteria do not have introns, and translate mRNA as it is transcribed. This means they have fewer regulatory mechanisms. They also do not diversify the protein products they make via alternate splicing.In contrast, eukaryotic cells usually have multiple DNA molecules organized into linear chromosomes contained within a membrane-bound nucleus. While the nucleus gives the eukaryotic genome a protected environment, gene expression requires transport of genetic information in the form of RNA into the cytoplasm. Having multiple chromosomes requires mechanisms for ensuring that copies of each are transmitted to the next generation.

What is an expression profile?

The catalogue of transcripts or mRNA made by a cell at the time/stage of life that the cell is in when the profile is taken.

The Five Great Ideas Of Biology:

The cell as the basic unit of living systems: Organisms are made up of cells, so many life processes can be thought of in a cellular context. Cells and cellular processes like cell division and the cell cycle are highly structured. There are three types of cells: eukaryotes, archae, and bacteria. The gene as a unit of heredity: The genetic information used as a blueprint for all organisms is stored in their DNA. This information can be passed from one organism to another, but an organism's genetic material may not be identical to that of its parents. Life as chemistry: Chemical processes underlie biological processes. These processes may be anabolic or catabolic. In anabolic processes, there can be information stored in the way subunits are assembled. For example, the order of nucleotide bases in a strand of DNA is very important for carrying genetic information. The expression of genetic material also involves chemical processes like transcription and translation. Biology as an organized system or set of organized systems: There are many different processes that work together in a living organism. These may be minute processes on the cellular level, such as the expression of DNA, or processes that involve many components working together, such as the circulatory system. Evolution by natural selection: This explains how organisms arose. The process of Natural Selections works with variations arising by chance and those individuals that are most fit (best able to survive and reproduce compared to others) being selected for and becoming better represented in subsequent generations. The history of an organism's evolution is reflected in its DNA.

Suppose these dog genomes were compared to the genome of a wolf. What types of differences might be encountered, and how might this be different than what is seen by comparing two breeds of dogs?

The cocker spaniel and greyhound are more closely related to each other than either breed is to a wolf. Therefore, the genome of the wolf would be expected to be more distinct from each dog breed than the two dog breeds are from each other. These differences would include novel genes in one of the species (compared to the other) and variation in regulatory sequences, splicing patterns, and gene number. It is likely that some gene families have expanded or contracted when dogs and wolves are compared, and likely that some genes are spliced differently when the mRNA is made.

Genome:

The complete complement of genetic material of an organism. The genome consists of DNA, or RNA for some viruses, and includes both the coding sequence of genes and other non-coding regions.

Do the data effectively rule out either hypothesis? Why or why not?

The data does not totally rule out either hypothesis because there is still the possibility that the Haitian strains are more closely related to a different strain from the Americas that was not put onto this phylogenetic tree. The strain that is most closely related to the Haitian strains is from 2002, leaving ample time for that strain to have been previously transmitted to South America and then left to evolve into the current strains over the next 8 years.

Explain the concept that the function of a macromolecule is affected by its structure (that is, the shape and sequence of monomer subunits). How does this important concept play out in the evolution of biological systems?

The function of a macromolecule is a physical process so the physical properties of the molecule (shape, charge, composition of the subunits etc) will likely influence the function. This means that over the course of evolution, small random changes in the underlying DNA (which encodes the RNA, which encodes the amino acid subunits) can lead to alterations of the function of a molecule. If the changes are favorable they will be selected for and if they are disadvantageous they will be selected against. Ultimately, this will lead to changes in the system that the molecule functions within.

Describe how a DNA sequence change in the coding region of a gene might affect the function of the gene.

The gene may end up encoding a polypeptide with different amino acids because of the changes in the sequence. This change in amino acid sequence could change how well the polypeptide functions, what other macromolecules it interacts with, and so on.

What part of the structure of a chromosome do you think he was able to reconstitute? Describe this structure in as much detail as you can.

The graduate student could mix the DNA with H2A, H2B, H3 and H4. Under the appropriate salt conditions, these molecules will make a nucleosome because these four core histone proteins are so highly conserved. The nucleosome has 146 base pairs of DNA wrapped around two molecules of each of these core histones. To make chromatin fiber, you need H1 and other proteins, so without these proteins, connecting the nucleosome beads together to make chromatin might be difficult. H1 is also more variable, so H1 from humans might not work to make chromatin in Arabidopsis.

Two other models for template-directed replication were considered as alternatives to semi-conservative replication. One of these was conservative replication in which the parental strands were unpaired, replicated, then re-annealed such that the parental strands stayed together and the newly synthesized strands were together. The second model was dispersive replication, in which the one strand was used as the template for polymerization, then polymerase switched to using the other strand as the template, and subsequently switched back and forth between the two strands until both were fully replicated. Each of these models is ruled out by one of your results from Part A. Which results from Part A rule out these alternative models? (HINT: Different results from Part A rule out different models.)

The intermediate density DNA after the first replication rules out the conservative model of replication because in this model all DNA would either be of the N14 density or the N15 density, and there would be no strands of DNA made of both densities. However, this does not rule out the dispersive model as this model would have also created all intermediate density DNA after the first replication. This model is ruled out by the second replication. The dispersive model predicts that DNA created during the second replication would have had a density in between the intermediate density and the N14 density as more low density new bases would be added. The results of the second replication showed no DNA of this density in between the N14 density and the intermediate density, ruling out the dispersive model as an option for replication.

Outline how they did this.

The investigators chose species that were closely related overall, as indicated by extent of DNA sequence similarity, but had different beak shapes as a fixed trait in each species. Of those species, they chose two with different beaks that were most genetically similar otherwise to increase the likelihood that DNA differences they observed would relate to beak differences. They looked for regions of the genome that were different between species, but that had only two variants, each of which correlated with either a blunt or pointed beak - since they knew the traits were fixed in both species they knew they were looking for variations that were between but not within the species. From there, they located all the genes in the identified regions. They then chose to focus on genes that were most likely to be involved in craniofacial development (based on predicted functions, known information or details from other species), since it was most productive to analyze these genes first, even though other genes might have been involved.

Explain how searching for regions of finch genomes that were fixed in different species was an appropriate way to begin the analysis.

The investigators knew that beak shape is a fixed trait in each species. Since there is a genetic variation within a species, they wanted to make sure they found a gene that represented a fixed trait that would look one way in all the organisms of one species (e.g. blunt) and another way in the other species (e.g. pointed). Therefore, they looked for regions that were fixed within one species but were different between species.

Briefly describe how the phosphate backbone is used to separate DNA molecules based on their size.

The negative charge on the phosphate backbone makes it possible to separate DNA molecules by size through electrophoresis because while all of the molecules are attracted to the positively charged end of the gel box, the smaller ones can move more quickly towards the positive charge as they can more quickly move through the gel matrix.

Origins of replication are typically AT-rich (that is, contain more As and Ts than Gs and Cs). What do you predict would happen in a hypothetical organism in which replication began at G-C rich region?

The organism would most likely have trouble replicating DNA quickly because a G-C base pair has three hydrogen bonds while an A-T base pair has two.

What are some ways that organisms use to ensure the fidelity of DNA replication? Why is it important that the fidelity of DNA replication is an evolutionary balance between faithful replication and the existence of some errors?

The principal mechanism by which the fidelity of DNA replication is ensured is the specificity of the base pairs—A with T, G with C. However, this is not enough on its own to ensure high fidelity replication. The 3' exonuclease proofreading activity of many DNA polymerase enzymes provides the ability of DNA polymerase to detect and remove erroneously paired bases being added to the 3' end of the newly synthesized strand. To repair damage, cells also have replication checkpoints where all repairs must be completed before the cell is allowed to continue with replication. After replication is finished the DNA goes through mismatch repair to catch any mistakes missed by proofreading. If mistakes can't be repaired, apoptosis is triggered. If these systems fail, an organism will have damaged DNA, which could affect its fitness and even harm its chances of survival. However, DNA fidelity must be balanced with some changes in order for evolution to occur. If the DNA was unable to change, then organisms would never be able to evolve, since variation is needed for natural selection and evolution to act upon. But if too many mistakes are made during replication, then the probability of frequent deleterious mutations increases to a point that will likely cause death.

What does this tinkering mean?

The term "tinkering" suggests that materials or processes already present are altered or used for a new purpose. A more modern term is "repurposing".

Define the term genome.

The total DNA content of a species

One of the "arrows" has remained unchanged. Which step in the Central Dogma process has not been changed, and why is this so important?

The translation of RNA into polypeptide only goes one way. This is incredibly important because it means that no matter what modifications are made to polypeptides, the RNA remains unaffected by those modifications and so does the DNA, making polypeptide modifications uninheritable.

While all bacteria and eukaryotes use double-stranded DNA as their genetic material, not all viruses have double-stranded DNA (dsDNA). Some viruses have single-stranded DNA (ssDNA) and some have single-stranded RNA (ssRNA). Before DNA sequencing was a routine method, biochemists would analyze nucleic acids for their base composition by determining the concentration of different components. Suppose that a biological sample was isolated from a deep sea vent, with the following results. Fill in the rest of this table. If some part cannot be answered, explain why.

The type of genome for the first Virus is very likely to be double-stranded because the purines make up exactly half of the bases. It could be either a dsDNA virus, in which case A= T, or it could be dsRNA virus in which case A=U. Since the question did not allow for dsRNA viruses (although some are known), this must be a dsDNA virus. The second virus must have an RNA genome. Since the question only allows RNA viruses to be single-stranded, this must have a ssRNA genome.

The fact that he is able to reconstitute this structure provides some important information about the underlying structure of the chromosome. What are some of the inferences that can be drawn from this successful experiment?

This shows that the four core histones are highly conserved in sequence, structure, and function, and that nucleosomes are a fundamental way of organizing DNA across species.

Positions 43 to 51 of the 159 base RNA that is an essential component of the enzyme telomerase in Tetrahymena, a eukaryote, have the sequence CAACCCCAA. Scientists in Elizabeth Blackburn's lab mutated this sequence to CGACCCCAA. How will this change affect the nature of Tetrahymena telomeres?

There will be a single base change in the telomeres from a T to a C. The original sequence would have read: GTTGGGTT and now will read GCTGGGGTT, so that telomeres extended using this template have a different sequence. This was part of the evidence for how the process worked.

One change was located immediately downstream of the ALX1 gene. Speculate about possible reasons that this change might have been found. We will return to this question in Chapter 12. We will encounter another type of gene regulation in Chapter 12 known as microRNAs.

These are small RNA molecules that regulate gene expression by binding to a target sequence in the mRNA; in animals, these target sequences are typically found immediately downstream of the protein coding region of the gene.

By hand, try to assemble the following three sequences and determine if these represent one, two, or three separate contigs. i.GCTAGTCAG....................CAAGTTTCAGii.GTACTAGCAT..................CCTATAGAiii.CCTATAGA.......................CTGACTAGC

These are two contigs, since iii and ii align with each other. Sequence i doesn't line up with either of the others (iii)CCTATAGA.......................CTGACTAG (ii)GTACTAGCAT..................CCTATAGA

Rare genetic diseases in humans arise from mutations in components of the mismatch repair system, the base excision repair system, and the nucleotide excision repair system. Individuals with these mutations are highly "cancer-prone", that is, they have a very high rate and recurrence of different types of cancer. Why is this so?

These individuals are likely to have higher rates of mutations in their cells because their DNA replication repair systems catch and repair fewer mistakes than the average person's. People who are more likely to experience DNA mutation are also more likely to be cancer-prone because the higher rates of mutations make it more likely that they will have a mutation that will cause cancer.

A protein carries out similar functions in two individuals, but not equally well in each individual.

This could be due to differences in the coding region of the gene for this protein in each individual. If the individual whose protein carries out the function more effectively has more offspring, the gene will have a fitness advantage over the individual whose protein does not work as well. The gene encoding the more functional protein will be selected for.

In one species, protein A interacts with proteins B and C, while in another species protein A interacts with proteins C and D.

This could be due to differences in the coding region of the gene, resulting how protein A recognizes and interacts with the other proteins.

Two different species have similar genes but these are spliced to make slightly different mRNAs.

This difference might be the result of variations in the DNA that result in variations in the splicing of the mRNA. This would mean the final proteins are different, and one type might create a fitness advantage for that species.

MutS

This is a protein that is able to recognize mismatched bases after DNA replication is complete to catch mismatched bases that were missed during proofreading. In other words, it is part of post-replication repair. MutS then recruits MutH and MutL to repair the damage. This is the process of mismatch repair as we know it in E. coli, but the process is highly conserved, and there are proteins similar to MutS in most organisms involved in mismatch repair. .

When comparing the sequences of the genes of Drosophila and the praying mantis, you notice that the proteins encoded by the labial genes are almost identical, at least in the relevant part of the characteristic feature from part A above. However, when looking at the head and mouth parts of Drosophila and the praying mantis (which are presumably regulated by the labgene), the insects are not that similar. Speculate about how changes in the head and mouth parts of the two species might have arisen even if the regulatory gene itself is not that different.

This is probably because the target genes regulated by labial are different between the two species—either some genes are regulated in one species and not the other (which is probably true) or some of the genes that are regulated in both species have themselves changed in sequence and function. As we will see in Chapter 14, gene regulation in eukaryotes occurs through a cascade or a hierarchy of transcription factors, and the Hox genes are situated near or at the top level. If one or more of the targets of lab gene is itself a transcription factor, then a small change in that target transcription factor could make a significant change in the morphology.

"Occasionally, differentiated cells of complex multicellular organisms deviate from their normal genetic program and begin to divide and grow, giving rise to tissue masses called tumors."

This relates to the idea of biology as a set of organized systems because the complex, highly-regulated system of cell division within a tissue is going awry here. It also relates to the idea that organisms are made up of cells, because it is the abnormal behavior of cells that is causing this problem. It relates to the idea of genes as a unit of heredity because the process of cell division is "programmed" by genes.

"Embryological and molecular evidence suggests that bilaterally symmetrical animals are divided into two lineages, the protostomes and the deuterostomes."

This relates to the idea of evolution by natural selection, which is the mechanism that divided those two lineages, and produced the diverse array of bilaterally symmetrical animals. It also relates to the idea of the gene as the unit of heredity because genetic information was passed from one generation to the next within each lineage, and to the idea of an organized system as it is at a system level that gene activities lead to different body forms.

"Immunological memory forms the basis for vaccinations, in which antigens in the form of living or dead pathogens are introduced into the body."

This relates to the idea of life as chemistry because antigens are molecules with chemical properties, and antigen recognition is a chemical process. It also relates to the idea of biology as a set of organized systems because the immune system is a complex system made up of many sub systems that allows the body to fend off pathogens.

"Eventually, most of the solar energy absorbed by green plants is converted into heat energy as the activities of life take place."

This relates to the idea of life as chemistry, because chemical reactions are used to convert solar energy into heat. It also relates to the idea of biology as a set of organized systems because the process of converting light to heat is a system that underlies many other systems that comprise "activities of life."

"This model [referring to the Watson-Crick model for double-stranded DNA] fit all of the known data about the arrangement of atoms, and made it apparent how genetic information is stored and how it could be replicated faithfully."

This relates to the idea of life as chemistry, because the chemical properties of the DNA molecule as Watson and Crick describe it allow it to carry genetic information. It also relates to the idea of the gene as a unit of heredity because genes are particular sequences of nucleotides within the DNA molecule.

"The generation of genetic variability is a prime evolutionary advantage of sexual reproduction."

This relates to the idea of the gene as the unit of heredity because sexual reproduction involves the combination of genetic information from two individuals to create a new genome in a new individual in the following generation. It also relates to the idea of evolution by natural selection because genetic variability is one of the factors that facilitate evolution. And it relates to the idea that organisms are comprised of cells because sexual reproduction requires the fusion of gametes (cells).

"In nature, prokaryotes often live in communities where they interact in a variety of ways."

This relates to the idea that organisms are made up of cells because prokaryotes are a type of cell with specific characteristics that distinguish it from eukaryotes and archae. It also relates to biology as an organized system as the different prokaryotes interact with one another to form a system of interactions within a community.

"Glycolysis produces pyruvate molecules in the cytosol and an active transport mechanism moves them into the mitochondrial matrix."

This relates to the idea that organisms are made up of cells, because it is a process that happens within cells. It relates to the idea of life as chemistry because glycolysis is a chemical process. It relates to the idea of biology as a set of organized systems because the active transport mechanism is a system that is involved in many broader processes that occur within the cell.

Topoisomerase

Topoisomerases are enzymes that unwind DNA before and during replication to stop it from becoming tangled as the strands are separated from one another. This addresses the problem that when the two strands of the helix are uncoiled, the rest of the molecule will coil up more tightly and become excessively twisted around itself and tangled. Some topoisomerases relieve this tension by actually making cuts in the DNA, which it eventually repairs; others pass the DNA through itself, like untying a knot

Nitrous acid converts cytosine to uracil.

Transition mutation in which C:G base pairs are replaced by T:A base pairs.

Ethylnitrosourea (ENU) attaches ethyl groups, primarily to thymines. This results in more frequent pairing with guanine rather than adenine.

Transition mutation in which T:A base pairs are replaced with C:G base pairs

Ethylmethane sulfonate (EMS) attaches an alkyl group to guanine which increases the frequency at which it pairs with thymine rather than cytosine.

Transition mutation, particularly in which G:C base pairs are replaced by A:T base pairs

When gene sequences from closely related individuals are compared, transitions are both more common and less deleterious in their effects than transversions. Propose an explanation for why transitions are both more common and generally less harmful than transversions. Figure 13-16, which presents the genetic code based on the chemical similarities of amino acids, could be helpful in thinking about the harmful effects of different types of mutation.

Transitions are more common because a base is replaced with a similar-looking (a single ring base for a single ring base or a double ring base for a double ring base) rather than a more dissimilar base. Transitions are more likely to be missed during the proof-reading and repair processes. Transversions require a distortion of the DNA backbone and alter the spacing between the two strands. Transitions are also usually less harmful because a transition mutation is more likely to code for the same amino acid than a transversion mutation, making them less harmful overall.

We cannot be certain that a particular phylogenetic tree is the "optimal" tree as the data set becomes larger. Since we cannot know the "right answer" for a tree for sure, why are trees useful? What types of evidence give us confidence that a tree is accurate, or would cause us to doubt the accuracy of a particular tree?

Trees are still useful even if we are not certain that they provide the perfect answer because even an imperfect tree can still give the most likely relationships between species. Furthermore, the reliability of a tree can be checked by using the same data and different methods to create another tree with the data and checking to see if the two trees show the same relationships between organisms. However, it is not at all unusual for phylogenetic trees to be revised as more data are acquired. The validity of a method for creating a phylogenetic tree can also be tested by applying the statistical analyses to a rapidly evolving organism whose evolutionary history is known and therefore can be checked against the phylogenetic tree that is created. The accuracy of a tree could be called into question if the clades dramatically change when a different set of statistical analyses are applied or if the methods do not produce accurate results for organisms whose evolution is known.

Some cases of basal cell carcinoma ("skin cancer") in humans arise from somatic mutations in a gene called patched (Ptch1). One study sequenced the Ptch1 gene from basal cell carcinoma cells found on the nose or cheek of different patients. About half of these samples affected adjacent thymines. Explain this result.

UV light is a mutagen that causes adjacent pyrimidines--particularly adjacent thymines--to covalently bond to one another and form a dimer. The cells on the surface of an organism—the skin cells—are the ones that are most exposed to UV light from the sun. Skin cancers like basal cell carcinoma are often caused by UV radiation, making it likely that the mutations found in these cancers would be dimerizations of thymines.

Approximately what fraction of the total genome is not found in the chromosome in bacteria compared to eukaryotes?

Up to approximately 4% of the genome of a bacterium can be found on a plasmid. In eukaryotes, less than a tenth of a percent of the genome is comprised of non-chromosomal DNA (though this number varies a great deal with chromosomal genome size).

In light of the Great Ideas, why do we use model organisms?

We can use model organisms because there are commonalities between all organisms, such as being made up of cells, having hereditary information stored as DNA, and being subject to evolution. Since all organisms are descended from a common ancestor through the process of evolution many shared biological processes work the same way in different organisms allowing us to extrapolate our understanding from model organisms to other organisms.

Based on what you know from this chapter or information from other courses, what are the basic steps by which a gene becomes expressed into a phenotype?

When a gene is used ('expressed') in an organism a corresponding RNA molecule is made that in turn often codes for a corresponding protein product. The RNA or protein product then carries out some sort of physical function in the cell. These functions combine with environmental influence to produce a particular trait or characteristic in the organism.

E. coli and other bacteria methylate adenines on the original strand to distinguish the original stand from the newly replicated strand of DNA. Why is this distinction important?

When the DNA is being checked for mismatches, it is important that the cell knows which mismatched base is the correct (or ancestral) base and which one is the incorrect (or newly introduced) base; the base on the newly strand can be replaced to minimize changes. Methylation makes it possible for the cell to recognize the difference between the two strands and make the correct substitution.

List the types of changes that you can expect for the Hox gene cluster of a praying mantis compared to that of another insect, such as Drosophila melanogaster. Is there a particular type of change in the Hox genes that you do not expect to see when two insects are compared like this?

While any change between the Hox genes could be found, it is least likely to be a change in splicing pattern. It is possible that there would be novel genes and changes in gene number, but those would not be my first guess. When comparing different insects; if the two species were more distantly related, that is also likely to be very important. The most likely changes that will almost certainly be found are changes in the expression pattern of the Hox genes and changes in the amino acid sequences of the proteins encoded by the genes.

If the genomes of these two dogs were compared, what types of differences are likely to be encountered?

Within a species, the main source of phenotypic variation is quantitative difference in level of transcription, meaning that most changes will be in how much certain genes are expressed. Hair color is an example of this, since varies based on level of expression of kit ligand, which is caused by a single base difference in the CRM (regulatory regions). You will also see differences in nucleotide sequences in the coding regions of some genes, coming from base substitutions and indels (insertions and deletions). This could cause differences in the amino acid sequences of the corresponding proteins. You probably will not see genes that are present in one breed and not the other, or the expansion or contraction of gene families. It is very likely that the genes are spliced the same way.

Why is it important to have a vast excess of the primer over the genomic DNA in these experiments?

You want to make sure the target DNA anneals to the primers, and not the target's complementary strand. A vast excess of primer is important to ensure that the majority of the single stranded pieces of DNA match with primers instead of re-annealing with their complementary strand.

Haplotype:

a set of polymorphisms (single base pair genetic variations) in a region of a genome that continue to be inherited together as a unit over multiple generations because they are linked to one another (present along the same stretch of DNA).

Ancestral and derived conditions:

an ancestral trait is a trait present in a more distant ancestor while a derived trait is a more recently changed trait.

What is cDNA and what makes cDNA so important to molecular biology?

cDNA is DNA that is created from template RNA. cDNA is very important to molecular biology because it allows researchers to create more stable (double-stranded) copy of the sequence of mRNA, allowing researchers to more easily study transcription and the sequences of RNA.

Fitness:

refers to the ability of a particular genotype to leave offspring relative to other genotypes. In other words, how well an organism of a certain genotype populates subsequent generations.

Suppose that this sequence is from an exon in the middle of a gene. What is the amino acid sequence that would be translated from this gene? (This question requires a little more insight than it might seem. The codon table needed for the translation is found in Figure 13-13 or on-line.)

●mRNA 1: 5' ACG AUC AGU CGU UAG GAC 3'polypeptide: Thr Ile Ser Arg Stop●mRNA 2: 5' CGA UCA GUC GUU AGG AC 3'Polypeptide: A arg ser val val arg thr●mRNA 3: 5' GAU CAG UCG UUA GGA C 3'Polypeptide: AC asp gln ser leu gly CEither reading frame 2 or 3 would be acceptable, but the first reading frame would not be acceptable, as this is in the middle of the exon of a gene, and the reading frame contains a STOP codon (UAG).