MB203: Midterm 2
What is the average life expectancy for patients with cystic fibrosis?
44 years. (40-60 years)
What is the generic format of the genomic sequence that can be targeted by CRISPR technology?
5'-GG-N18-NGG-3'
What is the sequence of the guide RNA that the scientist might use to direct Cas9 to this region of the genome? 5'-gcaccattaa agaaaatatc attgg-3' (deletion already removed)
5'cattaa agaaaatatc atctttgg(PAM)3' (DNA target sequence) 5'CAUUAA ACAAAAUAUGAU 3'(guide RNA, the N18)(complemented)
What is a possible consequence of a single nucleotide addition to the DNA used to generate a protein?
A frameshift mutation can occur, which could potentially affect all the proteins generated from the DNA after the mutation and result in the addition of a different amino acid to the protein.
Give one scenario that would explain how a mutation in the DNA of the Piedmontese bull could lead to muscle hypertrophy.
A point mutation in the MSTN gene alters the function of MSTN as a negative regulator of muscle growth, inducing muscle hyperplasia and hypertrophy.
Provide a brief description of how the CRISPR system works that your grandparents could understand.
A tool to change parts of your genes that may cause disease. See TED Talk video. It can find the exact right spot to make a cut, and your body will repair the cut which can affect the function of the gene. It can be applied to genetic diseases!
Write the mRNA sequence (from nucleotides 1651 to 1662: 5'-atctttggtg tt-3') that would be transcribed in this region (if no deletion occurred). Use the mRNA codon table to write the sequence of amino acids that would be translated in this region.
AACACCAAAGAU/ Asn-Thr-Lys-Asp
Write the mRNA sequence that remains after the deletion. 5'-attggtg tt-3' Use the codon table to write the sequence of amino acids that would be translated after the deletion. How does the deletion change the protein that is produced?
AACACCAAU/ Asn-Thr-Asn
Describe how it would be possible for a single point mutation in DNA to result in early termination during translation.
As shown in the diagram, a single point mutation, for example, from TTC to ATC, would eventually lead to an amino acid change from Lysine to a STOP, resulting in early termination in translation and a potentially truncated protein. This could also occur with an addition mutation.
Distinguish between the role of helicases and DNA polymerases in DNA replication.
Both DNA Helicase and Polymerase are essential for DNA replication. Helicase unwinds double-stranded DNA, while polymerases add nucleotides to the now ssDNA to make complementary strands.
In what cells were CRISPRs originally discovered and what is their purpose in that type of cell?
CRISPRs were originally discovered in bacteria, and their purpose was related to their immune system. They recognized viral genetic information and defended the bacteria from invading viruses.
Which gene is linked to cystic fibrosis? Briefly describe the function of the protein encoded by this gene.
Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mutation. The CFTR protein is related to mucus production in many organs of the body including the lungs, liver, pancreas, intestines, and sweat glands. The mutation prevents chloride from moving across ion channels, causing mucus buildup.
What are some of the applications of this technology?
Engineering other multicellular organisms, including mammals and plants, genetic diseases, medicine, farming.
Compare and contrast traditional PCR with quantitative PCR.
For qPCR, there is a fluorescent probe that tracks the number of the DNA after every PCR cycle, while traditional PCR does not have this feature
What mechanism of repair would use the donor DNA as a template?
Homology directed repair
Name three sources of nucleic acids you expect to find in a patient sample.
Human, SARS-CoV-2 virus, other viruses, and bacteria.
Does Huntington disease run in families? Is the mode of inheritance recessive or dominant? How do you know?
Huntington's Disease does run in the family. It is a mode of dominant inheritance because you only need to receive the gene from one of the two parents to develop the disease.
What could contribute to ambiguous results from samples? Hint: Think about differences in the viral load (the total amount of virus inside a person) between people, differences in sample collection methods, the differences in sample preparation methods. Can you suggest two factors that may contribute to an ambiguous test result?
Low amount of pathogen in patient's sample (e.g. asymptomatic infection); Insufficient sample amount is collected.
Briefly describe the respiratory and digestive signs and symptoms of cystic fibrosis. List any other symptoms that are characteristic of cystic fibrosis.
Lung infection, pneumonia, wheezing, coughing, bulky greasy bowel movements, constipation, trouble gaining weight, salty sweat.
What are some of the challenges or concerns associated with CRISPR technology?
Mismatched base pairing, sometimes doesn't get the effect you expect, ethics, long term effects of CRISPR are not known.
How common is cystic fibrosis? Are there any ethnic groups affected more than others?
More than 30,000 people in the US have cystic fibrosis, and more than 10 million are carriers of the CFTR gene mutation. It is more common in people of northern European ancestry and less common in Hispanics and African Americans. It is relatively uncommon in Asian Americans.
One criticism of the CRISPR technique is that it is not 100% efficient, meaning that not all of the mutated DNA will be repaired. Do you think this matters in the case of cystic fibrosis? Why or why not? For what types of diseases might this be more of a concern?
No, because using CRISPR to treat cystic fibrosis will elevate the lung functions, by making channels functional once again. However, if the patient is having a disease, such as HIV, not being efficient 100% will play a more important issue.
What are the two types of cellular repair processes that occur after a double-strand break?
Nonhomologous End Joining and Homology Directed Repair.
Transcribe and translate the portion of the gene from Piedmontese cattle. 5' ...TGCTCTGGAGAATATGAATTTGTATTT ...3' 3' ...ACGAGACCTCTTATACTTAAACATAAA... 5'
Piedmontese mRNA sequence- UGC UCU GGA GAA UAU GAA UUU GUA UUU Piedmontese polypeptide sequence- Cys-Ser-Gly-Glu-Tyr-Glu-Phe-Val-Phe
List the names and functions of the major proteins involved in transcription.
RNA polymerase: uses enzymatic activity to form phosphodiester bonds that hold ribonucleotides together Ribosomes: act as a site for protein synthesis
What is the manner of inheritance for cystic fibrosis: recessive (must inherit a defective gene from each parent) or dominant (only need to inherit a single copy of the defective gene from either parent)?
Recessive.
What structural changes occur in the brain of a Huntington disease patient? Specifically, what area of the brain atrophies?
Severe atrophy is found in the many brain structures including the vermis, cerebellar cortex, basal ganglia, caudate nuclei, putamen, and globus pallidus.
CRISPR is a new biotechnology that targets DNA sequences, allowing us to alter specific DNA sequences. For example, it can be used to delete portions of the genome. How could you use the CRISPR technology to treat a muscle wasting disease?
The CRISPR-CRISPR-associated (Cas) system is a promising platform for treating Duchenne muscular dystrophy (DMD), a neuromuscular disease characterized by DMD gene mutations. In systems ranging from cells generated from DMD patients to animal models of DMD, CRISPR-Cas can be utilized to permanently repair the mutant DMD gene, resulting in the expression of the encoded protein, dystrophin.
What is the name of the endonuclease involved with CRISPR technology? What molecule is required for this enzyme to direct its cutting function toward a particular sequence of DNA?
The endonuclease is Cas9. The molecule required for this enzyme to direct its cutting function is guide RNA: tracrRNA and sgRNA.
An error in DNA replication can lead to mutations in offspring. Does the gene mutation for Huntington disease reside in germline or somatic cells?
The gene mutation for Huntington's Disease resides and starts in germline cells, while other somatic cells also possess the mutation.
Compare and contrast the leading and lagging strands in DNA synthesis. Include in your answer a definition of an Okazaki fragment.
The leading strand is a single DNA strand that is replicated in the 3' - 5' direction, in which DNA is added to the leading strand continuously; the lagging strand is replicated in the 5' - 3' direction discontinuously, in which the short discontinuous Okazaki fragments are produced and will later be linked together by DNA ligase.
Is there a correlation between the CAG nucleotide repeat length and age of onset of the disease?
The length of CAG repeats is inversely proportional to the age of onset of the disease.
Use the codon table provided (Figure 4) to determine the impact of the following point mutation: Original sequence: AUG UUU UAU UGU Mutated sequence: AUG UUU UAC UGC
The original sequence will be translated to Met-Phe-Tyr-Cys The mutated sequence will be translated to Met-Phe-Tyr-Cys This point mutation leads to a missense mutation.
What was the purpose of the study that Hwang et al. (2013) performed?
The purpose of the study was to compare the CRISPR-Cas-based RNA guided endonucleases to other gene editing programs, zinc finger nucleases and transcription activator-like effector nucleases, as well as to increase the efficiency and also apply CRISPR-Cas9 to whole organisms.
Would a mutation in a parent's somatic cell be passed on to their offspring? Justify your answer.
The somatic cell comprises all of an organism's cells with the exception of germline cells. Therefore, a mutation in a parent's somatic cell would not be passed onto its offspring.
Briefly describe the type of mutation that occurs in the CFTR gene. State the most common mutation found in patients with this disease.
There are 6 types of mutations the most common being Class II that occurs in 88% of people with cystic fibrosis. Protein processing mutation. F508 deletion.
Is there a treatment for cystic fibrosis?
There is no cure for cystic fibrosis, but there are treatments that help people live longer, healthier lives; symptom management. Lung care such as airway clearance, chest physical therapy, autogenic drainage. Medications such as antibiotics, mucus thinners.
Errors in DNA replication can result in sections of repeating nucleotides. As shown in the animation, what can cause an expansion of these repeats?
Trinucleotide repeats can expand due to slippage during DNA replication. A hairpin will form and the longer repeat will now be incorporated in the second round of replication. The number of repeats are amplified with each cell division.
How can we ensure we are only amplifying and detecting viral sequences, and no other sequences that may be in the tube?
We use specific fluorescent probes and primers that only bind to the cDNA of our target viral sequences.
What does cDNA represent?
cDNA represents the complementary DNA
What is the role of mRNA in the central dogma of molecular biology?
mRNA is transcribed from DNA in the nucleus, transported to the cytoplasm, and is then translated to protein polypeptides.
Transcribe and translate the portion of the myostatin gene. Assume the bottom strand is the template strand. 5' ... TGCTCTGGAGAATGTGAATTTGTATTT ... 3' 3' ... ACGAGACCTCTTACACTTAAACATAAA ... 5'
mRNA seq: UGC UCU GGA GAA UGU GAA UUU GUA UUU polypeptide: Cys-Ser-Gly-Glu-Cys-Glu-Phe-Val-Phe
List and describe the roles of the three different types of RNA involved in transcription and translation.
mRNA: carries the genetic information for transcription rRNA: helps to form the peptide bonds that hold the amino acids together, generating the final protein tRNA: delivers the amino acids to the ribosome
Explain how in clinical trials, small interfering RNA (siRNA) is being tested as a potential therapeutic for Huntington disease. Include the goal of such therapy and any negatives to siRNA therapy.
siRNA can be used to target mRNAs for destruction, effectively reducing the expression of certain genes. The siRNA guides RNA-induced silencing complex (RISC) to a complementary mRNA and cleaves it. In the treatment of Huntington's disease, the RNA interference is designed to target mutant HTT mRNA, destroy it, and reduce the production of the mutant HTT protein. However, siRNAs have more off-target effects caused by their vulnerability in cytoplasms, which may affect the accuracy of the therapy.