All Multiple Choice (Modes #1-#5)

What is the probability of obtaining 3 heads in four flips of a fair coin? a. 0.50 b. 0.0625 c. 0.75 d. 0.25

.25

If a couple with Sickle cell disease genotypes Ss and Ss mate and have one child with the disease, what is the chance the next child has the disease as well? 0.25 1 0 0.5

0.25

In a human population, the genotype frequencies at one locus are 0.5 AA, 0.4 Aa, and 0.1 aa. The frequency of the A allele is: 0.50 0.70 0.32 0.90 0.20

0.70

How many Barr bodies would you expect to see in an XXY individual? 2 0 1 3

1

A typical prokaryotic genome has 1 million base pairs of DNA, containing 1000 genes. 1 million base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few thousand genes.

1 million bp of DNA, contains 1000 genes

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be genotypically AaBbCcDd ? a. 1/16 b. 8/256 c. 4/256 d. 81/256 e. 1/256

1/16

Ability to roll the tongue is caused by a dominant allele. A woman is a "roller," but one of her parents is not. Reference: Ref 6-2 The woman is expecting a child with a man who is a "nonroller." What is the probability that their child will be a "roller"? a. 1/2 b. 3/4 c. 1/4 d. 1/3 e. 2/3

1/2

One form of hemophilia is caused by a sex-linked recessive gene. Assume that a man with hemophilia marries a phenotypically normal woman whose father had hemophilia. What is the probability that their first son will have hemophilia? a. 3/4 b. 1/16 c. 1/4 d. 1/8 e. 1/2

1/2

Polydactyly is expressed when an individual has extra fingers and/or toes. Assume that a man with six fingers on each hand and six toes on each foot marries a woman with a normal number of digits. Having extra digits is caused by a dominant allele. The couple has a son with normal hands and feet, but the couple's second child has extra digits. What is the probability that their next child will have polydactyly? a. 7/16 b. 3/4 c. 1/2 d. 1/32 e. 1/8

1/2

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be genotypically AABBCCdd ? 1/256 9/256 81/256 1/2 3/4

1/256

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be phenotypically recessive? a. 1/256 b. 4/256 c. 81/256 d. 2/256

1/256

In the following cross, what proportion of individuals will have the Bombay phenotype? AB Hh x AB Hh a. 3/4 b. 0 c. 1/4 d. 1/2

1/4

What is the probability of obtaining 3 heads in three flips of a fair coin? 1/4 1/2 1 1/8

1/8

Most of the bacterial genomes described in the text have fewer than 10,000 genes 5,000 base pairs 500 genes 10,000 base pairs 50 genes

10,000 genes

If they live long enough, the penetrance of individuals carrying the Huntington's Disease allele will be what? 50% 100% 0% 25%

100%

In snapdragons, heterozygotes for one of the genes have pink flowers, whereas homozygotes have red or white flowers. When plants with red flowers are crossed with plants with white flowers, what proportion of the offspring will have pink flowers? a. 75% b. 100% c. 50% d. 25%

100%

a) In a healthy female, how many secondary oocytes would be expected to form from 100 primary oocytes? b) How many first polar bodies would be expected from 100 primary oocytes? a) 100, b) 50 a) 200, b) 300 a) 50, b) 50 a) 200, b) 50 a) 100, b) 100

100, 100

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine? 31 12 38 24

12

Assume that, regarding a particular gene, one scored 30 second-division ascospore arrangements and 70 first-division arrangements in Neurospora. What would be the map distance between the gene and the centromere? a. 15 b. insufficient information provided to answer this question c. 70 d. 60 e. 30

15

Meselson and Stahl determined that DNA replication in E coli is semiconservative. What additive did they initially supply to the medium in order to distinguish "new" from "old" DNA? 33P 14N S 15N 32P

15N

If a typical somatic cell has 32 chromosomes, how many chromosomes are expected in each gamete of that organism? a. 46 b. 32 c. 0 d. 64 e. 16

16

In a healthy male, how many sperm cells would be expected to be formed from (a) 400 primary spermatocytes? (b) 400 secondary spermatocytes? a) 400, b) 400 a) 1600, b) 800 a) 100, b) 800 a) 800, b) 800 a) 1600, b) 1600

1600, 800

Which of the following are among the major components of prokaryotic ribosomes? 18S rRNA, 5.8S rRNA, and proteins 16S rRNA, 5S rRNA, and 23S rRNA lipids and carbohydrates 12S rRNA, 5.8S rRNA, and proteins 16S rRNA, 5.8S rRNA, and 28S rRNA

16S rRNA, 5S rRNA, and 23S rRNA

A protein is 300 amino acids long. Which of the following could be the number of nucleotides in the section of DNA that codes for this protein? (Remember: DNA is double-stranded.) 300 1800 3 500 10018

1800

With incomplete dominance, a likely ratio resulting from a monohybrid cross would be a. 1:2:2:4 b. 3:1 c. 3:3 d. 1:2:1 e. 9:3:3:1

1:2:1

What types of phenotypic ratios are likely to occur in crosses when dealing with a single gene pair where all the genotypic combinations are of equal viability? a. 1:2:1, 3:1 b. 1:4:6:4:1, 1:1:1:1 c. 12:3:1, 9:7 d. 9:3:3:1, 27:9:9:9:3:3:3:1 e. 2:3, 1:2

1:2:1, 3:1

Mitosis ends with _____, while meiosis ends with _____. 2 diploid cells; 4 haploid cells 4 haploid cells; 2 diploid cells 4 diploid cells, 2 haploid cells 2 haploid cells; 4 diploid cells

2 diploid cells, 4 haploid cells

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. Reference: Ref 2-1 What is the total number of chromosomes in a polar body cell from a rat? 21 84 42 40 41

21

If a typical somatic cell has 44 chromosomes, how many chromosomes are expected in each gamete of that organism? 88 22 44 72 18

22

A recessive gene for red-green color blindness is located on the X chromosome in humans. Assume that a woman with normal vision (her father is color-blind) marries a color-blind male. What is the likelihood (give a percentage) that this couple's first son will be color-blind? 25% 100% 50% 75% 0%

25%

A trihybrid cross is a cross between two individuals who are heterozygous for three genes. For example: AaBbCc x AaBbCc. Assuming these three genes are unlinked and assorting independently, what segregation ratio would be observed? 16:9:9:3:3:1 12:9:3:1 27:9:9:9:3:3:3:1 1:1:1:1 9:3:3:1

27:9:9:9:3:3:3:1

The heterozygote genotype frequency term for a gene with two alternate alleles A (frequency of p) and a (frequency of q) in the Hardy-Weinberg equation is: p2 2pq q2 P+2pq+q2 (p+q)

2pq

Flower diameter in sunflowers is a quantitative trait. A plant with 6-cm flowers, from a highly inbred strain, is crossed to a plant with 30-cm flowers, also from a highly inbred strain. The F1 have 18-cm flowers. F1 × F1 crosses yield F2 plants with flowers ranging from 6 to 30 cm in diameter, in approximately 4-cm intervals (6, 10, 14, 18, 22, 26, 30). Reference: Ref 24-1 The number of different genes influencing flower diameter in this plant is 3. 5. 6. 7. 4.

3

When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing. 5' base 3' base middle base

3' Base

A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is 3' UCA 5' 3 'ACU 5' 5' TCA 3' 3' UGA 5

3' UCA 5'

An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it? 3' AUG 5' 3' ATC 5' 5' ATC 3' 5' AUG 3'

3'-AUG-5'

In one strand of DNA, the nucleotide sequence is 5'-ATGC-3'. The complementary sequence in the other strand must be: 5'-CGTA-3' 3'-ATGC-5' 5'-TACG-3' 5'-ATCG-3' 3'-TACG-5'

3'-TACG-5'

This new strand of DNA has its 3' end oriented in the opposite direction as that in which the replication fork travels. lagging strand In one strand of DNA, the nucleotide sequence is 5'-ATGC-3'. The complementary sequence in the other strand must be: 3'-TACG-5' 5'-CGTA-3' 5'-ATCG-3' 5'-TACG-3' 3'-ATGC-5'

3'-TACG-5'

Flower diameter in sunflowers is a quantitative trait. A plant with 6-cm flowers, from a highly inbred strain, is crossed to a plant with 30-cm flowers, also from a highly inbred strain. The F1 have 18-cm flowers. F1 × F1 crosses yield F2 plants with flowers ranging from 6 to 30 cm in diameter, in approximately 4-cm intervals (6, 10, 14, 18, 22, 26, 30). Reference: Ref 24-1 An 18-cm F1 plant is crossed to a 6-cm plant. What is the probability of an offspring with one additive allele, if all genes that influence this trait are unlinked? 1/3 1/16 1/6 3/8 1/4

3/8

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)? 60% 30% 35% 70%

30%

Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion. 400, 800, 1000 (2 of these) 400, 1200, 1600 300, 700, 2200 700, 400, 1400, 2600 300, 700, 1000, 1200

300, 700, 1000, 1200

If a typical somatic cell has 64 chromosomes, how many chromosomes are expected in each gamete of that organism? a. 64 b. 16 c. 32 d. 8 e. 128

32

If 64% of the people in a population are blue-eyed and the population is in Hardy-Weinberg equilibrium, what is the percentage of heterozygotes in the population? 36% 16% It cannot be determined from these data. 32% 20%

32%

If a DNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it have? 35 15 60 30 10

35

The ant, Myrmecia pilosula, is particularly interesting because it carries all its genetic information in a single pair of chromosomes. In other words, 2n = 2. (Males are haploid and have just one chromosome.) For the purposes of this question, assume that a G1 somatic cell nucleus in a female Myrmecia pilosula contains 2 picograms of DNA. How much DNA would be expected in a Metaphase I cell of a female? a. 4 picograms b. 8 picograms c. 16 picograms d. 32 picograms e. not enough information to answer this question

4 picograms

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. Reference: Ref 2-1 What is the total number of chromosomes present in the cell during metaphase I of meiosis? 168 42 21 84 126

42

Assume that there are 12 map units between two loci in the mouse and that you are able to microscopically observe meiotic chromosomes in this organism. If you examined 200 primary oocytes, in how many would you expect to see a chiasma between the two loci mentioned above? 46 48 24 0 32

48

Which of these sequences could form a hairpin? 5' TTTTTTCCCCCC 3' 5' AAAAAAAAAAAA 3' 5' GGGGTTTTCCCC 3' 5' ACACACACACAC 3'

5' GGGGTTTTCCCC 3'

Which of these sequences, if paired with its complementary strand, would be a palindrome? 5' CCCCCC 3' 5' CCCGGG 3' 5' CTGCTG 3' 5' TCCCCT 3'

5'-CCCGGG-3'

Select three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes. heteroduplex formation, base modification, capping 5'-capping, 3'-poly(A) tail addition, splicing 5'-poly(A) tail addition, insertion of introns, capping 3'-capping, 5'-poly(A) tail addition, splicing removal of exons, insertion of introns, capping

5'-capping, 3'-poly(A)tail addition, splicing

Name two mutagens that would be classified as base analogs. ethylmethane sulfonate and ethylmethylketone peroxide 5-bromouracil and 2-aminopurine hydroxyurea and peroxidase ultraviolet light and cosmic radiation acridine orange and proflavin

5-bromouracil and 2-aminopurine

It is estimated that transposable elements compose approximately what percent of the human genome? 1 99 10 <1 50

50

When crossing an organism that is homozygous recessive for a single trait with a heterozygote, what is the chance of producing an offspring with the homozygous recessive phenotype? a. 50% b. 25% c. 0% d. 75%

50%

Human albinism is an autosomal recessive trait. Suppose that you find a village in the Andes where 1/4 of the population is albino. If the population size is 1000 and the population is in Hardy-Weinberg equilibrium with respect to this trait, how many individuals are expected to be heterozygotes? 250 500 300 50 750

500

Of the approximately 6600 genes in Saccharomyces cerevisiae, about ________ have a known function. 2000 5700 900 200 1000

5700

The ribonucleic acid components known to exist in eukaryotic ribosomes are the following: (check all that apply) 5S 28S 16S 5.8S 18S

5S 28S 5.8S 18S

The horse (Equus caballus) has 32 pairs of chromosomes, whereas the donkey (Equus asinus) has 31 pairs of chromosomes. How many chromosomes would be expected in the somatic tissue of a mule? a. 31.5 b. 33 c. 63 d. 126

63

An organism has a haploid number of 6. How many possible assortments of chromosomes are possible based on the independent assortement of the chromosomes? 256 32 128 not possible to determine based on this information 64

64

A recessive allele in tigers causes the white tiger. If two normally pigmented tigers are mated and produce a white offspring, what percentage of their remaining offspring would be expected to have normal pigmentation? 50% 25% 75% about 90% about 66%

75%

You are producing a heteropolymer of synthetic mRNA using a 1C:5G ratio. In this synthetic mRNA what is the proportion of codons with 2Gs and 1C? 125/216 75/216 1/216 25/216

75/216

In a three-point mapping experiment, how many different genotypic classes are expected? a. 2 b. 4 c. 6 d. 8 e. 10

8

Drosophila melanogaster, the fruit fly, has a 2n chromosome number of 8. Assuming that a somatic G2 nucleus contains about 8.0 picograms of DNA, how many picograms of nuclear DNA would you expect in: a) Mitotic metaphase b) a primary oocyte (metaphase) c) a secondary oocyte (metaphae) d) a first polar body (metaphase) a. a-d: 4, 4, 8, 8 b. a-d: 8, 4, 2, 2 c. a-d: 8, 4, 4, 4 d. a-d: 8, 8, 4, 4

8,8,4,4

How many different F2 genotypes would you expect in a cross with four heterozygous gene pairs? a. 81 b. 162 c. 27 d. 243 e. 9

81

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be phenotypically ABCD ? 81/256 1/2 9/256 1/256

81/256

Assume that a dihybrid cross is made in which the genes' loci are autosomal, independently assorting, and incompletely dominant. How many different phenotypes are expected in the offspring? a. 4 b. 3 c. 9 d. 7 e. 6

9

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids? 1200 900 600 100 300

900

Assuming Mendel's Second Law is correct, what is the expected segregation ratio for traits in a dihybrid cross? 9:3:3:1 3:1 1:1 None of the above. 1:1:1:1

9:3:3:1

Typical ratios resulting from epistatic interactions in dihybrid crosses would be ________. a. 3:1, 1:1 b. 1:2:2:4:1:2:1:2:1 c. 1:1:1:1, 1:4:6:1 d. 9:3:3:1, 1:2:1 e. 9:3:4, 9:7

9:3:4, 9:7

The following is a map of four genes on a chromosome: A W E G |___5____|__3__|_______12___| Between which two genes would you expect the highest frequency of recombination? A and E W and E A and G E and G

A and G

What is a mutation? A change in allele frequency A change in the DNA sequence A change of amino acid A change in the phenotype

A change in the DNA sequence

DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide? a deoxyribose sugar purine or pyrimidine nitrogen-containing bases a ribose sugar phosphate DNA contains all of the above.

A deoxyribose sugar

Which one of the following statements regarding eukaryotic transcriptions is not true? Chromatin remodeling is necessary before certain genes are transcribed. Eukaryotic transcription involves a core promoter and a regulatory promoter. A group of genes is transcribed into a polycistronic RNA. There is no one generic promoter

A group of genes is transcribed into a polycistronic RNA.

The primary structure of a protein is: A chain of genes A linear chain of amino acids An active site A folded up ball of cells A long coil

A linear chain of amino acids

Which statement is true regarding heritability and continuous variation? A low heritability score means that genes are less influential than environment in determining phenotypic variation. The total variance used to calculate heritability measures all the variance in a population. Heritability measures the degree to which genes determine phenotype. As the number of gene loci that affect a trait increases, the proportion of extreme version of the trait also increases. A heritability value of 0.8% of the total variance is due to differences in the environment.

A low heritability score means that genes are less influential than environment in determining phenotypic variation.

Conditional mutations are more likely to result from which of the following alterations to the coding region of a gene. a mutation caused by a base addition or deletion a mutation caused by a base addition a mutation caused by X rays a mutation caused by a tautomeric shift a mutation caused by a deletion

A mutation caused by a tautomeric shift

Which of the following best describes the addition of nucleotides to a growing DNA chain? A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate.

A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

In the DNA double helix, disulfide bridges are formed between the two DNA strands a purine always pairs with a pyrimidine None of the above the number of hydrogen bonds between the participating bases is always constant A pairs with G, and T pairs with C

A purine always pairs with a pyrimidine

What is a gene? A sequence of amino acids that catalyze a reaction A sequence of DNA that encodes a protein A sequence of DNA that tells polymerase where to begin transcription A sequence of RNA that regulates expression

A sequence of DNA that encodes a protein

PCR is necessary for efficient replication of cell's DNA in interphase a technique for amplifying DNA sequences in vitro one of the control elements of the cell cycle None of the above

A technique for amplifying DNA sequences in vitro

In an analysis of the nucleotide composition of double-stranded DNA to see which bases are equivalent in concentration, which of the following would be true? Both B and C are true. A = G and C = T A + C = G + T A = C A + T = G + C

A+C=G+T

Three forms of DNA are... (Check three answers). A-DNA R-DNA L-DNA B-DNA Z-DNA

A,B,Z

Assume that the somatic cells of a male contain one pair of homologous chromosomes (e.g., A1 and A2), and an additional chromosome without a homolog (e.g., W). What chromosomal combinations would be expected in the meiotic products (spermatids) of a single primary spermatocyte? (There may be more than one answer.) a. A1 A1 A2 A2 b. A1,W A1,W A2,W A2,W c. A1,W A1,W A2 A2 d. A1 A1 A2,W A2,W

A1,W A1,W A2 A2 A1 A1 A2,W A2,W

Which of the following parental genotypes will produce only heterozygous F1 offspring? a. AA x Aa b. Aa x aa c. aa x aa d. Aa x Aa e. AA x aa

AA*aa

Which of the following are examples of monohybrid crosses? a. AaBB x AaBB b. Aa x aa c. AaBb x AaBb d. Aa x Aa e. AaBb x aabb

Aa*aa Aa*Aa

What modification neutralizes the charges on histones that promote ionic interaction with DNA? phosphorylation polyadenylation demethylation acetylation

Acetylation

Assuming one mutational event in a gene, on average, which of the following mutagens would be expected to cause the most damage to a protein synthesized by such a mutagenized gene? acridine orange ethylmethane sulfonate 5-bromouracil 2-amino purine

Acridine Orange

Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common? All are alternate forms of the ancestor All require plasmid cloning techniques All are derived from a single ancestor All contain mutations

All are derived from a single ancestor

Which is a characteristic of DNA sequences at the telomeres? They consist of cytosine and adenine nucleotides One strand protrudes beyond the other, creating some single-stranded DNA at the end. The consist of repeated sequences all choices are correct

All choices are correct

Assume that a man who carries an X-linked gene has children. Assuming normal meiosis and random combination of gametes, the man would pass this gene to all of his sons. half of his sons. half of his daughters. all of his daughters. all of his children.

All of his daughters

After translation, eukaryotic proteins can be modified by all of the above. the removal of amino acids. the addition of methyl groups. acetylation. the addition of phosphate groups.

All of the above

In the absence of glucose and in the presence of galactose, several genes are activated to enable yeast utilize galactose. The key regulator(s) of the yeast GAL system is/are the _______ protein(s). All of the above Gal4 Gal80 None of the above Gal3

All of the above

Which of the following human genotypes is associated with Klinefelter syndrome? a. none of the above b. XXY c. XXXY d. all of the above e. XXYY

All of the above

Which is not true of amino acids? They are the building blocks of proteins tRNA brings them to the ribosome for protein synthesis all of the above are true There are 20 of them required in the body

All of the above are true

What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? All produce RNA as a product. All produce RNA as a product. All produce lipid as a product. All produce DNA chains as a product.

All produce DNA chains as a product

Genes come in different versions called: a. loci b. alleles c. genotypes d. genomes e. chromosomes

Alleles

What is the function of the TATA binding protein? Allows eukaryotic RNA polymerase II to bind to the promoter of genes Allows prokaryotic RNA polymerase to bind to the promoter of genes Helps termination factors bind and terminate transcription. Aids in the removal of introns from eukaryotic pre-mRNA

Allows eukaryotic RNA polymerase II to bind to the promoter of genes

A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites? A 12-kb fragment An 8-kb fragment An 8-kb and a 2-kb fragment A 10-kb and a 2-kb fragment A 10-kb, an 8-kb, and a 2-kb fragment

An 8kb fragment

QTL mapping requires all of the following except: an estimate of homozygosity in the population. a genetic map. a controlled cross. genetic markers. offspring.

An estimate of homozygosity in the population

The sketch above depicts a cell from an organism in which 2n = 2 and each chromosome is metacentric. What stage is does the sketch represent? Ch.2 No.16-1.jpg anaphase of mitosis anaphase of Meiosis I anapase of Meiosis II telophase of mitosis

Anaphase of Meiosis II

Assume that you wished to generate conditional mutations (such as temperature sensitive mutations) for the study of cell-cycle genes in yeast. Of the mutagens listed in the following, which would be the most likely to generate such mutations? B and C transposon insertion nitrosoguanidine radiation ethyl methane sulfonate (EMS)

B and C

Genetic distances within a given linkage group cannot be determined. are measured in centiMorgans. B and C A, B, and C B, C, and D are dependent upon crossover frequencies between paired, non-sister chromatids. cannot exceed 100 cM.

B and C

Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.

B,C,E

A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that prokaryotes use a different genetic code from that of eukaryotes bacteria cannot remove eukaryotic introns. bacterial RNA polymerase cannot make RNA complementary to mammalian DNA bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA

Bacteria cannot remove eukaryotic introns

For a physical map of a chromosome, distances are measured in units of percent recombination. RFLPs. centiMorgans. base pairs. contigs.

Base Pairs

Which is true of the secondary structure of DNA? Thymine pairs with guanine Bases on complementary strands are held together by hydrogen bonds. Sugar-phosphate groups are on the inside of the DNA molecule. Cytosine pairs with adenine. Nucleotide bases are on the outside of the DNA molecule.

Bases on complementary strands are held together by hydrogen bonds

In E. coli, which terms accurately reflect the nature of replication of the chromosome? bidirectional and fixed point of initiation bidirectional and multirepliconic unidirectional and fixed point of initiation multirepliconic unidirectional and reciprocal

Bidirectional and fixed point of initiation

The lac repressor protein controls expression of the lac operon via ________________ binding to the lac structural genes to repress expression binding to the lac promoter site to repress expression binding of the lac Z and lac Y genes only binding to the lac operator site to repress expression all of the above

Binding to the lac operator site to repress expression

Polygenic traits ______________________ Both A and B may be measured quantitatively and have continuous variation are influenced by both genes and the environment fall into discrete classes of phenotypes are not affected by the environment

Both A and B

Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? DNA polymerase restriction enzymes specific for the target genes DNA ligase Both B and C

Both B and C

Regulatory proteins that bind DNA have common motifs that interact with sequences of DNA. How do amino acids in DNA-binding proteins interact with DNA? By forming covalent bonds with DNA sugars By forming covalent bonds with DNA bases By forming hydrogen bonds with DNA bases a) and c) None of the above.

By forming hydrogen bonds with DNA bases

How do centromeres help control the cell cycle? by inhibiting anaphase until spindle fibers are attached to chromosomes by causing DNA not attached to centromeres to be lostby inhibiting anaphase until spindle fibers are attached to chromosomes by activating cell cycle control genes by inhibiting the S phase until the cell is ready to double its DNA content

By inhibiting anaphase until spindle fibers are attached to chromosomes

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences? TTTTAAAA, GGGGCCCC GGTTC, TTAT CAAT, TATA any trinucleotide repeat

CAAT, TATA

Of the DNA sequences below, which would probably be the harder to determine? CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA

CGATATATAT... The repetitive region in A would make it harder to determine even though it is shorter.

What is the chromosomal configuration of the phiX174 virus? Check all that apply. double-stranded circular linear DNA single-stranded

Circular Single Stranded DNA

Which of the following clusters of terms applies when addressing enhancers or silencers as elements associated with eukaryotic genetic regulation? trans- and cis-acting, variable position cis-acting, variable orientation, variable position cis-acting, variable position, fixed orientation trans-acting, fixed position, fixed orientation cis-acting, fixed position, fixed orientation

Cis-acting, variable orientation, variable position

Translation is directly dependent on all of the following associations except _______. complementary base pairing between mRNA and tRNA association of the 30S and the 50S ribosomal subunits complementary base pairing between mRNA and rRNA complementary base pairing between mRNA and DNA

Complementary base pairing between mRNA and DNA

Which of the following polymorphisms is the most efficient for use in population genetics studies? Complete sequence variation Amino acid sequence polymorphisms Variable number of tandem repeats Chromosomal polymorphisms Restriction site variation

Complete sequence variation

Which of the following polymorphisms is the most efficient for use in population genetics studies? Restriction site variation Amino acid sequence polymorphisms Variable number of tandem repeats Chromosomal polymorphisms Complete sequence variation

Complete sequence variation

Which of the following are general categories of mutations? Select all that apply. DNA behavioral conditional lethal protein

Conditional Behavioral Lethal

What three possible models were suggested to originally describe the nature of DNA replication? Check three below. continuous dispersive semiconservative semidispersive conservative

Conservative Semiconservative Dispersive

Heterochromatin is characterized by all of the following, EXCEPT that it is present all over the inactive X chromosomes in mammals. remains highly condensed throughout the cell cycle. is present on most of the Y chromosome. is present at centromeres and telomeres. contains genes that require high levels of transcription.

Contains genes that require high levels of transcription

A bacterial polycistronic transcription unit is one that contains information for one protein product. contains information for more than one protein product. is capped at the 5'end and carries a poly-A tail at the 3'end. is void of start (AUG) and termination (UAA, UGA, UAG) triplets. none of these answers

Contains information for more than one protein product

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________. chromosome sequence map contig

Contig

Which of the following statistical terms is a not measure of central tendency? The Median The Mode The Mean All of the above Correlation

Correlation

Human racial differences are produced by cultural factors as well as multiple genes that affect several traits. multiple genes that affect skin color. a single gene that affects skin color. multiple genes that affect several traits.

Cultural factors as well as multiple genes that affect several traits.

Restriction endonucleases... are used to randomly digest DNA molecules. are human enzymes. are all genetically engineered. cut DNA at specific sequences.

Cut DNA at specific sequences

The long-term storage of genetic information in a cell occurs in the: RNA microRNA DNA mRNA

DNA

Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction? DNA ligase DNA polymerase III primase topoisomerase

DNA Pol III

Which term most appropriately refers to a regulatory protein in prokaryotes? translation DNA binding protein helicase activation RNA processing gyrase action

DNA binding protein

In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts? DNA contains purines, whereas protein includes pyrimidines. DNA contains nitrogen, whereas protein does not. DNA contains phosphorus, but protein does not DNA contains sulfur, whereas protein does not.

DNA contains phosphorus, but protein does not

During interphase of the cell cycle, a. DNA content essentially doubles. b. sister chromatids move to opposite poles. c. the nuclear membrane disappears. d. DNA recombines. e. RNA replicates.

DNA content essentially doubles

Reverse transcriptase (from a retrovirus like HIV) generates DNA from RNA RNA from a DNA template Genomic DNA from protein RNA from an RNA template DNA from DNA

DNA from RNA

The concept that genetic information passes from DNA to RNA to protein is called central dogma Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? Indicate the reason for your choice. A: GCATTAGGGCATCCC CGTAATCCCGTAGGG B: TTAGCGTTATAGCAT AATCGCAATATCGTA Mark the correct boxes below: DNA molecule B DNA molecule A DNA molecule B has a higher G-C content DNA molecule A has a higher G-C content. DNA molecule A has a higher A-T content DNA molecule B has a higher A-T content

DNA molecule A A has higher GC content B has higher AT content

a. RNA only b. DNA only c. both RNA and DNA d. neither RNA nor DNA Reference: Ref 13-1 When this molecule is synthesized, both strands of a DNA molecule are used as a template.

DNA only

Viral chromosomes exist in a variety of structures and can be made up of the following: protein or lipid-coding sequences DNA only RNA only DNA, RNA, or protein DNA or RNA

DNA or RNA

It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions? citric acid cycle DNA sequencing restriction digestion electron transport

DNA sequencing

In biology, most information flows through which sequence? DNA to RNA to protein protein to DNA to RNA RNA to DNA to protein protein to RNA to DNA

DNA to RNA to Protein

A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? Information about bacterial orthologs of the gene An EST database of the human genome Microarray data of tissues in which the gene is expressed Data about the inheritance of SNP markers in families with the disease Whole-genome-shotgun clones of the human genome

Data about the inheritance of SNP markers in families with the disease

What term refers to the regulatory events that establish a specific pattern of gene activity and developmental fate for a given cell? attenuation differentiation determination lysogen gradient regulated

Determination

The contribution of Gilbert and Sanger to modern genetics was to develop the PCR technique. discover DNA in the nucleus of cells. describe the structure of DNA. show that genes were made of DNA. develop a method for sequencing DNA.

Develop a method for sequencing DNA

Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon? use of different transcriptional activators. differential acetylation of specific histone proteins prior to transcription. differences in pre-mRNA splicing that results in an altered pattern of exon inclusion. All of the above. multiple random mutations within specific exons of the gene.

Differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.

Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides? Centrifugation sedimentation gradient. Fluorescently labeled dNTPs Fluoresently labeled dATP. Different fluorochromes attached to the four different ddNTPs.

Different fluorochromes attached to the four different ddNTPs.

LINES differ from retrotransposons in that LINES: do not encode transposase. do not contain the transposase gene. do not encode reverse transcriptase. do not contain LTRs. do not transpose in a replicative manner.

Do not contain LTSs

Which are abnormalities involving numbers of X chromosomes? Mark all that apply. a. Huntington's disease b. Down syndrome c. XXXX syndrome d. Klinefelter syndrome e. Turner syndrome

Down Syndrome XXXX Syndrome Turner Syndrome

The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR? Each cycle includes a "hot" saturation phase (95oC), which allows the primers to anneal to the target DNA. Each cycle includes a "hot" denaturation phase (95oC), which serves to sterilize the culture. Each cycle includes a "hot" denaturation phase (95oC), which activates the Taq polymerase. Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together. More than one of these answers is correct.

Each cycle includes a "hot" denaturation phase (95C), which separates the hydrogen bonds that hold the strands of the template DNA together.

Genetic information can be carried in which of the following biomolecules? a. Either DNA or RNA b. RNA and not DNA c. DNA and not RNA d. proteins

Either DNA or RNA

A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will encode unformylated methionine. encode N-formylmethionine. serve as the initiation codon. encode methionine that will eventually be removed.

Encode unformylated methionine

Which of the following statements is NOT true about enhancers? Enhancers contain sequences that are recognized by transcription factors. Enhancers represent control elements located far away from the promoter. Enhancers are recognized by and bind directly to RNA polymerase. Enhancers can be located thousands of nucleotides upstream of downstream of the gene they affect. Enhancers can differ for each gene in a eukaryotic cell (although overlap is possible).

Enhancers are recognized by and bind directly to RNA polymerase

______________ can cause the same genotype to produce a range of potential phenotypes. The inbreeding coefficient Hybrid vigor Heritability Epistasis Environmental effects

Environmental Effects

A condition in which one gene pair masks the expression of a nonallelic gene pair is called ________. codominance recessiveness additive alleles epistasis dominance

Epistasis

Regulation of gene expression using siRNAs is found in eukaryotes only. prokaryotes only. prokaryotes and eukaryotes.

Eukaryotes only

There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? Prokaryotic: presence of plasmids Prokaryotic: repetitive DNA Eukaryotic: repetitive DNA Eukaryotic: ESTs Eukaryotic: circular DNA

Eukaryotic: repetitive DNA

Any change in a population from Hardy-Weinberg equilibrium can be defined as ______. natural selection mutation genetic equilibrium evolution migration

Evolution

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes fusion into circular forms known as plasmids excision of introns union with ribosomes linkage to histone molecules

Excision of introns

If one compares the base sequences of related genes from different species, one is likely to find that corresponding ________ are usually conserved, but the sequences of ________ are much less well conserved. introns; chaperons introns; proteins introns; exons chaperons; exons exons; introns

Exons, Introns

What is the function of peptidyl transferase activity? It charges tRNAs. It acetylates the end of a protein after translation. It cleaves the polypeptide from the last tRNA during termination. It forms peptide bonds. It moves ribosomes along mRNA during translation.

Forms peptide bonds

A class of mutations that results in multiple contiguous amino acid changes in proteins is likely to be the following: transversion. recombinant. frameshift. transition. base analog.

Frameshift

When cells withdraw from the continuous cell cycle and enter a "quiescent" phase, they are said to be in what stage? a. M b. G2 c. S d. G0 e. G1

G0

__________ mutations produce new traits and are usually dominant. Induced Gain-of-function Forward Lethal Spontaneous

Gain-of-Function

Considering the electromagnetic spectrum, identify likely mutagens from the following list: radio waves, microwaves, infrared, ultraviolet, X rays, gamma rays, cosmic rays. Select all that apply: gamma rays microwaves cosmic rays radio waves X-rays infrared ultraviolet

Gamma Rays Cosmic Rays X-rays Ultraviolet

Mutations that eliminate a contiguous region in the Drosophila embryo's segmentation pattern are called gap genes compartment genes homeodomains linkage genes segment genes

Gap genes

Name the single individual whose work in the mid-1800s contributed to our understanding of the particulate nature of inheritance as well as the basic genetic transmission patterns. With what organism did this person work? Calvin Bridges, Drosophila (fruit fly) Gregor Mendel, Pisum sativum George Beadle, Neurospora Thomas Hunt Morgan, Drosophila (fruit fly) Boris Ephrussi, Ephestia

Gregor Mendel

What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary? Z-DNA double helix hairpin B-DNA

Hairpin

Which of these are major structural classifications of DNA-binding domains that are found in eukaryotic transcription factors? Please select all that apply: helix-turn-helix leucine zipper promoters coil-coil zinc finger

Helix-turn-helix Leucine Zipper Zinc Finger

Total phenotypic variance can be decomposed into all but one of these components: genetic variance. genetic-environment interaction variance. heritability. environmental variance.

Heritability

Chromatin of eukaryotes is organized into repeating interactions with protein octomers called nucleosomes. Nucleosomes are composed of which class of molecules? nonhistone chromosomal proteins glycoproteins lipids histones H1 histones

Histones

Population genetics is concerned with: whether allele frequencies are changing over time. how genes produce proteins. how genes confer relative reproductive success on the individuals. (b) and (c) above. how genes interact with one another.

How genes confer relative reproductive success on the individuals.

Which of the following is a concern of population genetics? How proteins fold under different pH conditions Why is cancer a difficult disease to treat? How many people have color blindness in Utah How the cell copies its DNA

How many people have color blindness in Utah

Considering the structure of double-stranded DNA, what kinds of bonds hold one complementary strand to the other? hydrogen hydrophobic and hydrophilic ionic covalent van der Waals

Hydrogen

A woman who has blood type A has a daughter who is type O and a son who is type B. Which of the following is a possible genotype for the son? a. IBIB b. IBIA c. IBi d. ii

IBi

As a Drosophila larva transitions to the pupa, much of the larval body is broken down. Adult structures, such as wings and legs, are constructed from small clusters of cells called imaginal discs homeoboxes pole cells syncytia homeodomains

Imaginal discs

Riboswitches were first discovered in 2002 and have been found in... In all of the listed organisms plants archaea In none of the listed organisms fungi bacteria

In all of the listed organisms

Which of the following is NOT true regarding the differences in mRNA between prokaryotic cells and eukaryotic cells? In eukaryotic cells, the 5' end of mRNA is modified with a cap, while in prokaryotic cells there is no cap. In eukaryotic cells, mRNA is spliced before translation, while in prokaryotic cells there is no mRNA splicing. In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled. In eukaryotic cells, the 3' end of mRNA is modified with a tail, while in porkaryotic cells there is no tail.

In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled.

Genes contain the instructions for building proteins. Where are those instructions located? In the tRNA. In the bonds between complementary bases. In the nuclear membrane. In the sugar and phosphate groups that are part of each nucleotide. In the order of the DNA bases.

In the order of the DNA bases

DNA polymerase I is thought to add nucleotides on single-stranded templates without need for an RNA primer. in a 5' to 5' direction. to the 3' end of the primer. in the place of the primer RNA after it is removed. to the 5' end of the primer.

In the place of the primer RNA after it is removed

Assume that a cross is made between AaBb and aabb plants and that the offspring fall into approximately equal numbers of the following groups: AaBb, Aabb, aaBb, aabb. These results are consistent with the following circumstance: codominance alternation of generations incomplete dominance independent assortment hemizygosity

Independent Assortment

What conditions are likely to apply if the progeny from the cross AaBb X AaBb appear in the 9:3:3:1 ratio? no gene interaction linked genes co-dominance independent assortment complete dominance

Independent Assortment Complete Dominance No Gene Interaction

The first commercial production of what human enzyme led to the explosion of the biotechnology industry? Polynucleotide Phosphorylase Inuslin Amylase Lactose Dehydrogenase

Insulin

Channels between chromosomes in the interphase nucleus are called extrachromosomal elements. subchromosomal territories. interchromosomal compartments. nonlocalized zones. localized zones.

Interchromosomal Compartments

During the cell cycle, chromosomal replication occurs in Telophase Prophase Interphase Metaphase

Interphase

Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? More than one termination codon is needed to stop translation. Introns are removed from mRNA before translation. Exons are spliced out of mRNA before translation. These triplets cause frameshift mutations, but not termination. UAA, UGA, and UAG are initiator codons, not termination codons.

Introns are removed from mRNA before translation

Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? UAA, UGA, and UAG are initiator codons, not termination codons. Exons are spliced out of mRNA before translation. These triplets cause frameshift mutations, but not termination. Introns are removed from mRNA before translation. More than one termination codon is needed to stop translation.

Introns are removed from mRNA before translation

The spliceosome is a large enzyme that catalyzes removal of specific introns in pre-mRNAs. junk sequences in the DNA by splicing different parts of a gene. None of the above. sequences in either a DNA or an RNA amino acid sequences in the protein by splicing different parts of a protein.

Introns in pre-mRNAs

Which of the following two terms relates most closely to split genes? heteroduplex, homoduplex elongation, termination 5'-cap, 3'-poly-A tail transcription, translation introns, exons

Introns, Exons

Which of the below are not steps in the production of genome sequence maps: Read the sequence of individual piece of the genome. Isolate whole chromosomes. When sequences are obtained, assemble and organize the sequences in order. Identify molecular markers on specific chromosomes. All of these are steps you would use.

Isolate whole chromosomes.

What is the function of cAMP in regulation of the lac operon? It inactivates a repressor protein. It activates a repressor protein. It activates an activator protein. It inactivates an activator protein.

It activates an activator protein.

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? It modifies histones so that nucleosomes can be removed from DNA for transcription. It bends and partly unwinds DNA at a promoter. It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. It blocks access of RNA polymerase to the promoter, until removed by general transcription factors.

It bends and partly unwinds DNA at a promoter

The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number? It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing. There are more introns than exons. There are more exons than introns. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes. Every gene can be read in both directions, and each gene can have inversions and translocations.

It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing.

If mating occurs solely between relatives, eventually what will happen to the population? It will become polymorphic for all shared traits. It will become completely heterozygous. It will remain in equilibrium. It will become completely homozygous. The individuals in the population will have more dominant alleles.

It will become completely homozygous

Where on the chromatid are the microtubules attached? Telomere Centriole Kinetochore Centromere

Kinetochore

The molecular nature of transposable elements was first understood in E. coli due to the simplicity of the E. coli genome. Which of the following types of transposable element contribute significantly to the genome complexity of eukaryotic organisms? IS elements SINES LTR retrotransposons Genes LINES

LINES SINES LTR Retrotransposons

The lac repressor binds to: lactose and DNA. promoter and lactose. RNA polymerase. RNA polymerase and DNA. d-galactosidase, permease and transacetylase.

Lactose and DNA

Significant in the deciphering of the genetic code was the discovery of the enzyme polynucleotide phosphorylase. What was this enzyme used for? ribosomal translocation production of ribosomal proteins peptide bond formation degradation of RNA the manufacture of synthetic RNA for cell-free systems

Manufacture of synthetic RNA for cell-free systems

Homologous chromosomes move toward opposite poles of the dividing cell during a. mitosis b. meiosis I c. meiosis II d. binary fission

Meiosis I

a. Meiosis I anaphase b. Meiosis I prophase c. Meiosis II anaphase d. Meiosis II prophase e. Mitosis telophase f. Mitosis prophase Reference: Ref 2-2 Crossing over (genetic recombination) occurs in...

Meiosis I Prophase

a. Meiosis I anaphase b. Meiosis I prophase c. Meiosis II prophase d. Meiosis II anaphase e. Mitosis prophase f. Mitosis prophase Reference: Ref 2-2 The first stage after which a dividing cell that started as a diploid would be haploid Enter only the letter of your choice.

Meiosis I anaphase

The stage at which "sister chromatids go to opposite poles" immediately follows which stage listed below? a. Telophase of Meiosis II b. Mitotic anaphase c. Telophase of Meiosis I d. Mitotic metaphase

Mitotic Metaphase

Transposable elements are also known as: Jumping repeats Moving genes Transformers Jumping genes Mobile genetic elements

Mobile genetic elements Jumping genes

Inbreeding in populations that are normally outbreeding leads to which of the following? More individuals affected by rare diseases A higher rate of genetic drift A higher rate of mutation An increase in the frequency of heterozygotes A smaller population

More individuals affected by rare diseases

Which of the following are general categories of mutations? Select all that apply. morphological DNA induced protein-altering regulatory

Morphological Regulatory Induced

Which of the following is TRUE for both prokaryotic and eukaryotic gene expression? mRNA is synthesized in the 3' → 5' direction. The mRNA is the exact complement of the gene from which it was copied. After transcription, a 3' poly-A tail and a 5' cap are added to mRNA. RNA polymerase binds to the promoter region to begin transcription.

NA polymerase binds to the promoter region to begin transcription

What term would be applied to a regulatory condition that occurs when protein greatly reduces transcription when associated with a particular section of DNA? negative control stimulation activation inhibition positive control

Negative Control

Choose the type of control illustrated by each example. Reference: Ref 16-1 E. coli lac operon control by lac I negative inducible positive repressible negative repressible positive inducible

Negative Inducible

The phenomenon in which one crossover increases the likelihood of crossovers in nearby regions is called: positive interference reciprocal gene exchange mitotic recombination chiasma negative interference

Negative Interference

An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule. positive repressible negative inducible positive inducible negative repressible

Negative Repressible

The one-gene, one-enzyme hypothesis emerged from work on which two organisms? E. coli and humans Drosophila and humans all of the answers listed Neurospora and Drosophila E. coli and yeast

Neurospora and Drosophila

The basic structure of a nucleotide includes the following components: amino acids. base, sugar, and phosphate. phosphorous and sulfur. mRNA, rRNA, and tRNA. tryptophan and leucine.

Nitrogenous base, Sugar, and Phosphate

In a three-point mapping experiment, what three general classes of offspring are expected (assuming crossovers occur)? Select all those that apply. Noncrossovers Subcrossovers Triple crossovers Single crossovers Double crossovers

Noncrossovers Single Crossovers Double Crossovers

An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it? 5" ACU3' 5'AUC3" none 5'ATT3'

None

E. coli bacteria are placed into a medium containing glucose and lactose. Which of the genes below do you expect to be turned on? Lac I Lac P None of the above Permease f-galactosidase

None of the above

Which of the following features distinguishes RNA from DNA? DNA has only purine bases None of the above RNA has a pentose sugar while DNA utilizes a hexose sugar Unlike RNA, DNA uses a phosphodiester backbone RNA has only pyrimidine bases

None of the above

Which of the following statements about a mammalian messenger RNA are FALSE? It usually contains a cap at the 5' end. It is synthesized in the nucleus. It is usually much smaller than the initial transcript (that is copied directly from the gene). None of the above. It is translated in the cytoplasm.

None of the above

Regarding the structure of DNA, the covalently arranged combination of a deoxyribose and a nitrogenous base would be called a monophosphate nucleoside. nucleotide. ribonucleotide. oligonucleotide. nucleoside.

Nucleoside

Three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes occur in which cellular organelle? cytoplasm Golgi lysosome mitochondrion nucleus

Nucleus

Genes can be located in which organelles? a. ribosome b. nucleus c. golgi d. chloroplast e. vacuole f. mitochondria

Nucleus Chloroplast Mitocondria

A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons. OH, 2', 3' methyl, 2', 3' carboxyl, 5', 3' OH, 2', 5' None of these are correct.

OH, 2', 3'

A rare dominant trait, when exhibited in men, is transmitted to half their sons and to half their daughters. The gene for this trait is carried: None of the above. on an autosome. in the mitochondria. on the X chromosome. on the Y chromosome.

On an autosome

Which of the following is NOT an example of nonrandom mating? negative assortative mating panmixis outbreeding positive assortative mating inbreeding

Panmixis

The term peptidyltransferase relates to peptide bond formation during protein synthesis. 5' capping of mRNA. elongation factors binding to the large ribosomal subunit. discontinuous strand replication. base additions during mRNA synthesis.

Peptide bond formation during protein synthesis

What chemical group is found at the 5' end of a DNA molecule? dideoxy group carboxyl group nitrogenous base sulfate group phosphate group hydroxyl group

Phosphate Group

The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacteriophages made use of the following labeled components: hydrogen. nitrogen and oxygen. phosphorous and sulfur. tritium. None of these answers are correct.

Phosphorus and Sulfer

In a normal distribution, 99% of the measurements fall within plus or minus one standard deviation of the mean. plus or minus two standard deviations of the mean. 5% of the mean. 1% of the mean. plus or minus three standard deviations of the mean.

Plus or minus three standard deviations of the mean.

Which of the following is not a component within a single nucleotide of a nucleic acid? nitrogenous base sugar polymerase phosphate

Polymerase

Which of these is a level or type of genetic regulation in eukaryotes? Select all that apply: RNA splicing co-transcriptional post-translational DNA methylation transcriptional

Post-translational Transcriptional DNA Methylation

The DNA replication enzyme that most closely resembles RNA polymerase is DNA polymerase I. primase. telomerase. DNA polymerase III. helicase.

Primase

What is the general position of the consensus sequence called the GC box? What is its sequence? terminator; CAAT promoter; GGGCGG terminator; GGGCGG promoter; CAAT attenuator; GGGCGG

Promoter: GGGCGG

Crossing over occurs during anaphase. metaphase. prophase. interphase. telophase.

Prophase

The ribosome is the primary site of: amino acid storage. cellular respiration. protein synthesis. protein packaging. oxidative phosphorylation.

Protein Synthesis

Heinz Shuster collected the following data on the base composition of ribgrass virus (H. Schuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. NY: Academic Press, 1955). On the basis of this information (see below) is the hereditary information of the ribgrass virus RNA or DNA? Is it likely to be single stranded or double stranded? Percent: A: 29.3 G: 25.8 C: 18.0 T: 0.0 U: 27.0 Mark the correct boxes below: RNA single stranded double stranded

RNA Single-Stranded

Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe. RNA Pol I; RNA Pol II; RNA Pol III a. mRNA b. tRNA c. rRNA d. snRNA

RNA Pol I = C RNA Pol II = A, D RNA Pol III = B, C, D

Which of the following enzymes are known to be involved in the replication of DNA in bacteria? Check all that apply. RNA Polymerase II DNA Polymerase II ligase DNA Polymerase I RNA primase

RNA Primase Ligase DNA Pol I

What are the two major components of the Tobacco Mosaic Virus? RNA and protein lipids and nucleic acids DNA and protein carbohydrates and nucleic acids RNA and DNA

RNA and Protein

Which of the following statements is not true concerning RNA and DNA? DNA is transcribed into RNA which is translated into protein RNA is more stable than DNA DNA is permanent in a cell, RNA is temporary The sugar portion of RNA and DNA are different

RNA is more stable than DNA

a. RNA only b. DNA only c. both RNA and DNA d. neither RNA nor DNA Reference: Ref 13-1 This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil. Enter only the letter of your choice.

RNA only

An intron is a section of DNA that is removed during DNA processing. transfer RNA that binds to the anticodon. carbohydrate that serves as a signal for RNA transport. RNA that is removed during RNA processing. protein that is clipped out post-translationally.

RNA that is removed during RNA processing

The "RNA World" theory suggests that: RNA is the intermediate between DNA and proteins. many RNAs are capable of self-splicing. RNA viruses are more dangerous than DNA viruses. eventually RNA will become the genetic material of most living organisms. RNA was the genetic material in the first living cells.

RNA was the genetic material in the first living cells.

Frameshift mutations are caused by the __________ or __________ of one or more nucleotides in DNA. a. chemical modification b. removal c. reversion d. insertion e. suppression

Removal Insertion

One form of post-translational modification of a protein includes removal of exons. removal of introns. removal or modification of terminal amino acids. shuffling of exons. self-splicing.

Removal or modification of terminal amino acid

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by Knowing the isoelectric points of the piece in question. Measuring the sizes of the bands on the gel Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest Identifying the molecular weights of the fragments in question None of the above

Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest

Translation of RNA into protein takes place on which cellular organelle? tRNA Ribosome Polymerase Nucleus

Ribosome

Assume that an organism has a diploid chromosome number of six. Two chromosomal pairs are telocentric, and the other pair is metacentric. Assume that the sex chromosomes are morphologically identical. The drawing above could represent which stage(s)? Check all that apply. Ch.2 No.15-1.jpg Secondary spermatocyte (metaphase) First polar body (metaphase) Secondary oocyte (metaphase) Primary oocyte (metaphase)

Secondary Spermatocyte First Polar Body Primary Oocyte

Which of the following terms accurately describes the replication of DNA in vivo? nonlinear nonreciprocal conservative semidiscontinuous dispersive

Semi-discontinuous

Hairpins are formed in DNA as a result of sequences on the opposite strand that are identical sequences on the opposite strand that are complementary sequences on the same strand that are identical sequences on the same strand that are inverted and complementary

Sequences on the same strand that are inverted and complementary

Under certain conditions, the rate of mutation of a particular gene may be determined in humans. What properties of the mutation would favor the most direct determination of mutation rate in humans? Select all that apply: fully expressed 100% penetrant dominant recessive single locus

Single Locus 1000% Penetrant Fully Expressed DOminant

Under certain conditions, the rate of mutation of a particular gene may be determined in humans. What properties of the mutation would favor the most direct determination of mutation rate in humans? Select all that apply: single locus fully expressed 100% penetrant recessive dominant

Single Locus Dominant

A major difference between Mendelian and quantitative traits is in _______________ that statistical properties of quantitative traits are better understood that statistical properties of Mendelian traits are better understood large differences between average phenotypes compared to differences between individuals within genotypes there are no differences between them small differences between average phenotypes compared to differences between individuals within genotypes

Small differences between average phenotypes compared to differences between individuals within genotypes

Mutations that arise in nature, from no particular artificial agent, are called induced mutations. natural mutations. spontaneous mutations. chromosomal aberrations. cosmic mutations.

Spontaneous mutations

The 3' untranslated region affects the ___ of mRNA and the ___ of the mRNA protein-coding sequence. a. translation b. splicing c. stability d. transcription

Stability Translation

Why does DNA polymerase III exist as a dimer? This enzyme has two enzymatic activities. Its 5′→3′ polymerase activity allows it to add new nucleotides in the 5′→3′ direction. Its 3′→5′ exonuclease activity allows it to remove nucleotides in the 3′→5′ direction, enabling it to correct errors. Telomeres________________the end of chromosomes destabilize stabilize transcribe replicate

Stabilize

In general, a "model organism" used in genetics studies is one in which there is a large body of genetic knowledge that has been compiled over decades of genetic research. In addition, model organisms have available their DNA sequences and collections of ________ that make detailed genetic analysis possible and efficient. incomplete metamorphic systems complete metamorphic systems strains with specific mutations epigenetic developmental systems museum specimens

Strains with specific mutations

Immediately after fertilization of a Drosophila egg, the zygote nucleus undergoes a series of divisions. Subsequent nuclear migration generates a ________. maternal effect cleavage nucleus homeodomain syncytial blastoderm zygote

Syncytial blastoderm

Reverse transcriptase is an enzyme found in association with retroviral activity. It has the property of translation. most lysozymes. synthesis of DNA from an RNA template. synthesis of RNA from a DNA template. requiring no template.

Synthesis of DNA from an RNA template

Two modular elements that appear as consensus sequences upstream from RNA polymerase II transcription start sites are TTAA and CCTT. rDNA and nucleolar organizers. TATA and CAAT. enhancers and telomeres. microsatellites and transposons.

TATA and CAAT

Which of these sequences could form a hairpin? TTCAATAATCGCTAATAACTGA GCCGCCGCCGCCCCATTATTATTAT CGCCAAAAAATCGCCCCCCAATTA ATTATTGGCGCTAACGCCAATTTT ATTATTTCGTACCCCCAATTTT TTACGGCGGTTCCGCCGGTG

TTACGGCGGTTCCGCCGGTG

Structures located at the ends of eukaryotic chromosomes are called centromeres. recessive mutations. telomerases. permissive mutations. telomeres.

Telomeres

What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence? that DNA was the genetic material that DNAse or protease, but not RNase, stimulates transformation that protein was the genetic material that RNA was the genetic material

That RNA was the genetic material

Human blood types are an example of codominance because: a. The A and B alleles both express equally in individuals with both alleles. b. The only individuals with O type blood are homozygous recessive c. Individuals with both A and B alleles produce a blended blood type with neither allele expressing fully d. An individual with genotype AO will have A type blood

The A and B alleles both express equally in individuals with both alleles

Which of the following species is considered a genetic model organism? The worm, Caenorhabditis elegans The frog, Hyla chrysoscelis The deer mouse, Peromyscus maniculatus The chimpanzee, Pan troglodytes The plant, Linaria vulgaris

The Worm

In the classic experiment conducted by Hershey and Chase, why was the pellet radioactive in the centrifuge tube that contained bacteria with viruses, which had been grown on medium containing 32P? The bacteria were in the pellet, and they had incorporated radioactive proteins into their cell membranes. The radioactive viruses (coats plus DNA) were in the pellet. The radioactive viruses were in the pellet, and the bacteria were in the supernatant. The bacteria were in the pellet, and many contained the radioactive viral DNA. The radioactive protein coats of the viruses were in the pellet.

The bacteria were in the pellet, and many contained the radioactive viral DNA.

Which of the following are role(s) of the 5' cap? The cap helps the RNA polymerase find the promoter and initiate transcription. The cap protects the RNA from degradation. none of the above The cap acts as a binding site for the ribosome. The cap plays a role in the removal of introns.

The cap plays a role in the removal of introns. The cap acts as a binding site for the ribosome. The cap protects the RNA from degradation.

When scientists were attempting to determine the structure of the genetic code, Crick and co-workers found that when three base additions or three base deletions occurred in a single gene, the wild-type phenotype was sometimes restored. These data supported the hypothesis that there are three amino acids per base. the code is triplet. the code contains internal punctuation. the code is overlapping. AUG is the initiating triplet.

The code is triplet

How do the daughter cells at the end of mitosis and cytokinesis compare with their parent cell when it was in G1 of the cell cycle? a. The daughter cells have half the amoung of cytoplasm and half the amount of DNA b. The daughter cells have half the number of chromosomes and half the amount of DNA c. The daughter cells have the same number of chromosomes and twice the amount of DNA d. The daughter cells have the same number of chromosomes and half the amount of DNA e. The daughter cells have the same number of chromosomes and the same amount of DNA

The daughter cells have the same number of chromosomes and the same amount of DNA

It has been recently determined that the gene for Duchenne muscular dystrophy (DMD) is over 2000 kb (kilobases) in length; however, the mRNA produced by this gene is only about 14 kb long. What is a likely cause of this discrepancy? The DNA represents a double-stranded structure, while the RNA is single stranded. When the mRNA is produced, it is highly folded and therefore less long. There are more amino acids coded for by the DNA than the mRNA. The exons have been spliced out during mRNA processing. The introns have been spliced out during mRNA processing.

The introns have been spliced out during mRNA processing

Alternative splicing is known to be important in the regulation of the production of heat-shock elements. the lac operon in E. coli. the metallothionein gene. the mammalian SV40 virus.

The mammalian SV40 virus

The antiparallel nature of DNA refers to the formation of hydrogen bonds between bases from opposite strands the pairing of bases on one strand with bases on the other strand its charged phosphate groups the opposite direction of the two strands of nucleotides.

The opposite direction of the two strands of nucleotides

Which of the below is not true about the location of enhancers? They can be found in introns. They can be found upstream of the transcription initiation site. They can be found downstream of the promoter. The position of the enhancer has no effect on gene regulation. They can be found 3' of the polyadenylation site.

The position of the enhancer has no effect on gene regulation.

What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli. that somehow the radioactivity prevented DNA from getting into E. coli that DNA was the genetic material in phage that protein was the genetic material in phage that protein and DNA together made up the genetic material

The protein was the genetic material in phage.

This question relates to the regulation of enzymes involved in the synthesis of tryptophan in E. coli. If tryptophan is present in the medium and available to the bacterium, the repressor is inactive and the tryptophan operon is "off." positive control is occurring. the repressor is bound to the operator, thus blocking transcription. the repressor is inactive and the tryptophan operon is "on." the five structural genes associated with tryptophan synthesis are being transcribed at "induced" levels.

The repressor is bound to the operator, thus blocking transcription

The primary structure of a protein is determined by pleated sheets. a series of helical domains. the sequence of amino acids. hydrogen bonds formed between the components of the peptide linkage. covalent bonds formed between fibroin residues.

The sequence of amino acids

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? The tRNA that was in the A site moves to the E site and is released. The tRNA that was in the P site moves into the A site. The tRNA that was in the A site moves into the P site. The tRNA that was in the A site departs from the ribosome via a tunnel.

The tRNA that was in the A site moves into the P site.

When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that the two proteins have identical functions. the two proteins have no common origin. the two proteins share a common ancestry. the two proteins have identical tertiary structures. the primary structures may differ, but the secondary structures are identical.

The two proteins share a common ancestry

DNA replication is semi-conservative in that The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved. The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication. DNA replication can only follow the replication fork on the leading strand. The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

DNA replication is semi-conservative in that The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication. DNA replication can only follow the replication fork on the leading strand. The two stands of the original helix are conserved, but they become part of separate progeny DNAs. The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved.

The two strands of the original helix are conserved, but they become part of separate progeny DNAs

The expected ratio of phenotypes among the progeny of a test cross is 1:1:1:1. Out of 200 total resulting progeny, 48 occur in one of the four phenotypic classes. Given this information, which of the following must also be true? The value of observed - expected for this cell = -2. All of the other classes have observed values of 48 The progeny of this cross do not conform to a 1:1:1:1ratio. Since 48 is so close to the expected value, there is no need to calculate chi square before drawing a conclusion about the ratio. At least one additional cell must also contain a count of 48.

The value of the observed-expected for this cell = -2

The genetic code is said to be triplet, meaning that there are three "nonsense" triplets. there are three amino acids per base in mRNA. there may be three ways in which an amino acid may terminate a chain. there are three bases in mRNA that code for an amino acid. none of these answers

There are three bases in mRNA that code for an amino acid

When examining the genetic code, it is apparent that there are 44 stop codons because there are only 20 amino acids. AUG is a terminating codon. there can be more than one codon for a particular amino acid. the code is ambiguous in that the same codon can code for two or more amino acids. there can be more than one amino acid for a particular codon

There can be more than one codon for a particular amino acid

Which of the following is NOT a feature of Darwin's theory of natural selection? A population adapts to its environment due to the variable reproductive success of individuals. B and C Individuals with poor fitness never produce offspring. A and B There is no heritable variation among individuals.

There is no heritable variation among individuals. Individuals with poor fitness never produce offspring.

Insulators can block the effects of enhancers only when they lie upstream of a promoter. they lie within the structural genes. they lie within a consensus sequence. they lie between an enhancer and a promoter. they lie adjacent to a promoter

They lie between an enhancer and a promoter

Which of the following statements about homologous chromosomes are true? They occur together in haploid cells. They always contain the same alleles. They are always genetically identical. They occur together in diploid cells.

They occur together in diploid cells

What is the function of dideoxynucleotides in Sanger DNA sequencing? They act as primers for DNA polymerase. They act as primers for reverse transcriptase. They cut the sequenced DNA at specific sites. They allow only the specific sequencing of the RNAs of a genome. They stop synthesis at a specific site, so the base at that site can be determined.

They stop synthesis at a specific site, so the base at that site can be determined

Nutritional mutations can be defined as those mutations caused by site-specific mutagenesis those mutations which result in changes in behaviour. those mutations which change the composition of the medium. all strains which are not auxotrophic. those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium.

Those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium.

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA? two three four six

Three

What is the purpose of a cDNA library? To produce a library of all genomic DNA of an organism. To produce a library of expressed genes. To replicate the genomic DNA. To produce a library of chloroplast genes.

To produce a library of expressed genes

In eukaryotes, tRNAs are transcribed in the nucleus, but function in the cytoplasm. transcribed in both the nucleus and the cytoplasm, and function in the cytoplasm. transcribed in the nucleus, and function in the nucleus. transcribed in the cytoplasm, and function in the cytoplasm.

Transcribed in the nucleus, but function in the cytoplasm

In prokaryotes, translation of an mRNA is coupled to None of the above transcription mRNA processing mRNA splicing nuclear export

Transcription

What is the function of eukaryotic RNA polymerase I? transcription of mRNA genes transcription of rRNA genes initiation of transcription (but not elongation) transcription of snRNAs transcription of tRNA genes

Transcription of rRNA genes

List the following events in the pre-RNA processing of a one intron-two exon gene in correct sequence order: • Attachment of snRNP U1 to the 5' splice site • Transesterification reaction at the branch point adenine • Transcription of the DNA template into the pre-mRNA molecule • Recognition and binding the 3' AAUAAA sequence by specific protein factors • Cleavage at the poly(A) site • Addition of the 5' cap • Export to the cytoplasm • Addition of the poly(A) tail • Release of lariat structure • Splicing together of exons

Transcription of the DNA template into the pre-mRNA molecule Addition of the 5' cap Recognition and binding the 3' AAUAAA sequence by specific protein factors Cleavage at the poly(A) site Addition of the poly(A) tail Attachment of snRNP U1 to the 5' splice site Transesterification reaction at the branch point adenine Release of lariat structure Splicing together of exons Export to the cytoplasm

Genetic regulation in eukaryotes can take place at a variety of levels from transcriptional to post-translational. At what level is genetic regulation considered most likely in prokaryotes? exon processing intron processing capping transcriptional polyadenylation of the 3' end of the mRNAs

Transcriptional

Regarding eukaryotic and prokaryotic genetic regulation, what process seems to be the most similar between the two? poly(A) tail addition 5'-capping regulation transcriptional regulation intron/exon shuffling RNA splicing regulation

Transcriptional Regulation

When referring to attenuation in regulation of the tryptophan operon, it would be safe to say that when there are high levels of tryptophan available to the organism, translational termination is likely. transcriptional termination is likely. tryptophan is inactivating the repressor protein. ribosomes are stalling during translation of the attenuator region. the tryptophan operon is being transcribed at relatively high levels.

Transcriptional termination is likely

Two formal terms used to describe categories of mutational nucleotide substitutions in DNA are called euchromatic and heterochromatic. base analogs and frameshift. error prone and spontaneous. transversions and transitions. sense and antisense.

Transversions and Transitions

In what way do upstream activator sequences (UASs), regulatory sequences in yeast, differ from enhancers and silencers? Enhancers only function downstream. UASs can only function in the 5'-3' direction. UASs function in the middle of transcription units. UASs only function upstream. UASs only function downstream.

UASs only function upstream

During translation, chain termination is signaled by which triplets? Check all that apply. UGA UAA UAG AUG UGG

UGA UAA UAG

Transcription of the sequence AATGCGGTC would result in: UUACGCCAG TTACGCCAG Not enough information to tell Three amino acids

UUACGCCAG

The following may be caused by mobile genetic elements except ________________ undergo mutation activate a gene in which they reside disrupt a gene all of the above cause chromosome breaks

Undergo mutation

The genetic code is fairly consistent among all organisms. The term often used to describe such consistency in the code is universal. overlapping. none of these terms. exceptional. trans-specific.

Universal

The nitrogenous base that is found in RNA but not in DNA is None of the above adenine guanine cytosine uracil

Uracil

What general genetic process is believed to account for the variety of cellular structures and functions in eukaryotic cells? negative control exclusively variable gene activity maternal environmental activities RNA processing intron processing

Variable gene activity

The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. chemical removal; activate complementation analysis; enhance visual examination; eliminate temperature extremes; enhance epistasis analysis; enhance

Visual examination; Eliminate

Under the system of genetic control of the tryptophan operon, when there are high levels of tryptophan in the medium, transcription of CAP (CRP) occurs at high levels. when there is no tryptophan in the medium, transcription of the trp operon occurs at high levels. when there are high levels of tryptophan in the medium, transcription of the trp operon occurs at high levels. when there are high levels of tryptophan in the medium, ribosomes "stall" and reduce the levels of tryptophan synthesized. no transcription occurs under any nutritional circumstance because negative controls inhibit transcription.

When there is no tryptophan in the medium, transcription of the trp operon occurs at high levels.

Which modes of inheritance are influenced by the sex of individuals. Select all that apply. Y-linked autosomal dominant X-linked sex-limited autosomal recessive

Y-linked, X-linked, Sex-linked

One speaks of UAS (upstream activating sequences) as being DNase hypersensitive. We would interpret this to mean that each UAS has more histone binding sites than non-UAS sites. more than one strand of DNA exists in each UAS. a UAS is constitutively open. each UAS is likely to be single-stranded. any given UAS is composed of a double-stranded site with a bound repressor.

a UAS is constitutively open.

Red-green color blindness is X-linked recessive. A woman with normal color vision has a father who is color blind. The woman has a child with a man with normal color vision. Which phenotype is NOT expected? a noncolor-blind female a color-blind male a noncolor-blind male a color-blind female

a color-blind female

In humans, the genetic basis for determining the sex "male" is accomplished by the presence of ________. a. one X chromosome b. high levels of estrogen c. a portion of the Y chromosome d. a balance between the number of X chromosomes and e. the number of haploid sets of autosomes

a portion of the Y chromosome

Plasmids are important in biotechnology because they are a vehicle for the insertion of foreign genes into bacteria recognition sites on recombinant DNA strands surfaces for protein synthesis in eukaryotic recombinants surfaces for respiratory processes in bacteria

a vehicle for the insertion of foreign genes into bacteria. d. proviruses

Match each number with the closest type of DNA: a. moderately repetitive DNA b. highly repetitive DNA c. short interspersed elements d. long interspersed elements e. unique-sequence DN

a. b. c. d. e. Gene-encoding Sequence

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication

a. DNA gyrase b. DNA primase c. d. Okazaki fragments e. f. rolling-circle replication g. h. continuous synthesis i. DNA ligase j. k. theta replication

Match each term with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

a. in situ hybridization b. c. cloning vector d. YAC e. f. g. PCR h. i. ß-galactosidase j. k. cDNA library l.

DNA methylation may be a significant mode of genetic regulation in eukaryotes. Methylation refers to addition of methyl groups to the cytosine of CG doublets. altering translational activity especially of highly methylated tRNAs. altering RNA polymerase activity by methylation. alteration of DNA polymerase activity by addition of methyl groups to glycine residues. changes in DNA-DNA hydrogen binding.

addition of methyl groups to the cytosine of CG doublets

Which of the following is the fastest way for an enzyme to respond to changing conditions in the cell? controlling the synthesis or degradation of the enzyme in the cell covalently modifying the enzyme in the cell (by phosphorylation) changing the enzyme's compartmentalization or location in the cell altering the enzyme's activity by allostearic effectors (activators or inhibitors)

altering the enzyme's activity by allostearic effectors (activators or inhibitors)

In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction. tRNA; P; A; peptidyl-tRNA aminoacyl-tRNA; A; P; ribosome synthetase; P; A; ribosome mRNA; E; P; polymerase

aminoacyl-tRNA; A; P; ribosome

An allele is a. another term for epistasis. b. an alternate form of a gene. c. one of the bases in DNA. d. found in mitochondria but not in nuclei. e. present only in males and is responsible for sex determination.

an alternate form of a gene

In the context of molecular genetics, reverse translation refers to assembling a DNA sequence from an amino acid sequence. assembling an RNA sequence from a DNA sequence. translating in the 3' to 5' direction. transcribing first, then translating. making an amino acid sequence from a DNA sequence.

assembling a DNA sequence from an amino acid sequence.

In what part of the mRNA does degradation generally begin? at the 5' end with the removal of the poly(A) tail at the 5' end with the removal of the methyl cap Removal from either end is equally likely. at the 3' end with the removal of the methyl cap at the 3' end with the removal of the poly(A) tai

at the 3' end with the removal of the poly(A) tai

At what stage of the meiotic cell cycle and during what chromosomal configuration does crossing over occur? Mark all that apply. a. during prophase II b. after synapsis of homologous chromosomes c. during anaphase I d. at the four strand stage of meiosis e. before the end of prophase I

at the four strand stage of meiosis after synapsis of homologous chromosomes before the end of prophase I

The anticodon on the tRNA molecule: contains amino-acyl-tRNA synthtase. is the same for all tRNA molecules. is a catalytic part of protein synthesis. is oriented and written in the 5'→ 3' direction. binds to the mRNA in a complementary fashion.

binds to the mRNA in a complementary fashion

Eukaryotic chromosomes contain two general domains that relate to the degree of condensation. These two regions are separated by large stretches of repetitive DNA. each void of typical protein-coding sequences of DNA. void of introns. uniform in the genetic information they contain. called heterochromatin and euchromatin

called heterochromatin and euchromatin

In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? ribosomes and DNA uncharged tRNAs and ribosomes charged tRNA, RNA triplet, and ribosome free tRNAs sense and antisense strands of DNA

charged tRNA, RNA triplet, and ribosome

In anaphase a. chromosomes replicate b. chromosomes move to opposite poles c. homologous chromosomes are paired d. the nuclear membrane is dissolved

chromosomes move to opposite poles

Interactions among the human ABO blood group alleles involve _______ and ________. a. expressivity b. continuous variation c. complete dominance d. incomplete dominance e. co-dominance

co-dominance complete dominance

Linked genes ____________. a. co-segregate b. can crossover and recombine c. are allelic d. will segregate independently e. assort randomly

co-segregate

What is the name given to the three bases in a messenger RNA that bind to the anticodon of tRNA to specify an amino acid placement in a protein? codon anti-anticodon cistron protein rho

codon

In order to determine if mutations from different organisms that exhibit the same phenotype are allelic, which test would you perform? a. allelic series test b. test cross c. complementation test d. biochemical test e. epistasis test

complementation test

Assume that a cross is made between AaBb and aabb plants and that all the offspring are either AaBb or aabb. These results are consistent with the following circumstance: a. codominance b. incomplete dominance c. alternation of generations d. hemizygosity e. complete linkage

complete linkage

Two- and three-factor testcrosses can both be used to _____________ and _____________. a. screen recessive mutants b. map gene loci c. determine parental origin d. determine genotype e. identify double-crossover events

determine genotype map gene loci

Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes? double-stranded, parallel, (A + T)/C + G) = 1.0, (A + G)/(C + T) = 1.0 double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C + T) = variable double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C+ T) = 1.0 double-stranded, parallel, (A + T)/C + G) = variable, (A + G)/(C + T) = 1.0 single-stranded, antiparallel, (A + T)/C + G) = 1.0, (A + G)/(C + T) = 1.0

double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C + T) = variable

Considering the location of genes in the interphase nucleus, certain chromosomal territories appear to exist. Specifically, even-numbered chromosomes are located in the interior of the nucleus, whereas odd-numbered chromosomes are located peripherally. gene-poor regions of chromosomes are located outside the nucleus, whereas gene-rich regions are located inside the nucleus. each chromosome appears to occupy a discrete domain. small chromosomes are more likely to be located in the center of the nucleus. large chromosomes are more likely to be located in the center of the nucleus.

each chromosome appears to occupy a discrete domain

One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that each cosmid replicates nonautomously. lysogenic phages continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones. each vector can take up only a relatively small fraction of the eukaryotic DNA. each ligation product is sequence specific. the host range of the vector is limited.

each vector can take up only a relatively small fraction of the eukaryotic DNA.

That some organisms contain much larger amounts of DNA than are apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in the "alphoid" rather than the diphloid family. eukaryotes than in prokaryotes. RNA viruses than in DNA viruses. prokaryotes than in eukaryotes. viruses than in bacteria

eukaryotes than in prokaryotes.

A BLAST search is done to find similar gene or protein sequences. find the chromosomal location of a sequence. predict the three-dimensional structure of a protein from its amino acid sequence. find restriction sites and SNPs in a sequence. determine the conditions under which a gene is expressed.

find similar gene or protein sequences.

Which cluster of terms accurately reflects the nature of DNA replication in prokaryotes? fixed point of initiation, bidirectional, semiconservative fixed point of initiation, unidirectional, conservative fixed point of initiation, bidirectional, conservative random point of initiation, unidirectional, semiconservative random point of initiation, bidirectional, semiconservative

fixed point of initiation, bidirectional, semiconservative

Codominant alleles are expressed in individuals that are __________________________. a. mutually exclusive b. penetrant c. homozygous d. polymorphic e. heterozygous

heterozygous

List two especially useful characteristics of cloning vectors. high copy number and antibiotic resistance gene(s) virulence and lysogenicity ability to integrate into the host chromosome and then cause a lytic cycle nonautonomous replication and transposition reverse transcriptase and ligase activities

high copy number and antibiotic resistance gene(s)

Because of the mechanism of sex determination, males of many species can be neither homozygous nor heterozygous. Such males are said to be: a. dominant b. recessive c. complementary d. none of these answers e. hemizygous

homozygous

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally hybridizes filter-bound DNA with a DNA probe. hybridizes filter-bound RNA with a DNA probe. examines amino acid substitutions with radioactive probes. cleaves RNA with restriction endonucleases. ligates DNA with DNA ligase.

hybridizes filter-bound DNA with a DNA probe

The relationship between codon and anticodon can be characterized as involving ________ between complementary bases (usually) in typical ________ fashion. hydrogen bonds, parallel covalent bonds, antiparallel hydrogen bonds, antiparallel covalent bonds, parallel ionic bonds, antiparallel

hydrogen bonds, antiparallel

DNA may be damaged from the by-products of normal cellular aerobic respiration. Name three of these electrophilic oxidants that are generally classified as reactive oxidants. carbon dioxide (CO2) carboxyls (COOH-) hydrogen peroxide (H2O2) hydroxyl radicals (·OH) superoxides (O2·-)

hydrogen peroxide (H2O2) hydroxyl radicals (·OH) superoxides (O2·-)

0.1% frequency of recombination is observed a. only in sex chromosomes b. in any two genes on different chromosomes c. on unlinked chromosomes d. in genes located very close to one another on the same chromosome

in genes located very close to one another on the same chromosome

A Barr body is a(n) a. extra Y chromosome in a cell that is the result of nondisjunction. b. gene on the X chromosome that is responsible for female development. c. inactivated X chromosome, visible in the nucleus of a cell that is from a female mammal. d. patch of cells that has a phenotype different from surrounding cells because of variable X inactivation. e. extra X chromosome in a cell that is the result of nondisjunction

inactivated X chromosome, visible in the nucleus of a cell that is from a female mammal

The following are features and characteristics of the DNA molecule except _________________ a. is used as genetic material by all organisms b. is capable of being replicated c. can be mutated d. composed of four nitrogenous bases e. all of the above

is used as genetic material by all organisms

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces high amounts of ß-galactosidase. What is a possible genotype of the cells? lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ lacI+ lacP+ lacO+ lacZ- lacY+ lacA+ lacI- lacP+ lacO+ lacZ- lacY+ lacA+

lacI+ lacP+ lacOc lacZ+ lacY+ lacA+

A mutant E. coli strain, grown under conditions that normally induce the lac operon, does not produce ß-galactosidase. What is a possible genotype of the cells? lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ lacl+ lacP+ lacO+ lacZ+ lacY+ lacA+ lacI+ lacP+ lacO+ lacZ+ lacY- lacA+ lacI+ lacP+ lacOc lacZ+ lacY+ lacA+

lacI+ lacP- lacO+ lacZ+ lacY+ lacA+

Compared with prokaryotic chromosomes, eukaryotic chromosomes are large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in polycistronic transcription units without introns. small, mainly organized in polycistronic transcription units without introns. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.

large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.

Often, a mutation in a gene results in a reduction of the product of that gene. The term given for this type of mutation is: codominance loss-of-function or null (in the case of complete loss) incomplete dominance gain-of-function multiple allelism

loss-of-function or null

All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one? mRNA Methionine tRNA Initiation factors

mRNA

Which of the following statements best describes the messenger RNA? mRNA molecules have a double-helix structure mRNA consists of an anti-codon and an amino acid mRNA is the only type of RNA that carries DNA's protein building instructions mRNA is synthesized by ribosomes in the endoplasmatic reticulum genetic information is permanently stored in mRNA

mRNA is the only type of RNA that carries DNA's protein building instructions

The relationship between a gene and a messenger RNA is that genes are made from mRNAs. messenger RNA is directly responsible for making Okazaki fragments. mRNAs make proteins, which then code for genes. all genes are made from mRNAs. mRNAs are made from genes.

mRNAs are made from genes

In addition to highly repetitive and unique DNA sequences, a third category of DNA sequences exists. What is it called, and what types of elements are involved? permissive DNA, centromeres and heterochromatin dominant DNA, euchromatin and heterochromatin moderately repetitive DNA, SINEs, LINEs, and VNTRs composite DNA, telomeres and heterochromatin multiple gene family DNA, hemoglobin and 5.0S RNA

moderately repetitive DNA, SINEs, LINEs, and VNTRs

Which of the following statements about the genetic code are true? There is only one codon for each amino acid The code is ambiguous but not redundant None of the above Most amino acids are encoded by more than one codon Two consecutive bases specify an amino acid

most amino acids are encoded by more than one codon

A situation where there are more than two alternative forms of a given gene would be called ________. a. multiple alleles b. incomplete dominance c. alternation of generations d. codominance e. hemizygosity

multiple alleles

Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? palindrome consensus sequence multiple cloning site β-galactosidase complementation

multiple cloning site

If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the chromosome number of the four resulting gametes with respect to the normal haploid number (n)? a. n + 1; n + 1; n; n b. n + 1; n + 1; n - 1; n - 1 c. n + 1; n - 1; n; n d. n + 1; n - 1; n - 1; n - 1

n+1, n+1, n-1, n-1

An operon is controlled by a repressor. When the repressor binds to a small molecule, it is released from binding to DNA near the operon. The operon is never expressed if a mutation prevents the repressor from binding to the small molecule. positive repressible negative repressible negative inducible positive inducible

negative inducible

In order to be functional, a chromosome requires all of the following except: centromeres telomeres nucleomeres origins of replication

nucleomeres

For an individual with the XXY chromosomal composition, the expected number of Barr bodies in interphase cells is a. zero b. three c. variable d. one e. two

one

The F1 offspring of Mendel's classic pea cross always looked like one of the two parental varieties because a. one allele was completely dominant over another b. each allele affected phenotypic expression c. different genes interacted to produce the parental phenotype d. the traits blended together during fertilization

one allele was completely dominant over another

The DNA of a eukaryotic chromosome is: a. a pile of fibers with lots of loose ends. b. lots of double helices all jumbled together. c. two or three helices neatly arranged in the nucleus. d. attached in the middle by a centromere. e. one long double helix.

one long double helix

Evolution occurs: only via natural selection, genetic drift, migration, or mutation. only through natural selection. by altering physical traits but not behavioral traits. only when the environment is changing. magic

only via natural selection, genetic drift, migration, or mutation. only via natural selection, genetic drift, migration, or mutation.

Choose the answer that lists--in order of appearance--all the cell types expected to be formed during oogenesis. a. oogonium, primary oocyte, ootid and second polar body, secondary oocyte and first polar body b. ootid, primary oocyte, oogonium, secondary oocyte and first polar body, second polar body c. oogonium, primary oocyte and first polar body, secondary oocyte and second polar body, ootid d. oogonium, primary oocyte, secondary oocyte and first polar body, ootid and second polar body

oogonium, primary oocyte, secondary oocyte and first polar body, ootid and second polar body

In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinate control that are transcribed as a single unit. Such contiguous gene families are called transcriptomes proteomes contigs operons pseudogenes

operons

In a population in Hardy-Weinberg equilibrium, what will be the proportion of matings between homozygotes? P4 p4 + q4 p2 + 2pq 4p2q2 p4 + q4 + 2p2q2

p4 + q4 + 2p2q2

Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such word? lysogenic prototrophic palindromic conjugation insertion

palindromic

A conditional mutation is one that allows a mutant gene product to function normally under the ________ condition, but to function abnormally under the ________ condition. Such mutations are especially useful for the study of ________ mutations. recessive; dominant; codominant restrictive; permissive; dominant permissive; restrictive; dominant permissive; restrictive; lethal dominant; recessive; semidominant

permissive, restrictive, lethal

The Human Genome Project, which got under way in 1990, is an international effort to construct a physical map of the 3.3 billion base pairs in the human genome. collect samples of cells from all parts of the world in order to preserve human genetic diversity. collect plant seeds in order to reduce the impact of human activity on plant extinction. clone deleterious genes from humans and study their mode of action. clone beneficial genes from humans for eventual use in gene therapy.

physical map of the 3.3 billion base pairs in the human genome.

Side groups of amino acids are typically grouped under which of the following? primary, secondary polar, nonpolar alpha, omega long, short linear, circular In eukaryotes,

polar, non polar

What enzyme is exploited to produce synthetic mRNAs? polynucleotide phosphorylase RNA polymerase II ligase polynucleotide kinase

polynucleotide phosphorylase

Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli? inducible system negative control repressible system constitutive positive control

positive control

Drosophila melanogaster, the fruit fly, has a 2n chromosome number of 8. Assume that you are microscopically examining the mitotic and meiotic cells of this organism. You note that in the female two chromosomal pairs are metacentric and that two pairs are acrocentric. What stage is represented in the drawing above? (Genes "P" and "C" are not relevant to this question). a. Secondary oocyte (metaphase) b. Mitotic metaphase c. Primary oocyte (metaphase) e. Ootid (G1)

primary oocyte

In eukaryotes, chromosomes do not contain: a. chromatin b. histones c. DNA d. proteases e. proteins

proteases

The set of all proteins encoded by the genome is called the _______ . genome transcriptome metabolome proteome pharmacogenome glycome

proteome

Mendel's law of independent assortment has its physical basis in the: a. spindle attachment in anaphase I. b. sister chromatids separating in meiosis II. c. separation of alleles into haploid cells. d. haploid cells forming. e. random arrangement of chromosomes on the metaphase plate in meiosis I.

random arrangement of chromosomes on the metaphase plate in meiosis I

One form of post-translational modification of a protein includes shuffling of exons. removal of introns. self-splicing. removal or modification of terminal amino acids. removal of exons.

removal or modification of terminal amino acids

Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? DNAse gene cloning hydrogen sulfide reverse transcriptase isolation of stem cells from a lamb embryo and production of a zygotic equivalent

reverse transcriptase

The fundamental Mendelian process that involves the separation of contrasting genetic elements at the same locus would be called a. continuous variation. b. discontinuous variation. c. segregation. d. independent assortment. e. dominance or recessiveness.

segregation

Hemizygosity would most likely be associated with which of the following? a. sex-limited inheritance b. trihybrid crosses c. dihybrid crosses d. sex-linked inheritance e. incomplete dominance

sex-linked inheritance

What is the outcome of synapsis, a significant event in meiosis? a. monad movement to opposite poles b. side-by-side alignment of nonhomologous chromosomes c. dyad formation d. chiasma segregation e. side-by-side alignment of homologous chromosomes

side-by-side alignment of homologous chromosomes

Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? single-stranded complementary tails blunt ends poly-A sequences 5' cap interference

single stranded complementary tails

Compared with eukaryotic chromosomes, bacterial chromosomes are large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in polycistronic transcription units without introns. small, with high gene density. large, triple-helix, Z-DNA, organized in monocistronic units with introns.

small, with high gene density.

Choose the answer that lists--in order of appearance--all the cell types expected to be formed during spermatogenesis. a. spermatogonia, primary spermatocyte, secondary spermatocyte, spermatid, spermatozoa b. spermatozoa, primary spermatocyte, spermatogonia, secondary spermatocyte, spermatid c. spermatogonia, spermatozoa, primary spermatocyte, spermatid, secondary spermatocyte, d. spermatogonia, secondary spermatocyte, primary spermatocyte, spermatid, spermatozoa

spermatogonia, primary spermatocyte, secondary spermatocyte, spermatid, spermatozoa

In the lactose operon, the product of structural gene lacZ is capable of nonautonomous replication. forming ATP from pyruvate. splitting the β-linkage of lactose. forming lactose from two glucose molecules. replacing hexokinase in the early steps of glycolysis.

splitting the β-linkage of lactose.

Methods for determining the linkage group and genetic map in humans involve which of the following? a. tetrad analysis and bromodeoxyuridine b. twin spots and tetrad analysis c. zygotene and pachytene DNA synthesis d. chiasmatype and classical analyses e. syntenic testing and lod score determination

synthetic testing and low score determination

In the G0 stage of the cell cycle, which of the following is true: DNA content doubles the cell exits the cell cycle RNA replicates stem cells are produced the nuclear membrane disappears

the cell exits the cell cycle

In the G0 stage of the cell cycle, which of the following is true: DNA content doubles the cell exits the cell cycle RNA replicates stem cells are produced the nuclear membrane disappears

the cell exits the cell cycle

siRNAs and miRNAs are produced by the cutting and processing of double-stranded RNA by Slicer enzymes. the cutting and processing of double-stranded RNA by Dicer enzymes. the cleavage of functional mRNA within the cytoplasm. the cleavage of RISCs by endonucleases. the cleavage of pre-mRNA in the nucleus.

the cutting and processing of double-stranded RNA by Dicer enzymes.

Cytokinesis is a. None of the above b. the formation of two new nuclei at the end of mitosis or either meiotic division c. the formation of two cells at the end of mitosis in both plants and animals d. the energy transfer process that facilitates bacterial movement

the formation of two cells at the end of mitosis in both plants and animals

When Thomas Hunt Morgan crossed his red-eyed F1 generation flies to each other, the F2 generation included both red- and white-eyed flies. Remarkably, all the white-eyed flies were male. What was the explanation for this result? a. Other male-specific factors influence eye color inflies b. The gene involved is on an autosome c. The gene involved is on the Y chromosome d. The gene involved is on the X chromosome

the gene involved is on the X chromosome

Alternative splicing is known to be important in the regulation of the production of heat-shock elements. the mammalian SV40 virus. the lac operon in E. coli. the metallothionein gene.

the mammalian SV40 virus.

What is a concise definition of proteomics? the process of defining the complete set of proteins encoded by a genome the harvesting of proteins from a cell to determine their economic value the manipulation of amino acid sequences in proteins to alter their function changing the terminal sequences of proteins to alter their function the rational design of drugs based on protein structure

the process of defining the complete set of proteins encoded by a genome

It is possible for a repressor to negatively regulate the expression of an operon because the repressor induces the expression of inducer. one of the genes expressed in the operon negatively regulates the repressor. the repressor binding site overlaps the promoter site of the operon allowing it to physically block the binding of RNA polymerase. the repressor binding site on the DNA overlaps with the translation start site.

the repressor binding site on the DNA overlaps with the translation start site.

Prokaryotic chromosomes do not have telomeres because: they are circular. they do not go through DNA replication. they are in the cytoplasm. they have no centromeres. they do not go through mitosis.

they are circular

Embryonic stem cells are the subject of a great deal of research. What characteristic of embryonic stems cells accounts for this scientific interest? they are potentially pluripotent they can be used to clone animals they are potentially totipotent they are not controversial they do not undergo apoptosis

they are potentially totipotent

The role of tRNA is: to serve as general translational components of the ribosome. to facilitate splicing of pre-messenger RNAs. to act as transporters bringing amino acids to the site of protein synthesis. to serve as an intermediate in the decoding of genes. to facilitate splicing of pre-messenger RNAs.

to act as transporters bringing amino acids to the site of protein synthesis

What is the enzymatic function of restriction enzymes? to add new nucleotides to the growing strand of DNA to repair breaks in sugar-phosphate backbones to cleave nucleic acids at specific sites to join nucleotides during transcription.

to cleave nucleic acids at specific sites

DNA polymerase III adds nucleotides to both ends of the RNA primer. to the 3' end of the RNA primer. to internal sites in the DNA template. to the 5' end of the RNA primer. in the place of the primer RNA after it is removed.

to the 3' end of the RNA primer

DNA polymerase III adds nucleotides to the 3' end of the RNA primer. to both ends of the RNA primer. to internal sites in the DNA template. in the place of the primer RNA after it is removed. to the 5' end of the RNA primer.

to the 3' end of the RNA primer

The β chain of adult hemoglobin is composed of 146 amino acids of a known sequence. In comparing the normal β chain with the β chain in sickle cell hemoglobin, what alteration is one likely to find? extensive amino acid substitutions trinucleotide repeats glutamic acid replacing valine in the first position valine instead of glutamic acid in the sixth position frameshift substitutions

valine instead of glutamic acid in the sixth position

The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. complementation analysis, enhance temperature extremes, enhance epistasis analysis, enhance visual examination, eliminate chemical removal, activate

visual examination, eliminate

The secondary structure of a protein includes the following elements: disulfide bridges. gamma and delta. hydrophobic clusters. alpha and gamma. α-helix and β-pleated sheet.

α-helix and β-pleated sheet