BIO151 EXAM 2 PRACTICE QUESTIONS

HIV (human immunodeficiency virus), the virus that causes AIDS, is a retrovirus. HIV reverse transcriptase makes:

A DNA copy of the HIV RNA genome.

Which of the following organisms can be infected by a virus? A. A dog B. A tomato plant C. A bacterium D. A mushroom E. All of the above!

All of the above!

A "nonself" substance that can provoke an immune response is an:

Antigen

Given what we know about mRNA, where would the translation termination sequence of a gene be found?

At the 3' end of the mRNA

DAS181, also known as Fludase, is an experimental antiviral drug for the treatment of influenza (flu). It acts by binding with the receptor protein on the surface of epithelial cells of the nose, throat, and respiratory system. Which step in the viral life cycle does Fludase inhibit (stop)?

Attachment

How does the ribosome from the video know where to begin translation along the mRNA? A. Beginning at the poly-A tail, it scans until it reaching 3'-GUA-5' B. Translation begins at every AUG (the start codon) along the transcript. C. Beginning at the 5'-guanine cap, it "scans" until it reaches 5'-AUG-3'. D. Beginning at the 3'-guanine cap, it "scans" until it reaches 3'-AUG-5'.

Beginning at the 5'-guanine cap, it "scans" until it reaches 5'-AUG-3'. - eukaryotic cell

RNA GCAGCC DNA 5'-GCGCGTCGGTACA-3' Above is a DNA template and a partial mRNA transcript. What will the next RNA base be?

C

If a particular mRNA sequence has a cytosine content of 25%, what is its adenine content?

Cannot be determined - single stranded - = no complimentary base pairing (need to know 3 to figure out the other 1)

A cell is infected with a retrovirus and the viral DNA has been inserted into the host cell genome. When will the viral DNA be replicated?

During S-phase of the cell cycle

Which of the following statements are true? I. All RNA is translated to generate proteins. II. All introns have identical lengths and sequences. III. An exon is considered a "coding sequence" of DNA, and its information is retained in the processed mRNA within a cell. IV. The poly-A tail contributes to mRNA stability

III, IV

HIV is a retrovirus. Raltegravir is a drug given to HIVpositive individuals. It blocks the action of integrase. Which of the following statements are true regarding Raltegravir? I. Raltegravir acts by preventing the viral genome from entering the host cell cytoplasm. II. One side effect of Raltegravir is that it prevents transcription in eukaryotic cells. III. Cells treated with Raltegravir will only contain viral RNA, not viral DNA. IV. When cells treated with Raltegravir undergo cell division, the viral genome is not replicated.

IV only

Where in a eukaryotic cell, where are transcription factors active (doing their job)?

In the nucleus Any proteins involved will be active in the nucleus

Polycistronic RNA (prokaryotes)

Molecules of mRNA that code for multiple proteins

Is the promoter transcribed during transcription?

No

Why do DNA and RNA have overall negative charges?

The phosphate group that makes up every nucleotide is negatively charged.

What happens during translation when the ribosome comes across a second (or third) 5'-AUG-3'? A. Each 5'-AUG-3' is another start codon, so translation begins there. B. The ribosome adds another methionine to the growing polypeptide. C. Translation stops. D. A black hole forms on the other side of the universe.

The ribosome adds another methionine to the growing polypeptide.

Which of the statements below is FALSE? A. The promoter and termination sequences are not made into mRNA. B. RNA polymerase adds nucleotides to the RNA transcript. C. Transcription initiation occurs when RNA polymerase and transcription factors recognize a promoter sequence along the coding strand of DNA. D. Transcription occurs in the 3'-5' direction along the DNA template forming an mRNA in the 5'-3'direction with nucleotides added to the 3' end

Transcription initiation occurs when RNA polymerase and transcription factors recognize a promoter sequence along the coding strand of DNA. - not coding strand - template strand

You are analyzing a sample in the lab and you need to determine if it is a prokaryotic cell, eukaryotic cell, or virus. The sample has DNA, proteins, and no lipid membranes. The sample is most likely a:

Virus

SARS-CoV2

a RNA virus that causes COVID-19

Codon:

a sequence of three RNA nucleotides that corresponds with a specific amino acid or stop signal. - Codons specify which amino acids are added to a polypeptide

Proteins are polymers of __________ joined by ____________ bonds

amino acids, peptide bonds

Influenza

an RNA virus that causes the flu

RNA-dependent RNA polymerase (RdRp)

an enzyme that catalyzes the replication of RNA from an RNA template

A few amino acids joined together are called ___________________.

peptides

Many amino acids joined together are called ___________________.

polypeptides

HIV (causes AIDS)

retrovirus

While a cell was replicating its DNA, a mutation occurred that didn't change the sequence of amino acids. The type of mutation that occurred was probably a...

silent mutation

First vaccine

smallpox

Bacteriophages

viruses that infect bacteria

In most cases, introns are spliced out of mature messenger RNA (mRNA) and are not a part of the final translated protein product of a gene. Even though they are not included in the final protein, why are introns important?

- Introns can generate non coding RNAs that influence gene expression - Introns allow for alternative splicing of exons to create multiple proteins from one gene sequence - Introns are involved in some special regulatory functions like mRNA export and non-sense mediated decay.

In prokaryotes, transcription takes place in the

cytoplasm (no membrane bound organelles)

There are 5 main types of vaccines:

1. Live -attenuated vaccines 2. Inactivated/dead vaccines 3. Toxoid vaccines 4. Subunit or conjugate vaccines 5. mRNA vaccines

If a particular DNA sequence has a guanine content of 30%, what is its adenine content?

20%

The DNA template strand is read

3'-5'

The codon 5'-GCA-3' bonds with which anticodon? A. 5'-CGU-3; B. 3'-GCA-5' C. Alanine D. 3'-CGU-5'

3'-CGU-5' - complimentary base pairing

Translation starts at the ___end of the mRNA and amino acids are added to the________ of the growing polypeptide.

5', C -terminus.

If the sequence of an RNA transcript is 3'-CAGCUUAAGCUAGCUAUGA-5' Then which of the following must be the sequence of the DNA template used by RNA polymerase to produce this RNA?

5'- GTCGAATTCGATCGATACT - 3'

RNA polymers are synthesized

5'-3'

If a strand of DNA has the sequence 3'-CATAC-5', then what is the sequence of the complementary DNA strand?

5'-GTATG-3' Translating DNA - DNA = no U (not RNA)

In a prokaryote, a polycistronic mRNA with six protein coding genes has:

6 start codons, 6 Shine-Dalgarno sequences, and 6 stop codons.

An mRNA is 30 bases long and has the following sequence. 5' - AGUGGCAUGCCACGUGGGCAACGAUGCUGA - 3' How many amino acids long would the protein be that is translated from this mRNA?

7

Which of the following mutations would result in a SARS - CoV-2 virus that that would spread more quickly among people? A. A mutation in the gene coding for the spike protein responsible for recognizing the ACE2 receptor on the host cell. This mutation changes the spike proteins slightly so that they interact more loosely with the ACE2 receptors. B. A mutation in the gene coding for the SARS -CoV-2 capsid proteins. The mutated proteins prevent the capsid from forming. C. A mutation in the gene that codes for RNA -dependent RNA polymerase. The mutation causes the enzyme to work faster. D. A mutation in the gene coding for the spike protein responsible for recognizing the ACE2 receptor on the host cell. This mutation makes the spike proteins a completely different shape.

A mutation in the gene that codes for RNA -dependent RNA polymerase. The mutation causes the enzyme to work faster.

Retroviruses

A type of RNA virus that inserts a copy of its genome into the DNA of the host cell. - Retroviruses change the host cell's genome.

The codon 5'-CAA-3' is translated to which amino acid? A. Histidine B. Proline C. Glutamine D.Asparagine

Glutamine

tRNAs that carry different amino acids A. Bind to different ribosomes. B. Have different anticodons. C. Have different codons. D. Have different shapes.

Have different anticodons.

Which of the following are ways that translation initiation in prokaryotes is different than in eukaryotes? I. Prokaryotic mRNA lacks a 5' cap. II. Prokaryotes lack ribosomes. III.Prokaryotes can have polycistronic mRNA, so there can me multiple start codons on a single strand of prokaryotic mRNA. IV. mRNA is read 3'-5' in prokaryotes, so the start codon is 3'-GUA-5'

I and III

Which of the following statements are true? I. RNA has an OH on its 2` carbon and DNA has an H on its 2' carbon. II. DNA prefers to be double-stranded, RNA prefers to be single-stranded. III. DNA and RNA have identical nitrogenous bases. IV. DNA has a 5-carbon sugar in its backbone, RNA has a 6-carbon sugar. V. Phosphodiester covalent bonds link nucleotides together in both RNA and DNA. VI. Covalent bonds link together complementary DNA strands.

I, II, V

What will happen when the ribosome shifts one codon further on the mRNA, assuming the next codon is not a stop codon? I. The tRNA carrying the polypeptide will be in the P site. II. The sites of the ribosomes will be relabeled (from left to right) P, A, E. III. A new tRNA will bind to the ribosome in the A site. IV. The tRNA that is shown in the A site will be ejected from the ribosome. V. The tRNA that has the UAC anticodon will move to the E site and exit the ribosome.

I, III, V

Which of the following correctly describes genetic material in viruses and cells? I. RNA is mostly single-stranded in cells. II. RNA is mostly double-stranded in cells. III.DNA is mostly single-stranded in cells. IV.DNA is mostly double-stranded in cells. V. A single virus can have RNA and DNA. VI.Virus can have single-stranded DNA

I, IV, VI

How might a mutation in a splice site, so that an exon is ignored (i.e. an exon is treated like an intron), affect an organism? I. The mutant DNA might not be transcribed to RNA. II. The mutant protein might not get translated. III. The mutant protein might lack an intron. IV. The mutant protein might be longer than the normal protein. V. The mutant protein might be shorter than the normal protein.

II, IV, V

Which of the following statements about transcription are true? I. RNA polymerase reads the coding strand of DNA. II. Nucleotides are added to the 5' end of the growing RNA molecule. III. DNA is read 3'-5'.

III only I. not coding strand - reads the template stranded II: added to the 3' end, not the 5' end

Which of the following correctly describes the role of phagocytes in the immune response? A. Phagocytes are red blood cells that "eat" invading pathogens as part of the innate immune response. B. Phagocytes are white blood cells that "eat" invading pathogens as part of the adaptive immune response. C. Phagocytes are white blood cells that "eat" invading pathogens as part of the innate immune response. D. Phagocytes are white blood cells that respond to specific pathogens by using antibodies.

Phagocytes are white blood cells that "eat" invading pathogens as part of the innate immune response.

Most bacteriophages have double-stranded DNA genomes. A bacteriophage with a double-stranded DNA genome infects a bacterium. Which of the following proteins will be active in the bacterial cell during transcription of the viral genome?

RNA Polymerase, Sigma Factor

If you made a change in the promoter sequence in the DNA that inactivated the promoter, then what would happen?

RNA polymerase would not be able to bind to the DNA, so no RNA would be made.

Which viruses have the highest mutation rates?

RNA viruses

Ouabain is a plant compound that was traditionally used as an arrow poison in eastern Africa for both hunting and warfare. It also has antiviral properties and has been shown to work against the flu virus. It inhibits the Na -K pump, which is used by cells during gene replication. Which step in the viral life cycle does ouabain inhibit?

Replication & gene expression

Given what you know about the process of transcription, what would you predict reverse transcription is?

Reverse transcription is making DNA from RNA

In eukaryotes, transcription takes place in the

nucleus

True of False: SARS CoV2, the virus that causes Covid-19, is a retrovirus.

false

True or False: Because there are three different possible reading frames in a mRNA molecule, most mRNAs can be translated into three different proteins.

false - only get 1 protein

In the DNA sequence 5'-ATCC-3', the phosphodiester bond between the thymine and the cytosine connects:

the 3' end of the thymine to the 5' end of the cytosine.