biology 1121 chapter17
Gene Size
- Prokaryotes smaller genomes than eukaryotes -Eukaryotes, no relationship between genome size and phenotype see corn/ mouse/giant panda
regulatory gene
A gene that codes for a protein, such as a repressor, that controls the transcription of another gene or group of genes.
inducible enzymes
An enzyme whose transcription can be stimulated by an abundance of its substrate (as opposed to repressible enzyme). Usually in catabolism.
Yes, if the mother is AO
Can a mother with type A blood and a father with type O blood have a child with type O blood?
Describe polymerase chain reaction and explain the advantages and limitations of this procedure.
Can produce many copies of a specific target segment of DNA within a short amount of time, but it is more prone to errors. Like a photocopier of identical DNA molecules
Unlike eukaryotic organisms, prokaryotic organisms have a single ____ chromosome.
Circular
Comparing the human genome to that of other organisms is called ____ genomics.
Comparative
foreign DNA
DNA that belongs to a different species or DNA that is artificially synthesized
Microevolution
Evolution within a population.
True or false: Short tandem repeat fingerprinting can be used to identify cancer in humans.
False
highly conserved genes
Genes that have remained similar in distantly related species that diverged from each other long ago
Aa
If AA is crossed with aa, what's the genotype of 100% of the offspring?
What can cDNA not be used for in terms of information storage
It cannot be used to create a complete genomic library because it is derived from mRNA and only contains exons not the complete genome
The primary applications for this technology are in and is also used in
Medicine: Vaccines Antibiotic Production (the first antibiotic discovered was penicillin) Agriculture: crop genetic modification to increase yields used in: fermentation, treating oil spills and producing biofuels
An accessory ring of DNA in bacteria, often used as a vector in gene cloning, is a(n) _____.
Plasmids
Many proteins modify themselves after translation by processes such as
Proteolytic cleavage Phosphorylation Glycosylation Ubiquitination
Gel Electrophoresis
Separates DNA fragments based on length
electroporation
a brief electrical pulse applied to a solution containing cells creates temporary holes in their plasma membranes, through which DNA can enter
Ti plasmid
most commonly used vector for introducing new genes into plant cells
cytogenetic mapping
technique that uses a microscope to create a map from stained chromosomes
which of the following explains why we need a broader definition of gene?
-Some prokaryotes ave RNA genes -The end product of some DNA is RNA (not a protein) -Genes can be split across several loci across the genome
How many times does a restriction enzyme cut a double stranded piece of DNA at a given restriction site?
2
what is the estimated number of genes found in the human genome
25,000
Evolution
A change in a species over time
which of the following technologies also happens naturally?
Gene cloning
There is interest in injection p53, a tumor suppressing gene, into cancer cells. This is an example of"
In vivo gene therapy
epigenetic inheritance
Inheritance of traits transmitted by mechanisms not directly involving the nucleotide sequence.
Gene therapy
Insertion of genetic material into human cells for the treatment of a disease
DNA regions that reside between genes on a chromosome are called ____ sequences.
Intergenic
Cloning
The production of genetically identical copies of DNA, cells or organisms through asexual means
Why does the DNA polymerase used for PCR need to come from the organism THERMUS AQUATICUS?
This organism produces a DNA polymerase that can withstand heat
proteome
entire set of proteins produced by a cell type
Polygenic
which is a phenotypic characteristic that involves two or more genes, and also involve environmental factors such as diet.
which of the following are applications of transgenic bacteria?
-Product of insulin -Clean up oil spills -Production of growth hormone
____ therapy delivers the gene to the body or cells directly.
In vivo gene
Why does a dideoxyribonucleotide terminate a growing DNA strand?
It lacks a 3' -OH group which is where the next nucleotide is supposed to attach
Reverse transcriptase copies ______ to _______.
RNA, DNA
A scientist used reverse transcriptase to make cDNA from isolate cellular mRNA. After the cDNA is produced, it is used as a template in a PCR reaction. This is known as ________.
RT-PCR
The level of a particular mRNA in a cell can be determined using ______.
RT-qPCR
Order the 3 steps of a PCR cycle from the first to last step, starting at the top.
1. Heating to denature/separate DNA strands 2. Lowering the temp to allow for primer annealing to template DNA 3. Incubating at a temp that allows the synthesis of the complementary strand.
The identification of specific DNA sequences in complex mixtures can be achieved using which of the following techniques? 1. Hybridization 2. DNA sequencing 3. Polymerase chain reaction
1. Hybridization
List the sequential order of events that occur during the production of recombinant DNA (rDNA)
1. Identify an mRNA from a target gene 2. Use reverse transcriptase to produce a complementary DNA 3. Cleave the cDNA and vector DNA with same restriction enzyme 4. Introduce DNA ligase to connect sticky ends of DNA 5. Allow vector to reproduce to clone the gene
Human Genome Project
13-year multi-institutional effort to identify the sequence of all the bases (As, Ts, Cs & Gs) of all of the human chromosomes
what year did genetic engineering start
1973
Genome comparison
Comparison of the human genome to the genomes of other organisms
How does the Ti plasmid make genetic engineering in plants a possibility?
It is from a soil bacterium that integrates a specific segment of its DNA into the host cells DNA. This certain segment can be modified to contain the desired gene.
What does pluripotent mean?
Ex. Embryonic stem cells. they are capable of differentiating into many different cell types but cannot form an entire organism like totipotent.
What is in situ hybridization?
use of fluorescent dyes attached to probes to identify the location of specific mRNAs in place in the intact organism.
microsatellite polymorphism
variation between individuals in the sequence and number of microsatellite DNA repeats
microsatellite polymorphism
variation between individuals in the sequence and number of repeats of microsatellite DNA
variable number of tandem repeats (VNTRs)
variation in the number of tandem repeats between individuals in the population
Define polymorphisms
variations in DNA sequence among a population
short tandem repeats (STRs)
variations in length of genetic markers that are used by forensic scientists to generate a genetic profile. Tandemly repeated units of two to five nucleotide sequences in specific regions of the genome
A lab technician can introduce rDNA into a host cell using a ____.
vector
Northern Blotting
Transfer of RNA from a gel to a nylon membrane Detect the gene expression
true or false: The word 'fingerprinting" is used to describe the technology of DNA fingerprinting because like a fingerprint, each human has their own unique DNA pattern.
True
Restriction fragment length polymorphisms (RFLP)
We can detect RFLPs when the DNA of an individual is cut with a restriction endonuclease that recognizes specific sequences in the DNA to generate a series of DNA fragments, which we can then analyze using gel electrophoresis. Every individual's DNA will give rise to a unique pattern of bands when cut with a particular set of restriction endonucleases (an individual's DNA "fingerprint." ) Certain chromosome regions that are subject to polymorphism will lead to generating the unique banding pattern.
100%
What % of Mendel's F1 plants showed the dominant phenotype?
1. there are no mutations 2. there is no gene flow 3. there is random mating 4. there is no genetic drift 5. there is no selection
What 5 things must occur in order for the Hardy-Weinberg Principle to occur
pharmaceuticals, frost and pest resistance for plants, bioremediation (clean up oil spills)
What are some uses for transgenic bacteria?
Better crop yield, Disease resistance, Pest resistance, Herbicide resistance
What are some uses for transgenic plants?
1. There are variations within a population 2. In a population, more individuals are produced than the environment can support. 3. Some individuals have characteristics that allow them to survive and reproduce better than other individuals 4. The result is a population that is better adapted to its environment.
What are the major points of Darwin's theory of evolution by natural selection?
Finches
What birds did Darwin study on the Galapagos Islands?
Macroevolution
What is evolution at the species or higher level of classification?
1:1
What is the genotypic ratio?
Pleiotropy
What is the term that is used to describe When one gene affects many traits in an individual?
Polygenic inheritance
What is the term that is used to describe when more that one gene controls a genetic trait?
epistasis
What is the term that is used to describewhen one gene interferes with the expression of another gene?
Codominance
What is the term used to describe when both alleles in an individual are expressed.
microRNAs
can bind to complementary sequences on mRNA molecules either degrading the target mRNA or blocking its translation
Heterozygote advantage
What is the term used to describe when heterozygotes tend to be healthier and have an advantage over homozygotes? For Example: Persons heterozygous for Sickle cell disease are resistant to malaria.
Incomplete dominance
What is the term used to describe when two alleles for a gene blend their expression in a heterozygote?
genetic drift
What term is used to describe changes in the gene pool due to chance?
gene flow
What term is used to describe movement of alleles into or out of a population through immigration or emigration of breeding individuals?
assortative mating
What term is used to describe when an individual chooses an individual of the same phenotype as a mate?
nonrandom mating
What term is used to describe when mates are selected by their phenotypes or genotypes?
bottleneck effect
What type of genetic drift occurs if a disaster occurs and a few survivors are left to re-establish the population?
Founder effect
What type of genetic drift occurs if individuals are isolated from the main population and reproduce to form a new population?
allopatric speciation
What type of postzygotic isolation mechanism occurs due to evolution into a new species occurs because of geographic isolation?
sympatric speciation
What type of postzygotic isolation mechanism occurs due to evolution into a new species occurs without geographic isolation?
behavioral isolation
What type of prezygotic isolation mechanism occurs due to species having different courtship patterns or mating rituals?
mechanical isolation
What type of prezygotic isolation mechanism occurs due to species having genitalia or plant floral structures that are not compatible?
habitat isolation
What type of prezygotic isolation mechanism occurs due to species living in separate habitats and are geographically isolated?
temporal isolation
What type of prezygotic isolation mechanism occurs due to species reproducing at different times of the year?
stabilizing selection
What type of selection that favors an intermediate phenotype?
directional selection
What type of selection that favors one extreme phenotype?
disruptive selection
What type of selection that favors two opposite extreme phenotypes?
Wallace
Who independently developed a theory of evolution by natural selection that was practically identical to that of Darwin?
Wallace
Who presented a joint paper with Darwin?
Had closed flowers, so each plant self pollinated. Could open the flowers and cross pollinate in a controlled fashion. Many pure breeding varieties were available Had many distinct traits
Why was the garden pea a good choice for Mendel to do his experiments?
hemophilia
X-linked recessive trait, causes blood clotting problems
colorblindness
X-linked recessive trait, causes difficulty in distinguishing red and green
males
X-linked traits are more common in (males or females?) because they have fewer alleles for all X-linked traits
When performing nuclear transplantation, can the nucleus from a differentiated cell direct development of an organism?
Yes, but it is better to have a less differentiated cell because the age of the donor is inversely related to normal development.
totipotent
a cell that can generate a complete new organism
expression vector
a cloning vector that contains a highly active bacterial promoter upstream of a restriction site where the eukaryotic gene can be inserted.
Heterozygous
a condition where an organism has two different alleles for a gene.
Homozygous
a condition where an organism has two identical alleles for a gene.
Testcross
a cross used to determine if an organism is homozygous or heterozygous for a trait
plants are expected to be genetically engineered to have
a decreased susceptibility to herbicides
lac operon
a gene system whose operator gene and three structural genes control lactose metabolism in E. coli, inducible operon
recombinant protein
a gene's protein product derived by molecular cloning
RNA sequencing
a method of analyzing large sets of RNAs that involves making cDNAs and sequencing them
What is electroporation?
a method to introducing recombinant DNA into eukaryotic cells. Brief electrical pulse is applied, creating temporary holes in the plasma membrane
recombinant DNA molecule
a molecule containing DNA from two different sources, often different species.
In recombinant DNA, the term vector can refer to___
a plasmid used to transfer DNA into a living cell
Golden rice produces B-________ in the endosperm of the rice.
carotene
what is the function of a vector in genetic engineering
carry DNA into a new cell
Ex-vivo therapy removed ____ from the body, genetically, modifies them, and then reinserts them.
cells
which of the following is false about in vivo gene therapy
cells or tissues are removed from the body, given the new gene, and then returned to the body
Ex Vivo Gene Therapy
cells or tissues are removed from the patient, modified, & replaced into the patient
antibiotic resistance
ability of an organism to be unaffected by an antibiotic's actions
antibiotic resistance
ability of an organism to be unaffected by the actions of an antibiotic
What are some drawbacks to PCR?
despite its speed and specificity, occasional errors occur during PCR and it has a limit to how many good copies can be made. Problems arise when large amounts of DNA are desired or when the DNA fragments themselves are very long.
Hybridization allows scientists to_______
detect a specific DNA sequence in a complex mixture.
genetic diagnosis
diagnosis of the potential for disease development by analyzing disease-causing genes
What was the first technique developed to sequence DNA?
dideoxyribonucleotide chain termination method
Define genetic engineering
direct manipulation of genes for practical puropses
Organism complexity is ____ related to its proportion of non-gene DNA.
directly
reproductive cloning
entire organism cloning
proteome
entire set of proteins that cell type produces
Why do clones not always look or behave exactly the same?
environmental influences, methylation patterns, random X chromosome inactivation
DNA ligase
enzyme that bonds together cut pieces of DNA
ribonuclease
enzyme that breaks down RNA
protease
enzyme that breaks down proteins
restriction endonuclease
enzyme that can recognize and cleave specific DNA sequences
codominance
inheritance pattern where the heterozygote's phenotype contains both the dominant and the recessive appearance
incomplete dominance
inheritance pattern where the heterozygote's phenotype is an intermediate appearance between the dominant and recessive traits, but different from each
In Vivo Gene Therapy
inserting genes directly into a patient via viral "infection," injection, digestion, or nasal spray
Type 1 diabetes cannot be cured, but can be managed with daily _____ injections.
insulin
A(n) ____ repeat is a type of repetitive DNA element that is spread across several regions of a chromosome.
interspersed
If a segment of non-coding DNA contained a sequence TTAG every 2,000 bases throughout the entire chromosome, you would call this a(n) ____ repeat.
interspersed
Most nucleic acid extraction techniques
involve steps to break open the cell and use enzymatic reactions to destroy all macromolecules that are not desired (such as unwanted molecule degradation and separation from the DNA sample).
Pharmacogenomics, or toxicogenomics,
involves evaluating drug effectiveness and safety on the basis of information from an individual's genomic sequence. Studying changes in gene expression could provide information about the transcription profile in the drug's presence, which we can use as an early indicator of the potential for toxic effects. Genome-wide studies can also help to find new genes involved in drug toxicity. Medical professionals can use personal genome sequence information to prescribe medications that will be most effective and least toxic on the basis of the individual patient's genotype.
What is in vitro mutagenesis?
involves mutating a gene to destroy or alter its function and observe the effects it has when returned to the cells.
Metabolomics
involves studying small molecule metabolites in an organism. Metabolomics offers an opportunity to compare genetic makeup and physical characteristics, as well as genetic makeup and environmental factors.
Most current therapies involving stem cells use ______ stem cells, which can be used to treat damage to connective tissues such as bone and cartilage.
mesenchymal
gene targeting
method for altering the sequence of a specific gene by introducing the modified version on a vector
chain termination method
method of DNA sequencing using labeled dideoxynucleotides to terminate DNA replication; it is also called the dideoxy method or the Sanger method
reverse genetics
method of determining the function of a gene by starting with the gene itself instead of starting with the gene product
reverse genetics
method of determining the gene's function by starting with the gene itself instead of starting with the gene product
Reverse Genetics
method of determining the gene's function by starting with the gene itself instead of starting with the gene product.
DNA microarray
method to detect gene expression by analyzing many DNA fragments that are fixed to a glass slide or a silicon chip to identify active genes and identify sequences
DNA microarray
method used to detect gene expression by analyzing an array of DNA fragments that are fixed to a glass slide or a silicon chip to identify active genes and identify sequences
shotgun sequencing
method used to sequence multiple DNA fragments to generate the sequence of a large piece of DNA
DNA ____ have microsopic amounts of DNA sequences on a glass slide, which allow visualization of which genes are turned on in specific cells.
microarrays
a biologist is working to insert genes into eggs by hand, what technique would they use
microinjection
genetically modified organism (GMO)
organism whose genome has been modified by genetic engineering.
transgenic organisms
organisms that have been genetically modified by inserting genes from another type of organism
cloning vector
original plasmid in gene cloning that carries foreign DNA into a host cell and replicate there.
genetic map
outline of genes and their location on a chromosome
The sequence recognized by restriction enzymes are often ___________, meaning that the sequence is identical when read in the opposite direction on the complementary strand.
palindromes
DNA libraries containing small pieces of DNA are usually propagated using bacterial ______. When libraries contain large fragments of DNA, they are usually propagated using bacterial or yeast ______ chromosomes.
plasmid , artificial
Ti plasmid
plasmid system derived from Agrobacterium tumifaciens that has been used by scientists to introduce foreign DNA into plant cells
Ti plasmid
plasmid system derived from Agrobacterium tumifaciens that scientists have used to introduce foreign DNA into plant cells
Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problem of ____?
post-transcriptional processing (bateria dont have these capabilities like eukaryotes)
Wastewater can be treated in two or three stages. The three stages are, in the order in which they are performed, _____, ______, and ______ treatment.
primary, secondary, and advanced
physical map
representation of the physical distance between genes or genetic markers
A major goal of proteomics is to identify and determine the function ____ within a particular cell type.
protein
What kind of applications can genetic modifications have?
protein producing animals, environmental cleanup, improve agricultural products
recombinant protein
protein product of a gene derived by molecular cloning
Recombinant Proteins
proteins that are expressed from recombinant DNA molecules. *Not all recombinant plasmids are capable of expressing genes. The recombinant DNA may need to move into a different vector (or host) that is better designed for gene expression. Scientists may also engineer plasmids to express proteins only when certain environmental factors stimulate them, so they can control the recombinant proteins' expression.
A plant cell whose whose cell wall is removed is called a(n) ____.
protoplast
Cytogentic Maps
provides the starting point for more detailed mapping of the human genome
A scientist amplifies a region of DNA using PCR conditions which increase the error rate of TAQ polymerase. In this case, the scientist is performing PCR-based _____ _____.
random mutagenesis
PCR works by amplifying short tandom ____ sequences (STRs), sequences of DNA that are repeated many times and are considered noncoding.
repeat
TALE proteins contain several sets of a repeating 34 amino acid sequence known as the TALE _____ _____.
repeat domain
genomics
study of entire genomes including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species
metagenomics
study of multiple species' collective genomes that grow and interact in an environmental niche
proteomics
study of proteomes' function
metabolomics
study of small molecule metabolites found in an organism
metabolomics
study of small molecule metabolites in an organism
proteomics
study of the function of proteomes
Proteomics
study of the structure, function, & interaction of cellular proteins
systems biology
study of whole biological systems (genomes and proteomes) based on interactions within the system
genomics
study of whole genomes, including genes and their functions
DNA cloning
the production of multiple copies of a specific DNA segment
what is gene pharming
the production of pharmaceuticals by animals
metagenomics
the study of the collective genomes of multiple species that grow and interact in an environmental niche
the human proteome is the complete collection of proteins that humans produce. T/F
true
the mail goal behind therapeutic cloning is to provide cells that can be used to treat human illness T/F
true
reverse transcriptase polymerase chain reaction: RT-PCR
turns sample sets of mRNAs into double stranded DNAs with the corresponding sequences. Then, using the cDNAs produced, PCR is used to amplify samples
biotechnology
use of biological agents for technological advancement
biotechnology
use of biological agents for technological advancements
Reverse transcriptase catalyzes which reaction?
RNA to DNA
Barbara McClintocks
-During transposition a transposable element moves from one site in a cell's DNA to a different target site by a type of recombination process -"Jumping gene"
One can store the DNA samples frozen at what temperature for several years?
-80°C
What are some of the advantages of molecular pharming in animal versus bacteria?
-Animals can make large quantities of the protein products -Proteins remain stable and do not degrade quickly -Animals can fold the proteins properly.
Of the list below, which two answers components necessary for the polymerase chain reaction to occur.
-DNA polymerase -Nucleotides
Which of the following are direct applications of bioformatics?
-Determining the function of genes -Comparison of our genome to model organisms -Discovering the interplay of genes and proteins in our cells.
what type of information can be gained from studying whole genomes?
-Function of genes -Function of intergenic sequences -Sequence of bases -Function of introns.
choose the characteristics of structure of eukaryotic chromosomes
-Genes are fragmented into exons and introns -Genes randomly distributed -More complex than prokaryotic chromosomes
Identical Gene Families
-Genes for the three largest rRNA molecules; transcribed from a single transcription unit that is repeated tandemly hundreds to thousands of times in one several clusters in the genome of a multicellular eukaryote - Helps makes millions of ribosomes needed for active protein synthesis
Genomics seeks to determine ____
-How many genes we have -The sequence of the bases in DNA
select the benefits of using genetically modified plants?
-Increased crop yield -Pest resistant crops -Herbicide resistant crops -Production of human proteins.
Three Stages of the Human Genome Project
-Linkage mapping -Physical mapping -DNA sequencing
which of the following are vectors that have been used for in vivo gene therapy?
-Liposomes -Lentiviruses -Adenoviruses
a new form of genome editing called ____ is being researched to allow pigs to grow additional organs for human transplant.
CRISPR
Number of Genes
-Prokaryotes 1.5-7.5k vs. Eukaryotes 5-40k -Lower than expected in E considering genome size in human thought there would be 50-100k genes but there are less than 21k -Get more bang for buck b/c of alternative splicing, post translational modification of proteins regulation by mRNA etc.
Gene Density
-Prokaryotes have a greater density than eukaryotes -Mammals have the lowest gene density so far -Average Prokaryotic gene is 1000bp -Average Eukaryotic gene is 27,000bp- lots of introns in addition - more complex regulatory sequences genes interspersed w/ vast amount of non-protein coding regions
Select the choices that may refer to a plasmid.
-Prokaryotic DNA -Vector
Transposons are able to
-Regulate the activity of other genes -Play a role in evolution of organisms
Which of the following are possible functions of introns in eukaryotic genes?
-They allow a variety of proteins to be made from a single gene -They can regulate gene expression
National Center for Biotechnology Information (NCBI)
-This is called a GenBank; includes 119 million fragments of genomic DNA, 114 billion base pairs - Doubles about every 18 months
Which of the following are methods for creating genetically modified animals.
-Vortex mixing of animals cells with foreign DNA -Microinjecting foreign DNA directly into egg cells
select applications for PCR from the choices below
-confirming a genetic disorder -Evolutionary studies -Confirming a cancer -Confirming paternity -DNA fingerprinting -Confirming a viral infection.
Choose all advantages of biofuels. 1. They are environmentally friendly because the carbon in them is derived from atmospheric CO2 2. They are renewable 3. The reduce emissions, because when they burn, no greenhouse gases are produced. 4. They are burned much more efficiently than fossil fuels.
1 and 2
Which of the following are examples of Bt crops? 1. Corn 2. Cotton 3. Wheat 4. Strawberries
1 and 2 1. Corn 2. Cotton
Why are primers needed in PCR (choose all that apply)? 1. They allow DNA polymerase to extend the sequence of interest. 2. They allow the amplification of a specific DNA sequence. 3. They are the source of nucleotides for DNA polymerase. 4. They are needed to separate the double-stranded DNA into two single strands.
1 and 2 1. They allow DNA polymerase to extend the sequence of interest. 2. They allow the amplification of a specific DNA sequence.
What two modifications must be made to the Cas9 protein in order to use the CRISPR/Cas9 system to modulate gene expression? 1. The Cas9 is fused to a transcriptional activator or repressor 2. The nuclease activity of the Cas9 is enhanced by adding a green fluorescent protein 3. The Cas9 is made nuclease deficient 4. Several TALE repeats are added to Cas9
1 and 3 1. The Cas9 is fused to a transcriptional activator or repressor 3. The Cas9 is made nuclease deficient
Which of the following describe the significance of discovering restriction enzymes? 1. They allow the creation of recombinant molecules by cutting DNA molecules at particular sequences. 2. They can be used to sequence DNA and RNA molecules 3. They can be used to map the genome of an organism 4. They can be used to produce DNA molecules from RNA molecules and vice versa.
1 and 3 1. They allow the creation of recombinant molecules by cutting DNA molecules at particular sequences 3. They can be used to map the genome of an organism
Identify two benefits of glyphosate resistant plants. 1. No weeding is necessary 2. Glyphosate is a narrow spectrum herbicide 3. No need to water the plants 4. Glyphosate breaks down readily in the environment
1 and 4 1. No weeding is necessary 4. Glyphosate breaks down readily in the environment
From the list below, identify the general approaches used to introducing foreign DNA into plant cells. 1. Electroporation 2. Physical bombardment 3. Using bacteria to transfer genes 4. Growing hydroponic plants in a solution containing DNA vectors 5. Creating knockout plants using the same approach as creating knockout animals.
1, 2, 3 1. Electroporation 2. Physical bombardment 3. Using bacteria to transfer genes
Choose all features of probes used in qPCR. 1. They have a fluorescent tag added to one end. 2. They have a quencher molecule added to one end. 3. They are about 50-100 nt long. 4. They are about 20-30 nt long. 5. They can bind a fluorescent dye used to detect DNA synthesis in real time.
1, 2, and 4 1. They have a fluorescent tag added to one end. 2. They have a quencher molecule added to one end. 4. They are about 20-30 nt long.
What are knockout mice used for? 1. To determine if a gene is essential for survival or not. 2. To introduce genes from other species into mammals 3. To identify during which developmental stage a gene functions. 4. To determine the function of a gene. 5. To produce embryonic stem cells.
1, 3, 4 1. To determine if a gene is essential for survival or not. 3. To identify during which developmental stage a gene functions. 4. To determine the function of a gene.
Chose all applications of environmental biotechnology. 1. repair environmental damage 2. use microbes instead of chemical processes to make complex drugs 3. increase the sustainability of resources 4. produce genetically engineered crops with better nutrition 5. reduce human impact on the environment
1, 3, 5
Chose all applications of RT-PCR. 1. It allows scientists to determine the levels of gene expression in different cells and tissues. 2. It allows scientists to isolate the introns of genes. 3. It allows the production of recombinant DNA molecules from mRNAs. 4. It is used to produce RNA primers for sequencing. 5. It allows scientists to study the structure and function of gene products.
1, 3, and 5 1. It allows scientists to determine the levels of gene expression in different cells and tissues. 3. It allows the production of recombinant DNA molecules from mRNAs. 5. It allows scientists to study the structure and function of gene products.
A cloning vector must contain which of the following? 1. A selectable marker 2. A non-selectable marker 3. Several promoters with varying strength 4. A sequence that allows replication in a host organism 5. Restriction nuclease or combination sites
1, 4, 5 1. A selectable marker 4. A sequence that allows replication in a host organism 5. Restriction nuclease or combination sites
Select all features of the Ti plasmid. 1. It is carried by the plant pathogen Agrobacterium tumefaciens. 2. It can be used to induce the formation of tissues from individual transformed plant cells (hence its name Ti plasmid). 3. It is carried by nitrogen fixing bacteria, such as Rizhobium. 4. It contains sequences that can transfer part of the plasmid into plant cells. 5. It contains genes that normally cause the formation of a plant tumor.
1, 4, 5 1. It is carried by the plant pathogen Agrobacterium tumefaciens 4. It contains sequences that can transfer part of the plasmid into plant cells 5. It contains genes that normally cause the formation of a plant tumor.
Scientists can use the CRISPR/Cas9 system to "edit" the genome of a cell in vivo. Put the steps in the process in the correct order, starting at the top. 1. The CRISPR/Cas9 system is loaded with the guide RNA and introduced into cells. 2. The CRISPR/Cas9 system associates with the DNA sequence complementary to the guide RNA 3. A guide RNA is designed and synthesized that matches the sequence of DNA that will be edited. 4. Cas9 cuts the DNA 5. Inaccurate repair of the cut DNA results in small deletions or insertions, which lead to loss of gene function.
1. A guide RNA is designed and synthesized that matches the sequence of DNA that will be edited. 2. The CRISPR/Cas9 system is loaded with the guide RNA and introduced into cells. 3. The CRISPR/Cas9 system associates with the DNA sequence complementary to the guide RNA 4. Cas9 cuts the DNA 5. Inaccurate repair of the cut DNA results in small deletions or insertions, which lead to loss of gene function
PLace the steps in ex vivo gene therapy for familial hypercholesterolemia in the correct order. Begin with the first step at the top.
1. A portion of the patient's liver is removed 2. Liver cells are infected with virus carrying normal gene 3. Removed liver portion is reconnected in the patient's body.
Immunoassays can be used to detect viruses or bacteria. Place the steps in the process in the correct order, starting at the top. In this case, a virus is detected.
1. A solid surface is coated with antibodies against the virus of interest. 2. An unknown sample is added. 3. An antibody that has been linked to a fluorescent molecule is added. 4. Fluorescence is detected.
Arrange the steps used to clone a mammal from beginning to end.
1. An egg is collected from a donor and encleated 2. Inject nucleus of somatic cell different donor into encleated egg. 3. The donor egg is induced to start dividing 4. The dividing egg is implanted into a surrogate 5. A clone (of DNA donor) is born.
What is the percentage of genes that code for proteins or is transcribed into tRNAs or rRNAs?
1.5%
Which organism produces toxins that kill certain caterpillars and beetles? 1. Bacillus thuringiensis 2. Escherichia coli 3. Staphylococcus aureus 4. Agrobacterium tumefaciens
1. Bacillus thuringiensis
List the sequential order of events in ex vivo gene therapy of the disease SCID
1. Bone marrow is removed form the patient's body 2. Bone marrow cells are injected with a virus carrying a corrected gene 3. Bone marrow cells are injected into the patient 4. Normal bone marrow cells divide to produce normal blood cells.
Steps for PCR
1. Denaturation: Reaction mixture is heated to separate DNA strands and break hydrogen bonds. 2. Annealing: Strands are cooled to allow primer molecules to hydrogen bond to the target sequence of DNA 3. Extention: the heat-stable polymerase builds a new DNA strand by adding the primers in the 5' to 3' direction. Repeated steps, doubling.
The PCR cycle consists of 3 steps
1. Denaturation: the sample is heated to a high temperature so the DNA strands separate 2.Annealing: the sample is cooled so the primer can anneal to the DNA 3. DNA Synthesis: the sample is warmed, Taq polymerase synthesizes new strands of DNA
Order the steps in creating a knockout mouse starting at the top. 1. Introduce the interrupted gene into embryonic stem cells. 2. Select for cells containing the marker gene. 3. Inject ES cells containing the knocked-out gene into an embryo early in its development. 4. Disrupt the cloned gene with a marker gene using recombinant DNA techniques. 5. Implant the embryo into a pseudopregnant female.
1. Disrupt the cloned gene with a marker gene using recombinant DNA techniques. 2. Introduce the interrupted gene into embryonic stem cells. 3. Select for cells containing the marker gene. 4. Inject ES cells containing the knocked-out gene into an embryo early in its development. 5. Implant the embryo into a pseudopregnant female. 6. Cross transgenic animals to generate homozygous lines.
Explain the four basic steps of gene clothing
1. Gene is inserted into plasmid 2. Plasmid put into bacterial cell 3. Host cell grown in culture to form a clone of cells containing the cloned gene of interest 4. basic research and various applications.
What herbicide kills actively growing plants by inhibiting the enzyme EPSP which is required to produce aromatic amino acids? 1. Glyphosate 2. Greenkill 3. DDT 4. Tordon
1. Glyphosate
Place the steps in the process of plant transformation via particle bombardment in the correct order starting at the top. 1. Plant tissues are grown in vitro and eventually induced to differentiate and produce a mature plant 2. Gold or tungsten nanoparticles are coated with recombinant DNA 3. Plant tissue fragments are "bombarded" with nanoparticles.
1. Gold or tungsten nanoparticles are coated with recombinant DNA 2. Plant tissue fragments are "bombarded" with nanoparticles. 3. Plant tissues are grown in vitro and eventually induced to differentiate and produce a mature plant
Describe how nuclear transplantation was used to produce Dolly, the first cloned sheep
1. Nucleus of an unfertilized egg cell or zygote is replaced with the nucleus of a differentiated cell from a donor sheep. 2. Zygote grows inside a surrogate sheep to develop the clone.
Place the steps of gel electrophoresis in the correct order. Start with the first step on top. 1. Prepare a gel (agarose or polyacrylamide) 2. Apply electrical current 3. Load samples into wells 4. Visualize separated bands
1. Prepare a gel 2. Load samples into wells 3. Apply electrical current 4. Visualize separated bands
Outline the procedures for cloning a eukaryotic gene in a bacterial plasmid.
1. Restriction enzymes cut out restriction fragments. 2. unbound bases bind to foreign gene and is made a part of the plasmid through DNA ligase sealing the bonds at the sticky ends. 3. Foreign gene is replicated with the plasmid's genome. 4. Foreign gene is removed from plasmid after copying.
Place the steps of real time DNA synthesis detection using a probe in the correct order starting at the top with cooling the reaction in the annealing step. 1. The probe anneals to the template at a complementary site located between the two primers. 2. The fluorophore is released from the quencher so its fluorescence can now be detected. 3. The PCR reaction is cooled to the temperature of the annealing step. 4. When TAQ polymerase encounters the annealed probe, it degrades it with its exonuclease activity. 5. TAQ polymerase begins to synthesize new DNA.
1. The PCR reaction is cooled to the temperature of the annealing step. 2. The probe anneals to the template at a complementary site located between the two primers. 3. TAQ polymerase begins to synthesize new DNA. 4. When TAQ polymerase encounters the annealed probe, it degrades it with its exonuclease activity. 5. The fluorophore is released from the quencher so its fluorescence can now be detected.
Place the steps in the process of creating transgenic plants in the correct order starting at the top. 1. Transformed plant cells are induced under the proper nutritional and hormonal conditions to produce a mature plant. 2. The genes responsible for gall formation are replaced with a gene of interest. 3. The Ti plasmid is isolated from A. tumefaciens. 4. The Ti plasmid is re-introduced into A. tumefaciens. 5. A. tumefaciens is used to infect plant cells.
1. The Ti plasmid is isolated from A. tumefaciens. 2. The genes responsible for gall formation are replaced with a gene of interest. 3. The Ti plasmid is re-introduced into A. tumefacines. 4. A. tumefaciens is used to infect plant cells. 5. Transformed plant cells are induced under the proper nutritional and hormonal conditions to produce a mature plant.
During normal insulin production in human cells a large polypeptide is cut to become two smaller peptides connected by a disulfide bond. What happens when cDNA corresponding to the coding region of the insulin gene is inserted into a bacterium? 1. The bacterial cells produce a long polypeptide, because they cannot process proteins in the same way as eukaryotes. 2. The bacterial cells produce highly concentrated, functional human insulin. 3. The bacteria produced a polypeptide, but it has a different amino acid sequence, because bacteria read the genetic code differently.
1. The bacterial cells produce a long polypeptide, because they cannot process proteins in the same way as eukaryotes.
Biofuels are environmentally friendly because _____. 1. The carbon in them comes from atmospheric CO2 that was fixed by plants or algae. 2. They do not produce any greenhouse gases when they are burned. 3. They contain only natural products and so do not pollute the environment when they are burned.
1. The carbon in them comes from atmospheric CO2 that was fixed by plants or algae.
What is the purpose of transformation? 1. To introduce new DNA into a cell 2. To cut DNA at specific locations 3. To change the sequence of a DNA segment
1. To introduce new DNA into a cell
Place the steps in the manufacturing of insulin using bacteria in the correct order, starting at the top.
1. Two cDNAs are produce, one for each of insulin's polypeptide chains. 2. Each cDNA is incorporated in a plasmid vector. 3. The two plasmid vectors are used to transform two bacterial strains, each expressing one of insulin's chains. 4. The individual insulin chains are purified and mixed to produce functional insulin.
How can a TALE protein be engineered to recognize a specific sequence of DNA? 1. by combining several TALE repeat domains 2. by modifying the conserved portions of its TALE domain 3. by fusing it with a nuclease 4. by fusing it with a DNA recognition protein
1. by combining several TALE repeat domains
How can scientists increase the rate at which hydrocarbon pollutants are metabolized during bioremediation? 1. by supplementing microorganisms with nutrients 2. by moving the polluted soil or water to the lab, where conditions for bioremdiation can be ideal 3. by constantly adding microorganisms to the bioremediation process
1. by supplementing microorganisms with nutrients
Explain the six steps in reproductive cloning for mammals
1. cultured mammary cells are semi starved, arresting the cell cycle and causing dedifferentiation. 2. the nucleus of an egg cell is removed 3. the cells are fused together 4. grown in culture 5. implanted in uterus 6. embryonic development and birth to clone
A sequence of DNA flanked by Lox sites is said to be ______. 1. floxed 2. conditionally inactivated 3. tagged 4. loxed
1. floxed
What are two problems with bacterial gene expression systems?
1. gene expression varies between eukaryotes and prokaryotes, need to insert expression vector to serve as a promoter to ensure foreign gene is expressed 2. Eukaryotes have introns and this prevents correct expression in bacteria because they do not have RNA splicing machinery. to solve this, could insert cDNA since it only has exons. Or a better solution is usually to use yeast since they are eukaryotic and produce quickly like bacteria.
Explain the 4 steps of a DNA microarray assay
1. isolate mRNA 2. Make cDNA by reverse transcription using fluorescent tagged nucleotides 3. Apply cDNA mixture to array, cDNA hybridizes with any complimentary DNA on microarray 4/ Rinse off excess cDNA, scan microarray for fluorescence. Yellow spots indicate that the gene is expressed in the tissue sample
In reverse transcription PCR ___________. 1. mRNA is used to produce millions of copies of its complementary DNA 2. millions of RNA copies are produced from a specific mRNA sequence 3. DNA is used to produce millions of copies of complementary RNA
1. mRNA is used to produce millions of copies of its complementary DNA.
What is the expected result of a FISH analysis of HER2 positive cancer cells when observing their hybridized DNA? 1. multiple, large dots of fluorescence 2. two small dots of fluorescence 3. no fluorescence 4. a single small dots of fluorescence
1. multiple, large dots of fluorescence
The Cre-Lox sytsem was isolated from the bacterial virus P1. In this system _______. 1. the Cre enzyme will remove any sequence of DNA flanked by the Lox sequence. 2. the Lox enzyme will insert a DNA sequence into a Cre tagged part of the chromosome. 3. the Lox enzyme will remove any sequence of DNA flanked by Cre sequences 4. the Cre enzyme will insert a DNA sequence into a Lox tagged part of the chromosome.
1. the Cre enzyme will remove any sequence of DNA flanked by the Lox sequence
A scientist wants to use the Cre-Lox system which can be used to produce knockout mice, in which a gene is knocked out only in the kidney. How can the scientist do that? 1. the scientist needs to create a mouse line, in which the Cre gene is under the control of a promoter that is only active in kidney cells 2. the scientist needs to create a mouse line, in which the Cre gene is under the promoter that is active in all but kidney cells 3. the scientist needs to create a mouse line, in which the Cre gene is only inserted in a kidney cell
1. the scientist needs to create a mouse line, in which the Cre gene is under the control of a promoter that is only active in kidney cells
Of the three types of restriction enzymes, only type _____ restriction enzymes can recognize specific DNA sequences; these are the most commonly used restriction enzymes in biotechnology.
2
Choose all that is needed to use the CRISPR/Cas9 system to replace a mutation with a normal gene sequence. 1. A guide RNA that is complementary to the normal sequence of the gene 2. A linear double-stranded DNA which contains the normal sequence of the gene 3. A guide RNA that is complementary to the mutated sequence of the gene 4. A linear-single stranded DNA which contains the normal sequence of the gene 5. A linear double-stranded DNA which contains the mutate sequence of the gene
2 and 3 2. A linear double-stranded DNA which contains the normal sequence of the gene 3. A guide RNA that is complementary to the mutated sequence of the gene
Choose the two activities of reverse transcriptase. 1. DNA dependent RNA polymerase 2. DNA dependent DNA polymerase 3. RNA dependent RNA polymerase 4. RNA dependent DNA polymerase
2 and 4 2. DNA dependent DNA polymerase 4. RNA dependent DNA polymerase
Which of the following are applications of gene chip technologies in human medicine? 1. Gene chips can be used to visualize abnormalities in chromosomes associated with certain diseases. 2. Gene chips can be used to identify specific bacterial pathogens. 3. Gene chip can detect multiple genetic changes that lead to a particular genetic disorder. 4. Gene chips can identify single gene mutations.
2, 3, and 4 2. Gene chips can be used to identify specific bacterial pathogens 3. Gene chip can detect multiple genetic changes that lead to a particular genetic disorder. 4. Gene chips can identify single gene mutations.
Select concerns that have been raised regarding genetically modified crops. 1. They may exacerbate plant diseases 2. They may not be safe for human consumption 3. They may be more susceptible to herbivory by insects 4. They may cause allergic reactions 5. They may cause a loss in biodiversity
2, 4, 5 2. They may not be safe for human consumption 4. They may cause allergic reactions 5. They may cause a loss in biodiversity
Approximately what percent of soybeans grown in the United States are genetically modified? 1. 50 2. 90 3. 70 4. 30
2. 90
A restriction enzyme that cuts both DNA strands in the same position leads to which of the following? 1. Straight ends 2. Blunt ends 3. Sticky ends
2. Blunt ends
Which of the following technologies allows scientists to determine which genes are being expressed in a cell and their relative expression levels? 1. PCR 2. DNA microarrays 3. Immunoassays 4. FISH
2. DNA microassays
Which of the following is/are genetically engineered with genes from a daffodil and a bacterium to produce B-carotene? 1. Red carrots 2. Golden rice 3. Orange potatoes 4. Yellow beets
2. Golden rice
The HER2 gene has been implicated in invasive breast cancers. In those cancers, ________. 1. HER2 has been deleted from both homologous chromosomes. 2. HER2 has been duplicated, sometimes present in hundred of copies. 3. HER2 has been deleted from one of he chromosomes
2. HER2 has been duplicated, sometimes present in hundred of copies
Which of the following is an advantage of using bioremediation to remove hydrocarbon pollutants from the environment? 1. Hydrocarbons metabolized during the bioremediation can be used as biofuels. 2. Hydrocarbons are metabolized into CO2. 3. Hydrocarbons are broken down into other compounds with considerably lower toxicity.
2. Hydrocarbons are metabolized into CO2.
Bt crops are engineered to be which of the following? 1. More vitamin-rich thereby reducing the need to take vitamins 2. Insect-resistant thereby reducing the need for pesticides 3. Drought resistant thereby preventing the need to water them
2. Insect-resistant thereby reducing the need for pesticides
A scientist performs FISH on breast cancer cells in order to determine if the cancer is HER2 positive. She observes multiple large dots of fluorescence in the cells. What can be concluded from that test? 1. The results are inconclusive. Further testing with drugs will be needed. 2. The cancer is HER2 positive. 3. The cancer is not HER2 positive.
2. The cancer is HER2 positive.
Scientists can use hybridization to detect a specific sequence using a fluorescently or radioactively labeled probe. In the case of FISH 1. The probe is radioactively labeled and the target is DNA in cells with intact chromosomes 2. The probe is fluorescently labeled and the target is DNA in cells with intact chromosomes 3. The probe is radioactively labeled and the target is mRNA extracted from a whole organism 4. The probe is fluorescently labeled and the target is mRNA extracted from a certain type of cells
2. The probe is fluorescently labeled and the target is DNA in cells with intact chromosomes.
A human gene can be placed into the genome of a bacterium, such as E. coli, and the bacterium will make the encoded protein. How is that possible? 1. This is possible because bacterial cells evolved before human cells 2. This is possible because of the universal genetic code 3. This is possible because bacterial ribosomes are similar to human ribosomes
2. This is possible because of the universal genetic code.
A TALEN is ________. 1. a TALE protein without any TALE domains 2. a TALE proteins fused to a nuclease 3. a TALE protein with N TAKE domains
2. a TALE protein fused to a nuclease
How can scientists use knockout mice to analyze developmental events after birth? 1. by inserting the Cre gene into the genome of mice after they are born 2. by fusing the Cre gene to a promoter than can be turned on by a chemical supplied in the mice's food or water 3. by fusing the Cre gene to a promoter that is kept inactive during embryonic developmental by a chemical supplied in the mother's food or drink.
2. by fusing the Cre gene to a promoter that can be turned on by a chemical supplied in the mice's food or water
How did scientists produce genetically engineered glyphosate-resistant plants? 1. By inserting genes for the synthesis of glyphosate 2. by inserting extra copies of the EPSP synthase gene 3. by inserting several bacterial genes that are involved in the glyphosate degrading pathway
2. by inserting extra copies of the EPSP synthase gene
A scientist constructs two genomic libraries from the same animal, one from kidney cells, and another one from brain cells. These two libraries will have ______. 1. completely different sequences (very little if any sequences will be found in both libraries) 2. similar sequences 3. somewhat similar sequences (some, but not all sequences will be found in both libraries)
2. similar sequences
When creating developmental knockouts, scientists engineer mice lines in which _________. 1. the Lox sites are removed after the mice are born 2. the Lox site are only active at a specific developmental stage 3. the Cre gene is expressed at a specific developmental stage 4. the Cre gene is only expressed in embryos
2. the Cre gene is expressed at a specific developmental stage
In RT-qPCR________. 1. the amount of RNA used as a template during the RT step is measured in real time. 2. the amount of DNA produced during the PCR step is measured in real time. 3. the amount of cDNA produced during the RT step is measured in real time
2. the amount of DNA produced during the PCR step is measured in real time.
How many molecules will be produced by four PCR cycles?
2^n , so 2^4= 16 molecules
In a PCR reaction, the separation or denaturation of the DNA strands is achieved at which of the following temperature ranges? 1. Low 2. Intermediate 3. High
3. High
In RNA interference_______ 1. the transcription of RNA in cells is interrupted at a specific times, allowing scientist to study development 2. the translation of RNA in cells in inhibited and all of the non-translated RNA transcripts that are accumulating can be isolated and studied. 3. a gene is silenced by using a small double stranded RNA, which allows scientists to determine the gene's function.
3. a gene is silenced by using a small double stranded RNA, which allows scientists to determine the gene's function
The TALE proteins and the CRISPR/Cas9 system are examples of molecular techniques used to perform _____. 1. random mutagenesis 2. site-specific DNA repair 3. in vivo DNA editing 4. real-time PCR
3. in vivo DNA editing
Current next-generation sequencing technologies use 1. cloning vectors to obtain DNA that will be sequenced 2. artificial yeast chromosomes to obtain DNA that will be sequenced 3. variations of PCR to obtain DNA that will be sequenced
3. variations of PCR to obtain DNA that will be sequenced
What are the roles of CRISPR and Cas9 in the CRISPR/Cas9 system? 1. Cas9 binds a 9 nt sequence in DNA; CRISPR edits the bound sequence 2. CRISPR binds a guide DNA; Cas9 acts as a DNA repair enzyme 3. CRISPR recognizes a specific DNA sequence; Cas9 acts as a nuclease 4. CRISPR binds a guide RNA; Cas9 acts as a nuclease
4. CRISPR binds a guide RNA; Cas9 acts as a nuclease
An organism that carries a gene (or genes) from a different species that was introduced via genetic engineering, is called _____. 1. a hybrid organism 2. a heterozygous organism 3. an artificially modified organism 4. a transgenic organism
4. an transgenic organism
What is the activity of Cre in the Cre-Lox system? 1. it is an integrase 2. it is a polymerase 3. it is a protease 4. it is a recombinase
4. it is a recombinase
You are running two qPCR reactions, using a fluorescent dye to detect DNA production in real time. After 18 cycles, the fluorescence sample X is increasing faster than the fluorescence of sample Y. You can conclude that _______. 1. sample X contained at least 100 times less target cDNA than sample Y 2. sample X contained less target cDNA than sample Y 3. sample X contained about 10 times more target cDNA than sample Y 4. sample X contained more target cDNA than sample Y
4. sample X contained more target cDNA than sample Y
What part of algal cells is used for the production of biodiesel? 1. Their proteins 2. Their cell walls 3. Their nucleic acids 4. Their lipids
4. their lipids
The human genome is composed of about ____ repetitive DNA elements.
50%
Pseudogene
A DNA segment very similar to a real gene but which does not yield a functional product; a DNA segment that formerly functioned as a gene but has become inactivated in a particular species because of mutation.
enhancers
A DNA sequence that recognizes certain transcription factors that can stimulate transcription of nearby genes.
A scientist isolates mRNA from a specific type of cell found in the kidney. The mRNA is then converted to DNA using RT and the DNA fragments are inserted into appropriate vectors. What kind of library has the scientist constructed?
A cDNA library
A scientist isolates mRNA from a specific type of cell found in the kidney. The mRNA is then converted too DNA using RT and the DNA fragments are inserted into appropriate vectors. What kind of library has the scientist constructed?
A cDNA library
Multigene Families
A collection of genes with similar or identical sequences, presumably of common origin
complementary DNA (cDNA)
A double-stranded DNA molecule made in vitro using mRNA as a template and the enzymes reverse transcriptase and DNA polymerase. A cDNA molecule corresponds to the exons of a gene.
Linkage Map
A genetic map based on the frequencies of recombination between markers during crossing over of homologous chromosomes
Physical Map
A genetic map in which the actual physical distances between genes or other genetic markers are expressed, usually as the number of base pairs along the DNA
Conting
A larger sequence that is assembled from overlapping shorter sequences
Incomplete dominance
A person who is heterozygous for sickle cell disease can show some signs of the disease. This is an example of_______________.
Explain how DNA technology is used in forensic sciences
A person's genetic profile can be obtained by analysis of tissue or body fluids, which provide evidence in criminal or paternity cases and to identify human remains.
activator
A protein that binds to DNA and stimulates transcription of a specific gene.
repressor
A protein that suppresses the transcription of a gene.
What is RT-PCR?
A quicker and more sensitive method for Northern blotting. Reverse transcriptase- Polymerase Chain Reaction is done on mRNA and results in cDNA that is then amplified. the copies are then run on gel electrophoresis and observed
cyclic AMP
A second messenger derived from ATP and triggers specific cellular changes in metabolic regulation
Transposable elements
A segment of DNA that can move within the genome of a cell by means of a DNA or RNA intermediate; also called a transposable genetic element
Transposons
A segment of DNA that can move within the genome of a cell by means of a DNA or RNA intermediate; also called a transposable genetic element. o "cut-and-paste"; removes the element from the original site o copy-and-paste"; leaves behind o Both require an enzyme called transposase
restriction site
A specific sequence on a DNA strand that is recognized as a cut by a restriction enzyme.
inducer
A specific small molecule that inactivates the repressor in an operon.
in situ hybridization
A technique using nucleic acid hybridization with a labeled probe to detect the location of a specific mRNA in an intact organism.
Which answer would be an example of unique noncoding DNA?
ATCGAAATTCGGGCTACCAAC
Retrotransposons
A transposable element that moves within a genome by means of an RNA intermediate, a transcript of the retrotransposon DNA. o always leave a copy at the original site during transposition
operon
A unit of genetic function common in bacteria and phages, consisting of coordinately regulated clusters of genes with related functions, entire stretch of DNA that includes the operator, promoter, and genes that they control
Plasmid
Accessory ring of DNA, found within a bacteria.
To avoid some of the legal and ethical concerns about using embryonic stem cells, scientists are trying to use ___________________ to accomplish the desired result.
Adult stem cells
A proteome is:
All of the a species' proteins
Trp operon
An example of a repressible operon.
genetic profile
An individual's unique set of genetic markers, detected most often today by PCR or, previously, by electrophoresis and nucleic acid probes.
Human Genome Project
An international collaborative effort to map and sequence the DNA of the entire human genome. 1990-2003
What polymerase is used in PCR?
An unusually heat stable polymerase called taq polymerase. Found in hot spring bacteria if any other polymerase was used for PCR it would be denatured with the DNA in the first step.
PCR: Polymerase Chain Reaction
Automated process that creates millions of copies of a DNA sample using heat, DNA polymerase, & free nucleotides
genetic recombination
DNA exchange between homologous chromosome pairs
Describe the natural function of restriction enzymes and explain how they are used in recombinant DNA technology.
Bacterial restriction enzymes cut DNA molecules at specific restriction sites (DNA sequences). They are used in recombinant DNA technology to make "sticky ends" on the genome that allow scientists to attach a foreign gene.
Transposons were discovered by _____.
Barbara McClintock
Why was sperm often used as the source of DNA for the human Genome project?
Because of the high ration of DNA to protein
_____ are fuels produced by harvesting and using biotechnology to process the biomass of plants or algae.
Biofuel
____ is a new technology that acts as a "molecular scalpel", which allows scientists to edit specific gene sequences.
CRISPR
catabolite activator protein
CAP is a transcription activator protein. CAP has a characteristic helix-turn-helix structure that allows it to bind to successive major grooves on DNA <-- This opens the DNA molecule up, allowing RNA polymerase to bind and transcribe the genes involved in lactose catabolism. cAMP-CAP is required for transcription of the lac operon.
Repetitve DNA elements make up the ____ of chromosomes and the chromosome ends which are called ____.
Centromeres; telomeres
______ ______ allows the creation of knockout animals, in which a gene is knocked out only in cells of a special tissue or at a specific time during development.
Conditional inactivation
Lamarck
Created the theory of inheritance of acquired characteristics
There are three methods scientists use to create a physical map:
Cytogenetic mapping Radiation hybrid mapping Sequence mapping
Explain how transgenic "pharm" animals might be able to produce human proteins
DNA for a foreign gene is injected into the nucleus of a fertilized egg in vitro. Animal grows and expresses the gene by producing the protein that is coded for
Define recombinant DNA
DNA formed with segments from two different sources
PCR is a technique used to create copies of a segment ____ quickly in a test tube.
DNA
Complementary DNA (cDNA)
DNA copy that has been made from RNA using the enzyme reverse transcriptase.
reverse transcriptase PCR (RT-PCR).
DNA fragments can amplified from an RNA template. To recreate the original DNA template strand (called cDNA) reverce transcriptase, an enzyme, is required to applying DNA nucleotides to the mRNA. After the cDNA is made, regular PCR can be used to amplify it.
Why is the DNA sample to be separated by gel electrophoresis always loaded at the cathode/negative end of the power source?
DNA has a negative charge and is repelled by the negative cathode and attracted to the positive anode. When placed at the negative side, the sample moves towards the positive end, separating the molecule
why is DNA polymerase important to the PCR reaction?
DNA has to be replicated
which enzyme is used during recmbiant DNA production to link foreign DNA to vector DNA?
DNA ligase
The chain termination method involves
DNA replication of a single-stranded template by using a primer and a regular deoxynucleotide (dNTP), which is a monomer, or a single DNA unit. The primer and dNTP mix with a small proportion of fluorescently labeled dideoxynucleotides (ddNTPs). The ddNTPs are monomers that are missing a hydroxyl group (-OH) at the site at which another nucleotide usually attaches to form a chain Scientists label each ddNTP with a different color of fluorophore. Every time a ddNTP incorporates in the growing complementary strand, it terminates the DNA replication process, which results in multiple short strands of replicated DNA that each terminate at a different point during replication. When gel electrophoresis processes the reaction mixture after separating into single strands, the multiple newly replicated DNA strands form a ladder because of the differing sizes. Because the ddNTPs are fluorescently labeled, each band on the gel reflects the DNA strand's size and the ddNTP that terminated the reaction. The different colors of the fluorophore-labeled ddNTPs help identify the ddNTP incorporated at that position. Reading the gel on the basis of each band's color on the ladder produces the template strand's sequence.
Describe how the application of DNA technology is used in pharmaceutical products.
DNA technology helps develop new drugs to treat diseases. Proteins in these drugs can be mass produced using host cells in culture that are engineered to secrete a protein as it is made.
recombinant DNA
DNA that contains DNA from two or more sources.
host DNA
DNA that is present in the genome of the organism of interest
Southern blotting
DNA transfer from a gel to a nylon membrane
Southern Blotting
DNA transfer from a gel to a nylon membrane Detect the presence of certain DNA sequences in a given genome
DNA sequencing
Determining the complete nucleotide sequence of a DNA molecule
The law of segregation
Each individual has two alleles for each trait. The alleles separate during the formation of gametes. Which of Mendel's laws does this describe?
The law of independent assortment
Each pair of alleles segregate independently of the other pairs. All possible combinations of alleles can occur in gametes. Which of Mendel's laws does this describe?
What is the major difference between embryonic stem cells (ES) and adult stem cells?
Embryonic stem cells can generate all embryonic cell types, are from blastocyst stage of embryo Adult stem cells come from adult cells such as in one marrow, they can generate a limited number of cell types. these stem cells are not yet fully understood
Match the parts of the eukaryotic DNA with its function.
Exon- Regions of a gene that will eventually become translated into proteins Intron- Regions of a gene that will be excised after transcription Intergenic sequences- Regions of the genome located between genes.
True or false: Unique noncoding DNA changes often and is not conserved through evolutionary time.
False
The common DNA fingerprinting technique involves tagging short tandem repeats (STRs) with ____, so that a computer can analyze the emission of each fragment.
Fluorescence
What are genetically modified organisms, and why are they controversial?
Food that has been modified with foreign genes to have more desirable traits for production. They are controversial for many reasons. They might spread their genetic modifications to their wild relatives causing super weeds, humans may have allergic reactions, getting rid of diversity, have unknown effects on humans, etc.
Type A
Fred's mom has type O blood and his dad is homozygous for type A blood. What's Fred's blood phenotype?
Mapping information generated in laboratories all over the world goes into central databases, such as
GenBank at the National Center for Biotechnology Information (NCBI).
Gene therapy
Gene therapy is a genetic engineering technique used to cure disease. In its simplest form, it involves the introduction of a good gene at a random location in the genome to aid the cure of a disease that is caused by a mutated gene. The good gene is usually introduced into diseased cells as part of a vector transmitted by a virus that can infect the host cell and deliver the foreign DNA. More advanced forms of gene therapy try to correct the mutation at the original site in the genome, such as is the case with treatment of severe combined immunodeficiency (SCID).
Explain the idea of gene therapy, and discuss the problems with this technique as demonstrated in the treatment of SCID
Gene therapy is introducing genes into an afflicted individual for therapeutic purposed. Normal allele is inserted into the affected somatic cells. Excellent in theory but has some problems in practice. In the patients being treated with gene therapy for their SCID, 3 developed leukemia. It is possible that this happened because the DNA was injected close to a gene that codes for proliferation of blood cells, it is not always controlled where the new DNA is inserted and this can have disastrous effects on the genome
The human genome can be compared to genomes of model organisms such as mice, fruit flies and yeast through the field of comparative ____.
Genomics
osteogenesis imperfecta, Huntington disease, achondroplasia
Give examples of autosomal dominant disorders
cystic fibrosis, methemoglobinemia
Give examples of autosomal recessive disorders.
color bindness, hemophilia
Give examples of x-linked disorders.
Linnaeus
He wanted to describe the ideal characteristics of each species and determine their proper placement in the "scale of nature".
The ____ Project sought to determine the complete sequence of human DNA.
Human Genome
50
If a colorblind woman has a child with a normal-vision man, what % of their kids will be colorblind?
Transgenic
If the foreign DNA comes from a different species, the host organism is transgenic
homozygous dominant or heterozygous
In autosomal dominant disorders, what is the persons genotype if they have the disorder?
heterozygous- example Bb
In autosomal recessive disorders, what is the persons genotype if they are a carrier of the disorder?
homozygous recessive - ex: bb
In autosomal recessive disorders, what is the persons genotype if they have the disorder?
What does DNA ligase do when making recombinant DNA?
It catalyzes the formation of covalent bonds that close up the sugar-phosphate backbones of DNA strands.
Which of the following is not a benefit of cloning
It could be used to bring back extinct species of organisms
Paternity testing, Crime scene analysis, identification of human remains, genetic counseling
List some of the applications for DNA fingerprinting.
Hybrid sterility allopatric speciation sympatric speciation adaptive radiation
List the types of postzygotic isolation mechanisms.
Nucleic Acid extractions use
Lysis buffer: (a solution which is mostly a detergent) disrupts plasma membrane as well as breaking apart lipid molecules in the cell membranes and nuclear membranes. Enzymes: such as proteases that break down proteins inactivate macromolecules, and ribonucleases (RNAses) that break down RNA Alcohol: to precipitate DNA
Restriction endonucleases Process
Many restriction endonucleases make staggered cuts in the two DNA strands, such that the cut ends have a 2- or 4-base single-stranded overhang. Because these overhangs are capable of annealing with complementary overhangs, we call them "sticky ends." Adding the enzyme DNA ligase permanently joins the DNA fragments via phosphodiester bonds. In this way, scientists can splice any DNA fragment generated by restriction endonuclease cleavage between the plasmid DNA's two ends that has been cut with the same restriction endonuclease
pea plants
Mendel's research organism for his genetics experiments
Many fields such as: are using genomics
Metagenomics, Pharmacogenomics, Mitochondrial genomics
What are knockin mice?
Mice which have had a normal allele replaced with an allele that has a specific genetic alteration.
Explain how microarrays are used in understanding patterns of gene expression in normal and cancerous tissue
Microarray can be performed on normal cells and then compared to a microarray of cancer cells, or even done simultaneously. This allows us to see what proteins cancer cells are expressing that normal cells are not and vice versa. This gives us an idea of what goes wrong in gene expression in cancer cells
repetitive DNA
Most of the DNA between functional genes, which consists of sequences that are present in multiple copies of the genome.
Multiplying bacteria on spoiled food, plants with new underground shoots, and identical twins are all examples of ____ cloning.
Natural
Are cloned animals exactly like their "parents?"
No; they may look the same, but due to epigenetics they will have varied behaviors. Also, due to random X chromosome inactivation, cloned cats with a calico coat will have a different pattern than their donor. The clones are also more prone to health defects.
Non Identical Multigene Families
Nonidentical gene are two related families of genes that encode globin a group of proteins that include a and b polypeptide subunits of hemoglobin
Explain nucleic acid hybridization
Nucleic acid hybridization uses a RNA or DNA molecule as "probe". It is complimentary to a known sequence of the gene of interest. It binds to this gene and because the nucleic acid is radioactively labeled, the genes location can be determined
Repetitive DNA
Nucleotide sequences, usually noncoding, that are present in many copies in a eukaryotic genome. The repeated units may be short and arranged tandemly (in series) or long and dispersed in the genome.
transgenic
an animal or plant that has had DNA from an external source inserted into its genetic code
Next generation sequencing technologies use variations of _______ to produce the DNA that will be sequenced.
PCR
reverse transcriptase PCR (RT-PCR)
PCR technique that involves converting RNA to DNA by reverse transcriptase
reverse transcriptase PCR (RT-PGR)
PCR technique that involves converting RNA to DNA by reverse transcriptase
What is the general term used when small regions of DNA differ among individuals?
POlymorphism
what is the name of the DNA polymerases used in PCR
Pfu polymerase and Taq Polymerase
Define and distinguish between genomic libraries using plasmids, phages, and cDNA
Plasmid: Bacterial artificial chromosome- a large plasmid that has been trimmed down and carries a large DNA insert. phages: bacteriophages store genetic info in their capsids. cDNA: cloning DNA that represents only the exons of a gene.
recombinant DNA molecules
Plasmids with foreign DNA inserted into them. This is because they are created artificially and do not occur in nature Also called chimeric molecules because the origin of different molecule parts of the molecules can be traced back to different species of biological organisms or even to chemical synthesis
A small sample of dodo bird DNA is found, what technique should be used to increase the amount of the DNA for testing to be done?
Polymerase Chain Reaction (PCR) to amplify the genes
Briefly explain the process of PCR
Polymerase Chain Reaction. 1. Heat briefly to separate strands 2. cool to allow primers to form and hydrogen bonds with ends of target sequences (annealing stage) 3. DNA polymerase adds nucleotides to the 3' end of each primer (extension)
RNA splicing
Process by which the introns are removed from RNA transcripts and the remaining exons are joined together.
genetic engineering
Process of making changes in the DNA code of living organisms
histone code hypothesis
Proposes that specific combinations of modifications help determine chromatin configuration and influence transcription
What do proteins do?
Proteins actually carry out most of the activities of the cells; we must study when and where protein are produced in an organism and networks
____ interference is when small pieces of RNA are used to silence the expression of specific alleles.
RNA
a large percentage of what was once considered "junk DNA" is actually transcribed into ____.
RNA
Reverse transcriptase catalyzes which of the following reactions?
RNA to DNA
snRNPs
Recognize introns and snip them out
operator
Region of DNA that controls RNA polymerase's access to a set of genes with related functions, regulatory "switch"
Genome
an entire set of DNA molecules in the nucleus
The sequence AAGCTTCGTTC is found five different places on a chromosome. It is a(n):
Repetitive DNA element
The term, ____ DNA element, is used to describe when a sequence of two or more nucleotides is repeated many times along the length of one or more chromosomes.
Repetitve
Which of the following approaches allows scientists to determine the function of a gene?
Replace a wild-type gene with a mutant copy
DNA is cut with ____ enzymes at specific points during recombinant DNA production.
Restriction
Which of the following is an enzyme that cuts DNA at a specific sequence?
Restriction enzyme
Explain how restriction enzymes work
Restriction enzymes cut very specific sequences on a gene, when it cuts it cuts in a staggered way that creates sticky ends. Then new complimentary DNA cut by the same restriction enzyme can come in and bind, DNA ligase acts a glue to piece the new DNA together.
Some genetic markers that scientists use in generating genetic maps are
Restriction fragment length polymorphisms (RFLP) Variable number of tandem repeats (VNTRs) Microsatellite polymorphisms Single nucleotide polymorphisms (SNPs)
Define SNP and explain how it may produce RFLP
SNP: Single nucleotide polymorphisms. They are useful genetic markers and vary in a population when there is a single base-pair site where variation is present. When a restriction enzyme is added, SNPS result in DNA fragments of different lengths: Restriction Fragment Length Polymorphisms.
Why are SNP's useful when observing a gene?
SNPS are typically inherited with certain alleles. When two people share a disease and have the same SNP that unaffected people dont have, it can indicate where to look in the genome to find a mutation in the actual gene/allele.
Explain how single nucleotide polymorphisms (SNPs) and restriction fragment length polymorphisms (RFLPs) were demonstrated in analyzing sickle cell alleles
SNPs cause a restriction enzyme to cut differently since the specific sequence may be repeated more or less between cells. This results in different restriction fragment length polymorphisms. When run on the gel, we see different banding patterns because of these SNPs and consequent RFLPs.
genetic diagnosis by genetic testing
Scientists call the process of testing for suspected genetic defects before administering treatment
Describe the application of DNA technology to the diagnosis of genetic disease
Scientists diagnose genetic disorders using PCR and primers relating to cloned disease genes, then sequencing the amplified product to look for the disease causing mutation.
Blotting
Scientists transferring the fragments in the gel onto a nylon membrane, and then probe the nucleic acid fragments that are bound to the membrane's surface with specific radioactively or fluorescently labeled probe sequences
How did Dolly the sheep die and what does this indicate about reproductive cloning?
She died from illnesses commonly associated with older sheep. This indicates that the age of the donor cells affects the age of the new cells. Something in the nucleus is affected after differentiation and during reproductive cloning it can not be completely reprogrammed, causing trouble in cloned organisms.
Which tandem repeat type is used in determining famillial relationships?
Short tandem repeats
Describe how short tandem repeats can produce a sensitive genetic profile.
Short tandem repeats are repeats of certain sequences before and after the actual allele coded for in a gene. They are often inherited with the allele. Based on the number of short tandem repeats present in a person, a profile of the entire genome is very unique and no one else will all of the same short tandem repeats as a person except for in the case of identical twins.
Short tandem repeat (STR)
Simple sequence DNA containing multiple tandemly repeated units of two to five nucleotides. Variations in STRs act as genetic markers in STR analysis, used to prepare genetic profiles.
Whole-genome shotgun approach
Skip the linkage mapping and physical mapping stages and starts directly with the sequencing of DNA fragments from randomly
Plasmids are important in biotechnology. Give a full and complete definition of a plasmid.
Small circular DNA molecules that replicate separately from the bacterial chromosome. Contain a small number of genes that a bacteria may or may not need for certain environments
How are small molecules used as pharmaceutical drugs?
Small molecules such as imatinib inhibit the overexpression of a specific leukemia causing receptor
______ DNA fragments move faster through gel polymer than ______ fragments and will be located closer to the bottom of the gel (the part of the gel where DNA fragments are loaded is the "top" of the gel).
Smaller, larger
vaccine production
Some microbes can be genetically modified to produce components of vaccines.
spliceosomes
Special molecules that assist in the editing of mRNA during RNA processing.
Pax6
expression of this gene is required for eye development for all organisms.
Tg, Tg, tG, tg
T = tall, t = short; G = Green pea pod; g = yellow pea pod A hetozygous tall plant with a yellow pea pod. What gametes can be produced?
9:3:3:1
T = tall, t = short; G = Green pea pod; g = yellow pea pod Two plants that are heterozygous for both traits are crossed. What is the photypic ratio for this cross?
100% tall.
Tall plants (T) are dominant to short plants (t). A homozygous tall plant was crossed with a short plant. What is the percentage of tall plants?
1:2:1
Tall plants (T) are dominant to short plants (t). Two heterozygous tall plants were crossed. What is the genotypic ratio for the cross?
3:1
Tall plants (T) are dominant to short plants (t). Two heterozygous tall plants were crossed. What is the phenotypic ratio for the cross?
A(n) ____ repeat is a type of repetitive DNA element in which repeats occur one after another on a chromosome
Tandem
What does the "chain reaction" in the polymerase chain reaction mean?
Targeted DNA is repeatedly replicated.
the environment affecting the organisms phenotype.
The Himalayan rabbit and the Siamese cat have fur that deposits more pigment at lower temperatures. This is an example of _________
histone acetylation
The attachment of acetyl groups to certain amino acids of histone proteins.
A patient who is a carrier for sickle cell anemia would have a gel electrophoresis pattern showing four bands, explain why.
The banding pattern depends on how many times the restriction enzyme can locate the specific sequence that it cuts at. For a normal patient, there are 3 fragments, for a mutant there are 2. There are four for the carrier because it is cut at all the places the mutant AND the normal is cut at . (one allele of each)
What is the goal of the Human Genome Project
The goal of the Human Genome Project is the establishment of banks of data (databases) and refining of analytical software
Metagenomics
The collection and sequencing of DNA from a group of species, usually an environmental sample of microorganisms. Computer software sorts partial sequences and assembles them into genome sequences of individual species making up the sample
cell cloning
The creation of cultures of cells identical to one donor cell.
Reproductive cloning
The egg cell's haploid nucleus is replaced with a diploid nucleus from the cell of any individual of the same species (a donor), it will become a zygote that is genetically identical to the donor. Somatic cell nuclear transfer is the technique of transferring a diploid nucleus into an enucleated egg. Scientists can use it for either therapeutic cloning or reproductive cloning. this is using the ideas of sexual reproduction
What must happen to a differentiated cell before it resembles an embryonic cell during cloning?
The epigenetic markers must be reversed so that genes that are repressed in differentiated cells are expressed to resemble the early stages of development.
Explain why shorter DNA molecules travel farther down the gel than larger molecules
The gel acts as an obstacle course, the agarose fibers impede larger molecules. The smaller molecules can move more quickly through the gel.
Human Genome Project
The main goal was to map all the human genes and determine the nucleotide sequence of the entire human genome
How is nuclear transplantation performed in animals?
The nucleus of an unfertilized or fertilized egg is removed and replaced with the nucleus of a differentiated cell
genetically modified organism (GMO)
The organism that receives the recombinant DNA
Genotype
The organism's actual genetic make-up. Examples: PP, Pp, pp, TT, Tt, tt
In type 1 diabetes______.
The pancreas cannot produce insulin, which results in a rise in blood sugar.
Genome annotation.
The process of attaching biological information to gene sequences Annotating gene sequences helps with basic experiments in molecular biology, such as designing PCR primers and RNA targets.
reproductive cloning
The process of implanting an early embryo into the uterus of a surrogate mother. The resulting animal will be genetically identical to the donor of the nucleus.
regulation of gene expression
The process of turning genes on or off. Gene regulation ensures that appropriate genes are expressed at the proper times (such as early development). Gene regulation can also help an organism respond to its environment. It occurs in the nucleus prior to transcription. Some proteins are always necessary for an organism's survival and are continuously produced. Expression of the gene is always occurring (RNA/DNA polymerase, glycoproteins). Other proteins need to be produced at certain times and in certain amounts. Expression of the gene is turned on or off. All cells carry the same genetic information, but each type of cell expresses only a fraction of its genes (cellular differentiation).
gene cloning
The production of multiple copies of a gene.
Define gene cloning
The production of multiple copies of a single gene
Genomics is ____
The study of genomes
Genomics
The study of whole sets of genes and their interactions within a species, as well as genome comparisons between species
Proteomic
The systematic study of the full protein sets (proteomes) encoded by genomes
which of the following happens first in the process of recombinant DNA production?
The target DNA and vector are treated with the same restriction enzyme.
1. Explain how gel electrophoresis is used to analyze nucleic acids and to distinguish between two alleles of a gene
The technique uses gel as a molecular sieve to separate nucleic acids by size. The smaller fragments will go farther toward the positive end and bigger fragments will move slower toward the positive end. Restriction fragment analysis is used to compare two alleles of a gene, where DNA fragments from two individuals are produced by restriction enzyme digestion are sorted with gel electrophoresis
Bioinformatic
The use of computers, software, and mathematical models to process and integrate biological information from large data sets
Bioinformatics
The use of computers, software, and mathematical models to process and integrate biological information from large data sets
A scientist is using cloning techniques to repair tissues and fight cancer. Which of the following cloning techniques would he or she be using?
Therapeutic cloning
Discuss the safety and ethical questions related to recombinant DNA studies and the biotechnology industry.
There is an ethical question about letting GM organisms being controlled in the hands of large companies. Many people are concerned with genetically modified organisms used as food and with the creation of "super weeds" from the transfer of genes from GM crops to wild relatives. These concerns are addressed by guidelines in the US and national and international agencies that strive to set guidelines for safe and ethical practices. They must weight the benefits of genetic engineering with the hazards of harmful products or procedures.
Why are some colonies white? Why is this important?
These cells have not taken up the recombinant plasmid. This is evident because they do not have the enzyme to break down x-gal and form a blue product
How might induced pluripotent stem cells (iPS) resolve the debate about using stem cells for medical treatments?
They behave similarly to stem cells but are still relatively not understood. Cells are taken and reverted into stem cells instead of being harvested from human embryos.
How are SNPs genetic markers?
They genetically linked to disease causing genes (located close so crossing over rarely occurs). Following the SNP will lead to the gene.
Explain why a genetically engineered plasmid would be engineered with ampicillin resistance and the lacZ gene?
This provides two sources of proof that the bacteria has in fact taken up the plasmid if the bacteria A: grows on a plate of ampicillin and B: appear blue because of the product of hydrolyzing x-gal with the lacZ gene
X-linked disorders
This type of disorder appears more often in males, is carried on a sex chromosome, and females are more likely to be carriers
Vaccines
Traditional vaccination strategies use weakened or inactive forms of microorganisms to mount the initial immune response. However, modern techniques use the genes of microorganisms cloned into vectors to mass produce the desired antigen. Doctors then introduce the antigen into the body to stimulate the primary immune response and trigger immune memory.
genetically modified organisms that have had foreign DNA inserted into their genome are said to be ____ organisms.
Transgenic
bacteria and viruses
Two examples of vectors
nucleic acid hybridization
Two nucleic acid molecules with complementary strands base pairing.
cellular cloning
Unicellular organisms, such as bacteria and yeast, naturally produce clones of themselves when they replicate asexually by binary fission
Allele
alternate forms of a gene.
genomic imprinting
Variation in phenotype depending on whether an allele is inherited from the male or female parent, methylation regulates expression
A plasmid is often used in biotechnology applications as a(n) ____ to transfer foreign genetic material.
Vector
physical map
a representation of the physical distance between genes or genetic markers
Protein Signature
a set of over- or under-expressed proteins characteristic of cells in a particular diseased tissue
sticky end
a single-stranded end of a DNA molecule caused by a restriction enzyme
corepressor
a small molecule that cooperates with a repressor protein to switch an operon off
model organism
a species that is studied and used as a model to understand the biological processes in other species represented by the model organism
A model organism is
a species that researchers use as a model to understand the biological processes in other species that the model organism represents. Having entire genomes sequenced helps with the research efforts in these model organisms. Model organisms include: Escherichia coli K12 The yeast Saccharomyces cerevisiae. The mouse Mus musculus The fruit fly Drosophila melanogaster The nematode Caenorhabditis. elegans Humans Homo sapiens.
What is gel electrophoresis?
a technique used to separate nucleic acids or proteins that differ in size or electrical charge
genetically modified organisms
a transgenic organism that is acquired by artificial means one or more genes from another specie or from another variety of the same species.
which statement is not true about the recombinant DNA technique
a vector is used to release the product from the host cell
by what method was dolly, who was the first sheep cloned, produced
an adult nucleus was inserted into an enucleated egg cell
Dominant allele
an allele that is always expressed. It can repress the recessive allele.
Recessive allele
an allele that is only expressed in the homozygous condition.
Population
all members of a single species living in a specific area at a specific time
what is a reason why the genetic modification of organisms works
all species share many similar genes and proteins
Blast
allows the visitor to compare a DNA sequence with every single sequence in GenBank, base by base, to look for similar regions
genetic engineering
alteration of the genetic makeup of an organism
genetic engineering
alteration of the genetic makeup of an organism using the molecular methods of biotechnology
Biomaker
an individual protein that is uniquely produced in a diseased state
Vestigial structures
anatomical structures that are fully developed in one organism and are reduced or have no function
In immunoassays, a molecule is detected by using a specific ______ against it.
antibody
What is a totipotent cell?
any cell with the ability to dedifferentiate and give rise to all the specialized cell types of the organism. Can be an entire organism. these are the types of cells the first 4 days after an egg is fertilized
autosome
any chromosome other that the X or Y chromosome.
There is interest in injection p53, a tumor suppressing gene, into cancer cells as a form of in vivo therapy. The idea is that p53 would cause cancer cells to undergo
apoptosis
Bioinformatics
application of computer technologies, software, & statistical techniques to study biological information
Antibiotics
are a biotechnological product. Microorganisms, such as fungi, naturally produce them to attain an advantage over bacterial populations. Cultivating and manipulating fungal cells produces antibodies
Nucleic Acids
are macromolecules made of nucleotides (a sugar, a phosphate, and a nitrogenous base) linked by phosphodiester bonds
DNA microarrays
are methods that scientists use to detect gene expression by analyzing different DNA fragments that are fixed to a glass slide or a silicon chip to identify active genes and sequences. We can discover almost one million genotypic abnormalities using microarrays;
All enzymes (except ribozymes)
are proteins that act as catalysts to affect the rate of reactions.
Variable number of tandem repeats (VNTRs)
are repeated sets of nucleotides present in DNA's non-coding regions. Non-coding, or "junk," DNA has no known biological function; however, research shows that much of this DNA is actually transcribed. While its function is uncertain, it is certainly active, and it may be involved in regulating coding genes. The number of repeats may vary in a population's individual organisms.
Microsatellite polymorphisms
are similar to VNTRs, but the repeat unit is very small.
Single nucleotide polymorphisms (SNPs)
are variations in a single nucleotide.
transgenic ___ are used to help clean up beaches after a massive oil spill
bacteria
The field of study that relies heavily on computer technologies to analyze genomic and proteomic data is called ____.
bioinformatics
The use of microorganisms to degrade or metabolize (incorporate into microbial biomass) hydrocarbon pollutants is called ______.
bioremediation
the process by which bacteria can be used to clean up a toxin or pollutant in the environment is called ____.
bioremediation
Products made with or derived from transgenic or genetically modified organisms (GMOs) are called ____ products
biotechnology
A knockout mouse has had.
both alleles for a gene removed
What do we call a DNA copy of an RNA template (synthesized by reverse transcriptase)?
cDNA
the process that is used to seperate DNA fragments according to size is____.
called gel electrophoresis
The polymerase _____ _____ is used to quickly produce millions of copies of a particular DNA sequence.
chain reaction
the first US food to utilize genetic engineering was
cheese
The production of genetically copies of DNA, cells, or organisms through some asexual means is called ____.
cloning
reproductive cloning
cloning an entire organism
whole-genome shotgun approach
cloning and sequencing DNA fragments from randomly cut DNA. Computer programs then assemble the entire sequence.
what is not a principle application for PCR and DNA fingerprinting
cloning animals
Researchers use PCR for many purposes in laboratories, such as
cloning gene fragments to analyze genetic diseases, identifying contaminant foreign DNA in a sample, amplifying DNA for sequencing. More practical applications include determining paternity and detecting genetic diseases.
molecular cloning
cloning of DNA fragments
Gene cloning
cloning to produce many identical copies of the same gene
genomic library
collection of cloned DNA which represents all of the sequences and fragments from a genome
cDNA library
collection of cloned cDNA sequences
recombinant DNA
combination of DNA fragments generated by molecular cloning that does not exist in nature; AKA chimeric molecule
What two techniques are used in performing a Southern blot?
combines gel electrophoresis and nucleic acid hybridization
recombinant DNA
combining DNA fragments that molecular cloning generates that do not exist in nature; also a chimeric molecule
metabolome
complete set of metabolites which are related to an organism's genetic makeup
metabolome
complete set of metabolites which are related to the genetic makeup of an organism
what is not a concern with respect to genetic engineering
concerns about bringing extinct animals back to life
simple sequence DNA
contains many copies of tandemly repeated short sequences
which of the following plants has not been engineered to be resistant to insect predation and herbacides
corn potatoes soybeans cotton oranges oranges
what is not an example of a genetic modification in an organism
corn with built in fertilizer
Researchers use genomics to
create similar DNA maps of different organisms
what is the function of a restriction enzyme in genetic engineering
cut DNA into many fragments
what is not a trait that genetic engineers would want to put in plants
decreased tolerance of salt in the soil
Restriction Fragment Length Polymorphisms
each individual's DNA is cut into different-sized pieces by restriction enzymes
In genetically modified animals, foreign DNA is introduced into ____.
eggs
if you were a biologist and wanted to carry out the process of therapeutic cloning, which cell types would you need
embryonic stem cells
what is the difference between embryonic and adult stem cells?
embryonic stem cells are pluripotent (can differentiate into any cell type) while adult stem cells are limited.
X-ray crystallography
enables scientists to determine a protein crystal's three-dimensional structure at atomic resolution.
repressible enzymes
enzymes that usually function in anabolic pathways
Restriction enzymes
enzymes used to cut DNA into fragments at a specific palindromic sequence to be used for DNA fingerprinting.
What are some problems associated with animal cloning?
epigenetic changes in the chromatin cause proteins that need to be expressed in embryos not to be expressed, explains improper embryo development. DNA in cells from cloned embryos have unusually high amounts of methylated DNA.
A doctor studying in the field of gene therapy has removed tissue from the patient, inserted normal genes into the tissue and then reinserted the tissue back into the patient's body. Based on this information, you would conclude that the doctor is studying:
ex vivo gene therapy
in the treatment of skin cancer, what technique would be used
ex vivo gene therapy
clone
exact copy
clone
exact replica
genetic recombination
exchange of DNA between homologous pairs of chromosomes
physical map
expresses distance between genetic markers, usually as the number of base pairs along the DNA.
based on clinical trials that have occured so far, gene therapy has had an excellent cure rate T/F
false
gene therapy is when a foreign gene is inserted into the genome of an extinct organism to bring it back to life. T/F
false
in general, people tend to think that genetically modified food is safe and will have no long term health effects T/F
false
DNA_____ is a technology that can identify and distinguish among individuals based on variations in the number of short tandem repeats in their DNA.
fingerprinting
During aerobic secondary treatment of wastewater, bacteria and other organisms form aggregates called ________, where degradation of organic compounds occurs.
floc
The DNA in gels can be visualized using a _______ dye, such as ethidium bromide, that binds to DNA.
fluorescent
psuedogenes
former genes that have accumulated mutations and are nonfunctional
What specific type of genomic study determines the role of the genome in cells and organisms?
functional genomics
The type of cloning through which identical copies of a functional unit of DNA made is called ____ cloning
gene
making identical copies of the same gene is referred to as
gene cloning
Introns can regulate which genes may undergo transcription and how the mRNA gets spliced Thus introns can be said to regulate ____.
gene expression
genetic marker
gene or sequence on a chromosome with a known location that is associated with a specific trait
a biologist is interested in manipulation an organisms genes. the biologist would be most interested in which of the following
gene therapy
______ therapy targets genetic diseases, while _______ ______ therapy is used to treat degenerative diseases, or tissue damage.
gene therapy, stem cell therapy
____ engineering is a modern field that allows scientists to change genomes, this can be to create biotechnology products or change the organism's characteristics.
genetic
sickle cell anemia
genetic disorder that causes a change in hemoglobin shape which causes a change in red blood cell shape (and many side effects)
cystic fibrosis
genetic disorder that causes excess mucus production in the respiratory system
Huntington's disease
genetic disorder that is lethal but does not show its neurological symptoms until the affected individual is in their mid-30s
Biotechnology products are produced by ____ modified organisms.
genetically
an organism that carries a foreign gene in their genome is a ____ organism.
genetically modified
Functional genomics tries to understand the exact role of the ____ in cells orgranisms
genome
Scientists can use ______ ______ to restore defective genes in pluripotent stem cells. The modified stem cells can then be infused into a patient to treat certain conditions. This technology has been used with some success to treat patients infected with HIV.
genome editing
the study of our genes and the genes of other organisms is best described as what
genomics
next-generation sequencing
group of automated techniques for rapid DNA sequencing
next-generation sequencing
group of automated techniques used for rapid DNA sequencing
Xenotransplantation
growing human organs for organ transplants in another organism
pure culture
growth of a single cell type in the laboratory
pure culture
growth of a single type of cell in the laboratory
if there are two different genes that code for the same protein, these are considered ____ genes.
homoiogous
radiation hybrid mapping
information obtained by fragmenting the chromosome with x-rays
Mass spectrometry
identifies and determines a molecule's characteristics. It has allowed researchers to analyze very small protein samples
The ultimate goal of proteomics is to
identify or compare the proteins expressed from a given genome under specific conditions, study the interactions between the proteins, and use the information to predict cell behavior or develop drug targets.
What methods to scientists use to determine gene function?
in vitro mutagenesis, RNA interference, SNP study
false negative
incorrect test result that should have been positive
deoxynucleotide
individual DNA monomer (single unit)
dideoxynucleotide
individual DNA monomer that is missing a hydroxyl group (-OH)
deoxynucleotide
individual monomer (single unit) of DNA
dideoxynucleotide
individual monomer of DNA that is missing a hydroxyl group (-OH)
biomarker
individual protein that is uniquely produced in a diseased state
X-linked recessive
inheritance pattern for color-blindness and hemophilia
Bacillus thuringiensis (Bt)
is a bacterium that produces protein crystals during sporulation that are toxic to many insect species that affect plants. Insects that have eaten Bt toxin stop feeding on the plants within a few hours. After the toxin activates in the insects' intestines, they die within a couple of days. Modern biotechnology has allowed plants to encode their own crystal Bt toxin that acts against insects. Scientists have cloned the crystal toxin genes from Bt and introduced them into plants. Bt toxin is safe for the environment and nontoxic for humans which has made it a 'natural insecticide'
Next-generation sequencing
is a group of automated techniques used for rapid DNA sequencing. These automated lowcost sequencers can generate sequences of hundreds of thousands or millions of short fragments (25 to 500 base pairs) in the span of one day. These sequencers use sophisticated software to get through the cumbersome process of putting all the fragments in order.
Reproductive cloning
is a method scientists use to clone or identically copy an entire multicellular organism. **Most multicellular organisms undergo reproduction by sexual means
Linkage Analysis
is a procedure that analyzes the recombination frequency between genes to determine if they are linked or show independent assortment It involves studying the recombination frequency between any two genes. The greater the distance between two genes, the higher the chance that a recombination event will occur between them, and the higher the recombination frequency between them. If the recombination frequency between two genes is less than 50 percent, they are linked.
Whole-genome sequencing
is a process that determines an entire genome's DNA sequence. is a brute-force approach to problem solving when there is a genetic basis at the **doctors are still confounded by some diseases, and they are using whole-genome sequencing to discover the root of the problem.
Physical Map
is a representation of the physical distance, in nucleotides, between genes or genetic markers
multiple cloning site (MCS)
is a short DNA sequence containing multiple sites that different commonly available restriction endonucleases can cut
Plasmid, or Vector,
is a small circular DNA molecule that replicates independently of the chromosomal DNA. Plasmids are usually introduced into a bacterial host for proliferation They occur naturally in bacterial populations
Polymerase chain reaction (PCR)
is a technique that scientists use to amplify specific DNA regions for further analysis
Gel Electrophoresis
is a technique that scientists use to separate molecules on the basis of size, using their negative charge ***Because nucleic acids are negatively charged ions at neutral or basic pH in an aqueous environment, an electric field can mobilize them.
Gene therapy ____
is an accepted therapy for treatment of a disorder or disease
Genetic Map
is an illustration that lists genes and their location on a chromosome
false negative
is an incorrect test result that should have been positive.
Microbial Genomics
is helping to develop diagnostic tools, improved vaccines, new disease treatments, and advanced environmental cleanup techniques.
which is not a drawback to cloning
is increases genetic variability of a species
The basic technique for protein analysis, analogous to DNA sequencing
is mass spectrometry.
Genetic engineering
is the alteration of an organism's genotype using recombinant DNA technology to modify an organism's DNA to achieve desirable traits
Metabolome
is the complete set of metabolites that are related to an organism's genetic makeup. The goal of metabolome research is to identify, quantify, and catalogue all the metabolites in living organisms' tissues and fluids.
Proteome
is the entire set of proteins that a cell type produces. We can study proteoms using the knowledge of genomes because genes code for mRNAs, and the mRNAs encode proteins.
Genome Mapping
is the process of finding the locations of genes in each chromosome
Proteomics
is the study of proteomes' function.
Metagenomics
is the study of the collective genomes of multiple species that grow and interact in an environmental niche. Metagenomics can be used to identify new species more rapidly and to analyze the effect of pollutants on the environment
Biotechnology
is the use of biological agents for technological advancement was used for breeding stock long before people understood the scientific bases of these techniques
Gene targeting
is the use of recombinant DNA vectors to alter a particular gene's expression, either by introducing mutations in a gene, or by eliminating a certain gene's expression by deleting a part or all of the gene sequence from the organism's genome. *used in reverse genetics
To study or manipulate nucleic acids, one must first
isolate or extract the DNA or RNA from the cells.
What is the purpose of a genomic library?
it can be used for research, sequencing, or commercial purposes. "the complete set of plasmid containing cell clones".
A mouse, which has had one of its genes inactivated, is called a ________ mouse.
knockout
Scientists can construct specific genetic alterations of a gene in vitro and then use biotechnology to replace a normal gene in a mouse with the constructed altered gene. This results in the creation of a ________ mouse.
knockin (In knockout mice a gene is inactivated, usually by interrupting it with a marker gene, such as one for antibiotic resistance.)
Explain how a bacterial artificial library (BAC) and cDNA library are formed
large plasmids are trimmed down to contain and store many genes. cDNA libraries are derived from the mRNA, store cDNA which only entails exons. not a complete genome
contig
larger sequence of DNA assembled from overlapping shorter sequences
after being treated with gene therapy, some of the children with severve combined deficiency syndrome (SCID) developed which complication
leukemia
A collection of many different recombinant molecules that can be maintained and replicated (when needed) is called a DNA _______.
library
The enzyme DNA ______ covalently links the sugar phosphate backbones of two DNA strands.
ligase
RNA extraction involves
like DNA extraction, the usage of various buffers and enzymes to inactivate macromolecules and preserve the RNA.
what is the function of DNA ligase in genetic engineering
link together newly joined fragments of DNA
what is the function of the polymerase chain reaction in genetic engineering
make millions of copies of a specific segment of DNA
In research involving the SRY gene, when an embryo was injected with the SRY gene it became ____ ; when an embryo was not injected with the SRY gene it became ____.
male; female
what is the most complex type of organism science has been able to clone?
mammal
sequence mapping
mapping information obtained after DNA sequencing
linkage map
maps the location of several thousand genetic markers on each chromosome through recombination frequencies that show relative distances and order.
transponsons
move within a genome through a DNA intermediate in a cut and paste mechanism.
DNA has a _______ charge, therefore it moves through a gel toward the ________ electrode during electrophoresis.
negative, positive
Dideoxy Chain Termination
o Cut the DNA from many copies of an entire chromosome into overlapping fragments short enough for sequencing o Clone the fragments in plasmid or phage vectors o Sequence each fragment o Order the sequence into one overall sequence with computer software
Sequencing by Synthesis
o Resulted in massive increases in speed and decreases in the cost of sequencing entire genome o Made cloning in the shotgun approach unnecessary
Physical Map Process
oMade by cutting the DNA, using restriction enzymes, of each chromosome into a number of restriction fragments oThen determining the original order of the fragments in the chromosomal DNA oThe key is to make fragments that overlap and then use probes or automated nucleotide sequencing in a way to find overlaps; fragments can be assigned to a sequential order that corresponds to their order in a chromosome oPrepared by DNA cloning
The Denaturation, Annealing, and DNA Synthesis steps
occur at high, low, and intermediate temperatures, and the cycle is repeated again and again which yields a doubling of the DNA molecules each time, and are the same length as the distance between the primers.
Genetic recombination
occurs by crossing over DNA between homologous DNA strands, such as nonsister chromatids.
Homologous structures
same structures have evolved from a common ancestor.
Parthenogenesis, or "virgin birth"
occurs when an embryo grows and develops without egg fertilization. This is a form of asexual reproduction. **Example: parthenogenesis occurs in species in which the female lays an egg and if the egg is fertilized, it is a diploid egg and the individual develops into a female. If the egg is not fertilized, it remains a haploid egg and develops into a male. The unfertilized egg is a parthenogenic, or virgin egg. Some insects and reptiles lay parthenogenic eggs that can develop into adults.
Mitochondrial Genomics
often use it to study evolutionary relationships use mitochondrial genomics to trace genealogy.
what best describes transgenic organisms
one which contains a foreign gene and is free living in the enviornment
transgenic
organism that receives DNA from a different species
genetically modified organism (GMO)
organism whose genome has been artificially changed
genetically-modified organism (GMO)
organism whose genome has been artificially changed
what is not a biotechnology product that is produced by bacteria for human use
pesticides
The process of gene pharming is most often used in transgenic animals to produce ____.
pharmaceuticals
Gene ____ describes the production of pharmaceuticals using transgenic animals.
pharming
polygenic
phenotypic characteristic caused by two or more genes
one method of making a genetically modified ____ is by subjecting a protoplast floating in foreign DNA to an electric current.
plant
the bacterial vector used for human genes is the
plasmid
pharmacogeneomics
study of drug interactions with the genome or proteome; also called toxicogenomics
linkage analysis
procedure that analyzes recombining genes to determine if they are linked
linkage analysis
procedure that analyzes the recombination of genes to determine if they are linked
gene expression
process by which a gene produces its product and the product carries out its function, regulates development and is responsible for difference in cell types
genome annotation
process of attaching biological information to gene sequences
genome mapping
process of finding the location of genes on each chromosome
genetic testing
process of testing for the presence of disease-causing genes
whole-genome sequencing
process that determines an entire genome's DNA sequence
whole-genome sequencing
process that determines the DNA sequence of an entire genome
organismal cloning
produces one or more organisms genetically identical to the "parent" that donated the single cell.
cellular cloning
production of identical cell populations by binary fission
An individuals's genetic ____ shows their genome, including mutations
profile
Restriction endonucleases
recognize specific DNA sequences and cut them in a predictable manner. They are naturally produced by bacteria as a defense mechanism against foreign DNA.
A segment of DNA containing genes from both mice and humans would be called ____ DNA
recombinant
if you were studying DNA which comes from tow or more different sources, you would be studying what
recombinant DNA
a technigue used to gather evidence against a suspected rapist would be
recombinant DNA techniques
What are stem cells?
relatively unspecialized cells that can reproduce indefinitely and under the right conditions differentiate into specialized cells.
Fossils
remains of organisms that have turned to stone or left their impressions in stone.
Molecular Cloning
reproduce desired regions or fragments of the genome in cloning, scientists can use plasmid molecules to provide a "folder" in which to insert a desired DNA fragment.
if you were a transgenic mouse breeder, what would most of your mice be used for
research
A(n) ______ ______ is an enzyme capable of cutting DNA at specific sequences.
restriction endonuclease
if you wanted to perform recombinant DNA experiments, which enzyme would you need
restriction enzymes, and DNA ligase
Sequence mapping
resulted from DNA sequencing technology that allowed for creating detailed physical maps with distances measured in terms of the number of base pairs
Plato
saw the different forms of life as imperfect copies of a perfect form.
Double-barrel shotgun sequencing, or pairwise-end sequencing.
scientists analyze each fragment's end for overlap. Pairwise-end sequencing is, therefore, more cumbersome than shotgun sequencing, but it is easier to reconstruct the sequence because there is more available information
what is the function of gel electrophoresis in genetic engineering
separate fragments of DNA by their length and electrical charge
pharmacogenomics
study of drug interactions with the genome or proteome; also called toxicogenomics
protein signature
set of uniquely expressed proteins in the diseased state
In shotgun sequencing method
several DNA fragment copies cut randomly into many smaller pieces. Then, with sequence computer assistance, scientists can analyze the fragments to see where their sequences overlap. By matching overlapping sequences at each fragment's end, scientists can reform the entire DNA sequence.
expressed sequence tag (EST)
short STS that is identified with cDNA
Short Tandem Repeats (STRs)
short sequences of DNA bases that recur several times in the genome
What is Northern blotting?
similar to southern blotting except gel electrophoresis is performed on samples of mRNA
Why are the four nucleotides in DNA each labeled with a different color of fluorescent for DCTM?
so the colors can be used to identify which nucleotide was added and ultimately sequence the entire DNA strand
the small regions of DNA which vary among individuals is referred to as
single nucleotide polymorphisms
multiple cloning site (MCS)
site that can be recognized by multiple restriction endonucleases
multiple cloning site (MCS)
site that multiple restriction endonucleases can recognize
multiple cloning site (MGS)
site that multiple restriction endonucleases can recognize
A scientist amplifies a region of DNA using a primer, in which one of the bases has been changed so that it does not match the template. By using this primer the scientist is performing PCR-based _______-______ mutagenesis.
site-specific
_________ digesters are sealed reactors used to perform ________ digestion of wastewater.
sludge, anaerobic
probe
small DNA fragment to determine if the complementary sequence is present in a DNA sample
Probe
small DNA fragment to determine if the complementary sequence is present in a DNA sample usually in the form of a fluorescent tag
probe
small DNA fragment used to determine if the complementary sequence is present in a DNA sample
plasmid
small circular DNA molecules that replicate separately from bacterial chromosome.
lysis buffer
solution to break the cell membrane and release cell contents
lysis buffer
solution used to break the cell membrane and release cell contents
vector
something that carries the DNA
DNA gel electrophoresis is able to ____ DNA fragments.
sort
model organism
species that researchers study and use as a model to understand the biological processes in other species represented by the model organism
in vitro mutagenesis
specific mutations are introduced into a cloned gene, and the mutated gene is returned to a cell in such a way that it disables the normal cellular copies of the same gene. The changed phenotype points to the gene's function.
Creating genomic libraries and complementary DNA (cDNA) libraries (collections of cloned sequences or all DNA from a genome) has
sped the physical mapping process. A genetic site that scientists use to generate a physical map with sequencing technology (a sequence-tagged site, or STS) is a unique sequence in the genome with a known exact chromosomal location. An expressed sequence tag (EST) and a single sequence length polymorphism (SSLP) are common STSs. An EST is a short STS that we can identify with cDNA libraries, while we obtain SSLPs from known genetic markers, which provide a link between genetic and physical maps.
The source of DNA for sequencing the human genome came mostly from:
sperm
Scientists perform RNA analysis to
study gene expression patterns in cells
A restriction enzyme that makes single stranded ends that will hydrogen bond to other DNA fragments cut with the same restriction enzyme produces _____ ends.
sticky
After DNA is cut by a restriction enzyme, often a "____ end" forms, allowing one place of DNA to attach to a foreign piece of DNA.
sticky
genomic library
stores cloned genes
transposable elements
stretches of DNA that can move locations within a genome through a recombination process.
Analogous structures
structures that have the same function, but do not share a common ancestory.
If a segment of non-coding DNA contained a sequence TTGTTTAGTTTGT, you would call this a(n) ____ repeat.
tandom
polymerase chain reaction (PCR)
technique to amplify DNA
polymerase chain reaction (PCR)
technique used to amplify DNA
gene therapy
technique used to cure heritable diseases by replacing mutant genes with good genes
gene therapy
technique used to cure inheritable diseases by replacing mutant genes with good genes
gel electrophoresis
technique used to separate molecules on the basis of size using electric charge
DNA technology
techniques for sequencing and manipulating DNA
pleiotropy
term for a gene that controls many phenotypic traits (ex: sickle cell anemia causes side effects in many organ systems)
polygenic
term for a phenotypic trait that is controlled by many genes (ex: eye color in humans)
homozygous
term to describe a genotype with the same two alleles (either two dominant or two recessive alleles)
heterozygous
term to describe a genotype with two different alleles (one dominant, one recessive)
phenotype
term to describe the physical appearance (ex.: purple flowers)
Ti Plasmids (tumor inducig plasmids)
that contain genes to produce tumors in plants. DNA from the Ti plasmid integrates into the infected plant cell's genome. Researchers manipulate the Ti plasmids to remove the tumor-causing genes and insert the desired DNA fragment for transfer into the plant genome. The Ti plasmids carry antibiotic resistance genes to aid selection and researchers can propagate them in E. coli cells as well.
Describe how a radioactively labeled nucleic acid probe can locate the gene of interest on a multiwell plate
the DNA is denatured in a nylon membrane. The nucleic acid probe binds to the gene of interest creating a double stranded DNA again. Then it is laid under photographic film and the radioactive label turns black. From this the well location of the gene of interest can be determined.
high-throughput sequencing
the ability to rapidly sequence large amounts of DNA
bioinformatics
the application of computational methods to store and analyze biological data.
a biologist wants to major in bioinformatics. what would they be studying
the application of computer technologies to study the genome
Biogeography
the study of present and past geographical distribution of organisms.
which of the following is not a prediction based on the mapping of the human genome project
the cloning of humans will become common
nucleic acid probe
the complementary molecule, a short, single-stranded nucleic acid that can be either RNA or DNA
restriction fragments
the cuts in a DNA molecule by a restriction enzyme.
Exome sequencing
the doctor sequences only the DNA's coding, exon-producing regions.
which of the following is not true about the PCR
the enzyme used in PCR was extracted from e coli
the goal of comparative genomics is
the evolution of a species and how genes and non-coding regions function
differential gene expression
the expression of different genes by cells with the same genome; differences between cell types are not due to different genes, but due to differential gene expresison
if you were studying functional genomics, you would be most interested in
the function of regions where DNA has no identifiable genes
Aristotle
the idea that all organisms could be placed in order from the simplest to the most complex
Gene therapy
the introduction of genes into an afflicted individual with a single defective gene for therapeutic purposes. Inserting a normal allele of the defective gene into the somatic cells of the tissue affected by the disorder.
which of the following statements about the genomes of organisms is not true
the larger the genome, the more complex the organism is
Define biotechnology
the manipulation of organisms or their components to make useful products
biotechnology
the manipulation of organisms or their components to make useful products.
The most common type of RNA that researchers analyze is
the messenger RNA (mRNA) because it represents the protein-coding genes that are actively expressed. RNA molecules are often less stable than DNA, which makes them challenging to analyze.
What is a cloning vector?
the original plasmid, the DNA molecule that can carry foreign DNA into a host cell and replicate it there
Phenotype
the physical appearance of an organism. Examples: purple flowers, white flowers, tall plant, short plant
if you were a biologist studying proteomics, what would you be studying
the structure, function, and interactions of cellular proteins
proteomics
the study and comparison of all the proteins that result from an organism's genome
pharmacogenomics
the study of drug interactions with the genome or proteome; also called toxicogenomics
Genomics
the study of entire genomes, including complete set of genes, their nucleotide sequence and organization, and their interactions within a species with other species
genomics
the study of entire genomes, including the complete set of genes, their nucleotide sequence and organization, and their interactions within a species and with other species
cloning in which the end result is not an organism but mature cells of various types is referred to as
therapeutic cloning
Gene ______ is a correction of detrimental DNA mutation by inserting new DNA into the genome.
therapy
After transformation has occurred, why are some of the colonies blue?
they have the lacZ gene which codes for an enzyme that hydrolyzes x-gal and creates a blue product
Gradualistic model
this model proposes that speciation occurs after populations become isolated and that each population follows its own evolutionary pathway.
Punctuated equilibrium model
this models proposes that species have periods of equilibrium where there is no change and these periods are interrupted by rapid speciation.
DNA microarray assays
tiny amounts of a large number of single-stranded DNA fragments representing different genes fixed to a glass slide in a tightly spaced array, or grid. This helps determine functions of the genes.
What are the two basic purposes of gene cloning?
to amplify a particular gene and to produce a protein product from it for a specific purpose.
What is the purpose of a Southern blot?
to detect and identify only the genes of interest on a gel
southern blotting
transfer of DNA from a gel to a nylon membrane
Northern blotting
transfer of RNA from a gel to a nylon membrane
northern blotting
transfer of RNA from a gel to a nylon membrane
During _____, a bacterial cell is allowed to uptake foreign DNA.
transformation
retrotransposons
transposable element that moves through a RNA intermediate that is a transcript of the retrotransposon DNA>
DNA sequences able to randomly move from one site to another in the genome are called ____.
transposons
dominant
type of allele that is always expressed, whether homozygous or heterozygous
recessive
type of allele that is only expressed in the homozygous genotype
cross-pollination
type of pollination that lead to Mendel's 1st Filial (F1) generation plants
self-pollination
type of pollination that lead to Mendel's Parental (P) generation plants
Functional genomics
understanding the role of the genome in organisms & cells
Plants are more readily manipulated by genetic engineering than animals because ___?
unlike somatic animal cells, a somatic plant cell can often give rise to a complete plant
stem cell
unspecialized cell that can both reproduce itself indefinitely and, under appropriate conditions, differentiate into specialized cells of multiple types. Promise in regenerating tissues.
xenotransplats are
use animal organs for transplants
Nuclear magnetic resonance (NMR)
uses atoms' magnetic properties to determine the protein's three-dimensional structure in aqueous solution.
Cytogenetic mapping
uses information from microscopic analysis of stained chromosome sections. It is possible to determine the approximate distance between genetic markers using cytogenetic mapping, but not the exact distance (number of base pairs).
Radiation hybrid mapping
uses radiation, such as x-rays, to break the DNA into fragments. We can adjust the radiation amount to create smaller or larger fragments. This technique overcomes the limitation of genetic mapping, and we can adjust the radiation so that increased or decreased recombination frequency does not affect it
RNA interference (RNAi)
uses synthetic double-stranded RNA molecules matching the sequence of a particular gene to trigger breakdown of the gene's messenger RNA or to block its translation
Reverse Genetics
using DNA sequence, geneticists can study genes directly, without having to infer genotype from phenotype as in classical genetics
Gene pharming
using transgenic farm animals to produce pharmaceutical products
single nucleotide polymorphism (SNP)
variation between individuals in a single nucleotide
restriction fragment length polymorphism (RFLP)
variation between individuals in the length of DNA fragments generated by restriction endonucleases
restriction fragment length polymorphism (RFLP)
variation between individuals in the length of DNA fragments, which restriction endonucleases generate
System biology (Genomic- and proteomic-scale analyses)
which is the study of whole biological systems (genomes and proteomes) based on interactions within the system. Because proteins are the direct products of genes and reflect activity at the genomic level, it is natural to use proteomes to compare the protein profiles of different cells to identify proteins and genes involved in disease processes. Most pharmaceutical drug trials target proteins.
