biology 121 final exam, final exam BLY 121

Lakukan tugas rumah & ujian kamu dengan baik sekarang menggunakan Quizwiz!

Using distance-based methods to construct a phylogenetic tree requires:

a constant evolutionary rate of change in the DNA of the taxa.

Which of the answer choices is most likely to fossilize?

a crayfish that died in its muddy burrow by a creek

In order for phospholipids to form bilayers spontaneously in an aqueous environment, the pH should be:

approximately neutral.

Which one of the following is NOT a product when photosystem II oxidizes a molecule of water?

carbon dioxide

Which of the following correctly lists the three steps of the Calvin cycle?

carboxylation, reduction, and regeneration

Which of these correctly lists the three phases of the Calvin cycle?

carboxylation, reduction, and regeneration

It is thought that the evolution of two photosystems from one likely involved:

either transfer of genetic material or gene duplication and divergence.

codominance

heterozygous genotypes simultaneously displays multiple phenotypes; blood type; capital letter with subscript

what is FADH2

high energy form of FAD

Which of the sequences best represents the flow of energy through living systems?

light → photosynthesis → carbohydrate → cellular respiration →ATP → heat

Which type of receptor is involved in rapid responses of muscle cells and neurons?

ligand-gated ion channel

in which stage of photosynthesis is O2 produced

light reactions

RNA molecules are transported from the nucleus to the cytoplasm in eukaryotes through:

nuclear pores.

In the Calvin cycle, NADPH is: reduced. oxidized. None of the answer options is correct. oxidized and reduced. phosphorylated.

oxidized

Platelet-derived growth factor (PDGF) is a signaling molecule that functions in which of the following types of cell signaling?

paracrine

Which type of signaling is blocked by the toxin, curare?

paracrine

What is a product (as opposed to a substrate) of at least one of the processes of cellular respiration?

water

We consume a variety of carbohydrates that are digested into a variety of different monosaccharides. How do these different sugars enter glycolysis?

Different sugars can be modified to form different intermediates of glycolysis.

In the developing nervous system, delta cells display on their surface the protein Delta, which interacts with and activates the Notch protein present on neighboring Notch cells. What is the developmental fate of these two cell types?

Delta cells become neurons, and the activation of Notch causes neighboring cells to become glial cells.

Fermentation produces nearly twice as much ATP as aerobic respiration, which explains why it is a preferred pathway for bacteria.

False

When a single pyruvate is converted to acetyl-CoA during pyruvate oxidation, the other products of the reaction are

NADH and CO2.

When a single pyruvate is converted to acetyl-CoA during pyruvate oxidation, the other products of the reaction are:

NADH and CO2.

pyruvate oxidation

- starts with 2 molecules of pyruvate that are transported into the mitochondrial matrix - ends with product acetyl COa(or coenzyme A) - results= 1 molecule of CO2, 1 molecule of NADH

Which of the following correctly describes the role of rubisco in the Calvin cycle?

...uses co2...

You are studying a gene with three distinct alleles found in Daphnia magna, a water flea. Your sample reveals the following genotype proportions: AA = 10 AB = 5 AC = 15 BB = 30 BC = 15 CC = 25 The allele frequencies of all alleles at a given are equal to 1. The frequency of allele A is:

0.2.

For every turn of the Calvin cycle, how many triose phosphates are exported from the chloroplast?

deletion, duplication, and inversion

3 types of single chromosome mutations

How did the earliest organisms on Earth most likely produce ATP? A. by glycolysis B. by pyruvate oxidation C. by the citric acid cycle D. by oxidative phosphorylation

A. by glycolysis

Cytochrome b6f is an important complex in the photosynthetic electron transport chain because it facilitates the transport of electrons from PSII to PSI. Another vital function of Cytochrome b6f is that it couples the transport of electrons with the pumping of _____ from the _____. A. protons; stroma into the thylakoid lumen B. ATP; stroma into the thylakoid lumen C. water; thylakoid lumen into the stroma D. NADPH; thylakoid lumen into the stroma

A. protons; stroma into the thylakoid lumen

Which of the following describes the key reactions in fermenting beer, wine, or other alcoholic beverages? A. reduction of acetaldehyde B. reduction of pyruvate C. reduction of glucose D. reduction of lactic acid E. none of the answer choices are correct

A. reduction of acetaldehyde

What is the primary function of Mitosis? A. to produce new somatic cells B. to regulate gene expression C. to produce new proteins D. to produce haploid gametes

A. to produce new somatic cells

what is the correct equation of the synthesis of ATP

ADP + inorganic phosphate + energy -> ATP

Atractyloside is a poison that inhibits the transport of ADP from the cytosol across the mitochondrial membranes and into the mitochondrial matrix. The direct effect of this drug is to stop ATP synthesis because:

ADP is a necessary substrate for the reactions catalyzed by ATP synthase

The enzyme phosphofructokinase-1 (PFK-1) is thought of as a metabolic "valve" that regulates the rate of glycolysis. Which example correctly identified its allosteric activators and inhibitors and their actions?

ADP-activator; citrate-inhibitor

Which of the following are products of the light-dependent reactions of photosynthesis that are required by reactions in the Calvin cycle?

ATP and NADPH

After pyruvate oxidation, the chemical energy of how many carbons of the original glucose molecule is converted to chemical energy in the form of ATP in the remaining steps of cellular respiration? 2 3 4 1 5

Why is pyruvate imported from the cytoplasm into the mitochondrial matrix?

Although pyruvate is made in the cytoplasm, the product of its oxidation, acetyl-CoA, is a substrate for the citric acid cycle, which is located in the mitochondrial matrix.

Animals breathe in air containing oxygen and breath out air containing less oxygen. The consumed oxygen is used:

As an electron acceptor in the respiratory electron transport chain

If the cell shown on the right divides by Mitosis, what is the total number of chromosomes in each of the two new cells? A. 2 B. 4 C. 8 D. 16

B. 4

What is the total number of chromosomes in the cell shown on the right? A. 2 B. 4 C. 8 D. 16

B. 4

How is total genome size measured? A. Number of genes B. Number of base pairs C. Number of chromosomes D. Number of proteins

B. Number of base pairs

Recall that a carbon atom has only four electrons in its valence (outermost) shell. Given this information, what is the MOST likely structural formula for carbon dioxide (CO2)? A. O-C-O B. O=C=O C. O=C-O D. O-C=O

B. O=C=O

Which of the following chemical bonds is unique to nucleic acids? A. peptide bonds B. phosphodiester bonds C. hydrogen bonds D. ionic bonds E. glycosidic bonds

B. phosphodiester bonds

Condition in which homologous chromosomes carry the same alleles. A. Codominance B. Heterozygous C. Homozygous D. Incomplete dominance

C. Homozygous

in respiration, which molecule is the electron donor

C6H12O6

What is the INITIAL carbon input in the Calvin cycle? triose phosphate CO2 C6H12O6 rubisco

CO2

What is the fully oxidized product that results from the pyruvate oxidation stage of cellular respiration?

CO2

Dinosaurs disappeared at the end of which period?

Cretaceous

The current techniques of high-throughput sequencing are collectively called __________ . A. Proteomics B. Sangar Method C. Polymerase Chain Reaction D. Metagenomics E. Next Generation Sequencing

E. Next Generation Sequencing

Copy Number Variations (CNV) are due to ___________? A. Missense mutations B. Frameshift mutations C. Chromosomal level duplications/deletions D. Single nucleotide polymorphisms E. Nucleotide insertion/deletion (indel)

E. Nucleotide insertion/deletion (indel)

As a population geneticist, you find a species of snail with more genetic diversity than humans. What does this mean? E. There is more variation in the gene pool of snails than humans. F. The snails have more genes on their chromosomes than humans. G. The snails have more DNA than humans. H. The snails have a larger population size than humans.

E. There is more variation in the gene pool of snails than humans.

Which of the answer choices do scientists think might have been the first electron donor to arise?

Fe2+

The statement "Humans evolved from chimpanzees" is a common misconception. Which of the statements is a more accurate description of the evolutionary relationship between chimpanzees and humans?

Humans and chimpanzees share a relatively recent common ancestor.

Imagine that a scientist discovers a new flying species of mammal that resembles a winged rabbit. What can the scientist say about this organism?

If molecular sequence data show that bats and this new species share a common ancestor not shared by other mammals, the wings of these two species would be considered homologous.

Certain complexes of the mitochondrial electron transport chain pumps protons. Protons are pumped across the __________ mitochondrial membrane, from the _________ to the ___________

Inner; matrix; intermembrane space

What are the inputs and outputs of the Calvin cycle?

Inputs- CO2, NADPH, and ATP; Outputs-triose phosphate

The sum of all chemical reactions in a cell is referred to as ____________.

Metabolism

In eukaryotes, pyruvate oxidation takes place in the:

Mitochondrial matrix

Kinetic Energy

Motion

Which example represents the reduced forms of the two major electron carriers?

NADH and FADH2

The final (terminal) electron acceptor of the electron transport chain is:

Oxygen

destabilizes the glucose molecule so that it can be broken down in phase 2

Phosphorylating glucose during phase 1 of glycolysis: 1. releases phosphorylated glucose from cells. 2. destabilizes the glucose molecule so that it can be broken down in phase 2. 3. provides electrons to reduce NAD+ in phase 3. 4. provides electrons to reduce FADH in phase 3. 5. None of the other answer options is correct.

gel electrophoresis

Procedure used to separate and analyze DNA fragments by placing a mixture of DNA fragments at one end of a porous gel and applying an electrical voltage to the gel

Which of the following compounds is required for the carboxylation step of the Calvin cycle? ATP NADPH 3-PGA RuBP ATP and NADPH

RuPB

Why does genetic drift have more of an impact on the evolution of small populations than large ones?

Sampling from generation to generation is more variable in small populations than large.

What is a possible explanation for why a population may not be in Hardy-Weinberg equilibrium?

Selection is favoring a particular trait in the population.

Why do some marathon runners attempt to "carbo load" (that is, eat a lot of pasta) before a big race?

The bonds in carbohydrates have high potential energy.

how long two populations of the same species have been separated.

The concept of a molecular clock allows a population geneticist to estimate:

Imagine that you walk out of your warm house on a cold winter's day. What is different between the air inside and outside of your house in this scenario?

The molecules in the warm air of your house are moving faster than those outside

Which statement is true regarding the earliest photosynthetic organisms on Earth?

The organisms likely used molecules other than H2O (that is, H2S) as electron donors.

Which statement is true regarding the molecular clock of hemoglobins?

The rate of the molecular clock of hemoglobins is in between that of pseudogenes and cytochrome c.

Which one of the following statements about the formation of a peptide bond is incorrect?

The reaction is spontaneous

There is some debate about whether Homo floresiensis is a separate species or an aberrant form of Homo sapiens. Regardless, what we do know is that H. floresiensis were only found on an Indonesian island, and adults were only 3 feet tall. What factors would have selected for this distinct phenotype on an island habitat?

The smaller body size was advantageous for living on an island, as food is often limited on islands.

As a population geneticist, you find a species of snails with more genetic diversity than humans. What does this mean?

There is more variation in the gene pool of snails than humans.

Which of the answer choices is true when comparing the Calvin cycle and light-harvesting reactions of photosynthesis?

They take place in different compartments of the same organelle

Rubisco can function as either a carboxylase or an oxygenase.

True

Which of the scenarios represents genetic incompatibility?

Two groups of snakes do not produce fertile offspring because they have a different number of chromosomes.

All cells able to carry out photosynthesis have:

a plasma membrane

All cells able to carry out photosynthesis have:

a plasma membrane.

What is the INITIAL carbon input in the Calvin cycle? a. CO2 b. rubisco c. triose phosphate d. C6H12O2

a. CO2 The Calvin cycle begins with carboxylation which is the addition of carbon dioxide to the five carbon structure.

bacterial transformation

ability of bacteria to alter their genetic makeup by uptaking foreign DNA from another bacterial cell and incorporating it into their own

Glycolysis is:

anaerobic.

lactic acid fermentation occurs in

animals bacteria

You observe two groups of frogs that are closely related. Males from each group "sing" with a species-specific song to attract a female frog. Females only respond to songs sung by males of their species. This is an example of _____ separation and _____ reproductive isolation between two species.

behavioral; pre-zygotic

heterozygous

condition in which homologous chromosomes carry different alleles

homozygous

condition in which homologous chromosomes carry the same allele

The phosphorylation of glucose during glycolysis serves to

destabilize the molecule, making it easier to cleave. trap imported glucose inside the cell.

Tool use is unique to humans.

false

An avalanche is an example of _____ energy.

kinetic

The citric acid cycle takes place in the:

mitochondrial matrix.

A branching pattern depicting the evolutionary history of a group of organisms is called a:

phylogeny

Proton gradient provides ______ energy

potential

According to the figure shown, phosphate groups play a key role in receptor kinase activation by:

providing binding sites to recruit and activate signal-transduction proteins.

NAD+ -> NADH

reduction

stroma

what is the primary function of mitosis?

to produce new somatic cells?

p53 gene

tumor suppressor gene; builds up in the nucleus when phosphorylated causing other inhibitor genes to active which stop the cell from dividing

prometaphase II

(Meiosis II) Spindles attach to kinetochores on chromosomes

Formation of Acetyl CoA Produces: [2]

- CO2 - NADH

Glycolysis Uses: [4]

- glucose - some ATP (net is negative) - ADP +Pi - NAD+

What conditions in a cell would result in all NAD+ being converted to NADH? What would be the consequences on the steps of glucose metabolism?

- if the ETC were shut down none of the NADH would be used and NAD+ would continue= all NAD+ - glycolysis would stop without NAD+ so everything stops

Glycolysis Produces: [3]

- pyruvate - ATP - NADH

Formation of Acetyl CoA Uses: [2]

- pyruvate - NAD+

glycolysis

- starts with the breakdown of glucose - ends with production of 2 molecules of pyruvate - result= net gain of 2 ATP and 2 NADH(electron carrier)

What are the net products of the citric acid cycle for each molecule of acetyl-CoA generated by pyruvate oxidation?

-1 ATP -1 FADH2 -3 NADH

Which regulatory mechanisms are important in keeping glycolysis and the citric acid cycle in relative balance to each other?

-ATP inhibits phosphofructokinase-1 -Citrate inhibits phosphofructokinase-1 -AMP up-regulates phosphofructokinase-1 -ADP up-regulates phosphofructokinase-1

Each round of the citric acid cycle begins when the four-carbon molecule oxaloacetate is converted to the six-carbon molecule citrate. As the cycle progresses, two carbons are eliminated to regenerate the oxaloacetate. The added carbon is supplied by _____ and the two eliminated carbons are released as _____.

-Acetyl-CoA -CO2

Which components of the electron transport chain directly move protons across the inner mitochondrial membrane?

-Complex III -Complex I -Complex IV

DNP (2,4-dinitrophenol) is an effective weight loss agent that was used in diet pills in the 1930s. It has since been removed from the market because of serious side effects such as fever, cataracts, rashes, and sometimes death. DNP inserts into the inner mitochondrial membrane and allows the flow of protons from the intermembrane space to the matrix. Based on this information, which of the answer choices might you predict? Select all that apply.

-Decreased difference in pH between the matrix and intermembrane space -Dissipation of the proton gradient -Reduced ATP production

When oxygen is depleted, the citric acid cycle stops. Which of the answer choices would you need to add to the system to restore activity?

-FAD -NAD+

Where in the eukaryotic cell does each of the following steps occur? -Glycolysis -Acetyl-CoA synthesis -Citric acid cycle -Respiratory (electron transport) chain -ATP synthesis -Fermentation

-Glycolysis: cytosol/cytoplasm -Acetyl-CoA synthesis: mitochondria, matrix -Citric acid cycle: mitochondria, matrix -Respiratory (electron transport) chain: Inter-membrane space -ATP synthesis: mitochondria, intermembrane -Fermentation: cytosol/cytoplasm

The coronary arteries supply oxygenated blood to heart muscles. Following a heart attack, which of the events would occur in heart tissue due to a block in the coronary arteries?

-Lactic acid would accumulate in the tissue due to glycolysis and fermentation -The production if ATP would decrease -Phosphofructokinase, an intermediary enzyme of glycolysis, would be activated

Which statements are true regarding redox reactions?

-Oxidizing agents may accept H+ ions -If a molecule accepts electrons, it has been reduced -A molecule that has gained H atoms is said to be reduced -Redox reactions may involve the transfer of hydrogen ions (H+) -Oxidizing agents accept electrons

The coronary arteries supply oxygenated blood to heart muscle. Following a heart attack, what would occur in heart tissue due to a block in the coronary arteries?

-Phosphofructokinase, an intermediary enzyme of glycolysis, would be activated. -The production of ATP would decrease. -Lactic acid would accumulate in the tissue due to glycolysis and fermentation.

During which stages of cellular respiration is carbon dioxide released?

-Pyruvate oxidation -The citric acid cycle

Glucose is stored in plants as ________ and in animals as __________

-Starch -Glycogen

Which of the following statements is/are true? Choose all that apply.

-The energy of the starting materials for a reaction will equal the sum of energies of the products plus energy released as heat and disorder. -The amount of useable energy resulting from a reaction will always be less than the total energy available in the starting materials.

Pyruvate oxidation:

-occurs twice for each glucose oxidized. -occurs in the mitochondrial matrix. -shows synthesis of the substrate that enters the citric acid cycle.

Which of the following is part of the photosynthetic electron transport chain between photosystems I and II?

-plastocyanin -plastoquinone -cytochrome-b6f complex

Which of the following can directly participate in creating the binding specificity of an enzyme active site? Choose all that apply.

-positively charged amino acid side chains -hydrophilic amino acid side chains -negatively charged amino acid side chains -hydrophobic amino acid side chains

Which of the following is a component of a molecule of ATP? Select all correct choices.

-three phosphate groups -adenine -ribose -three phosphate groups and ribose

Earth's earliest organisms...

.... likely carried out fermentation and may have had rudimentary proton pumps.

Tracing the metabolism of one glucose molecule, how many carbon atoms are fully oxidized to CO2 at the completion of glycolysis?

if the cell shown on the right divides by mitosis, what is the total number of chromatids in each of the two new cells?

0 technically, 4 chromosomes but no chromatids.

You are studying a population of 100 diploid individuals. Initially, there were two alleles at a specific gene, each at equal frequency, p=q. You come back and sequence the same gene in the same individuals five years later and discover a single point mutation in one individual (only present in one chromosome). What is the frequency of the mutant allele in this population?

0.005

You are working with a population of snails. During the mating season, you observe that individuals in the population will only mate with others of the same genotype. For example, Mm individuals will only mate with Mm individuals, and mm individuals will only mate with other mm individuals. There are only two alleles for this gene (M is dominant; m is recessive). You have determined that the frequency of the M allele is 0.5. After one generation, what is the expected genotype frequency for Mm individuals in this population?

0.25

beta oxidation produces

1 FADH2, 1 NADH which is then go to the electron transport chain

Which of these equations demonstrates energetic coupling in a cell? Equation 1: ATP + H2O → ADP + Pi ΔG1 = -7 kcal/mol Equation 2: phosphoenolpyruvate + H2O → pyruvate + Pi ΔG2 = -14.8 kcal/mol Equation 3: glucose + Pi → glucose-6-phosphate + H2O ΔG3 = +3.3 kcal/mol Equation 4: ADP + Pi → ATP + H2O ΔG3 = +7 kcal/mol equations 2 and 3 equations 3 and 4 equations 1 and 4 equations 1 and 2 equations 1 and 3

1 and 3

Which statements are true of an inhibitor that binds the active site of an enzyme? Select all that apply.

1. Adding more substrate can reduce the effect of these inhibitors. 2. These inhibitors are structurally similar to the normal substrate of an enzyme. 3. These inhibitors compete with the substrate for the active site of the enzyme.

Which of the statements are true? Select all that apply.

1. The energy for a reaction equals the sum of the energy in the product plus energy released as heat and disorder. 2. The amount of usable energy resulting from a reaction is always less than the total energy available at the start of the reaction.

During translation, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal sequences. Which peptides would you expect to find in the polypeptide that will eventually fold to become an ion channel protein? Select all that apply.

1. an amino-terminal signal peptide 2. a signal-anchor peptide

Which actions would affect the secondary structure of a protein?

1. breaking the hydrogen bonds between amino acids 2. changing the sequence of amino acids

Once molecules of pyruvate enter the mitochondria, how many electron carriers (NAD+ or FAD) are reduced per original molecule of glucose?

When photosynthesis is fully operational under conditions of intense light, the pH of the thylakoid lumen may be as much as three full pH units lower than the pH of the stroma of the chloroplast. That means that there are _____ protons in the thylakoid lumen compared to the stroma.

1000 times more

Which choice correctly lists the approximate number of ATP produced by (1) metabolism of a 16-carbon fatty acid, (2) fermentation of a single glucose, and (3) aerobic respiration of a single glucose, in that order? For this calculation, you will need to know that each 2-carbon unit cleaved from the fatty acid yields one NADH and one FADH2, and the 2-carbon unit is added to coenzyme A to become acetyl-CoA, which is further metabolized by the citric acid cycle.

108, 2, 32

The half-life of 14C is 5,730 years. Archaeologists dig up a seed that contains 0.25 parts per trillion 14C. If it originally contained 1 part per trillion 14C, how old is the archaeological specimen?

11,460 years

You found a fossilized skull of a saber-toothed tiger while kayaking around the mud flats of Mobile Bay! Subsequent analysis of the skull showed that the percent concentration of carbon-14 was roughly 12.5% of what is found in a living organism. According to this result, how long has it been since this tiger was alive? Remember, the half-life of carbon-14 is 5,730 years.

17,190 years

The ratio of ATP to NADPH used by the Calvin cycle is approximately 3:2 (3 moles ATP used for each 2 moles NADPH). What is the minimum number of these molecules required to synthesize one mole of glucose?

18 moles ATP + 12 moles NADPH

A single molecule of glucose requires _____ "turn(s)" through the citric acid cycle for its chemical energy to be completely harvested.

For every six CO2 molecules incorporated into carbohydrate molecules, how many triose phosphates can be exported from the chloroplast?

For every six CO2 molecules incorporated into carbohydrate molecules, how many triose phosphates can be exported from the chloroplast? 10 12 6 2 1

For every six CO2 molecules incorporated into carbohydrate molecules, how many triose phosphates can be exported from the chloroplast? 2 12 10 6 1

How many reactions in glycolysis directly generate ATP by substrate-level phosphorylation?

How many reactions in glycolysis directly generate ATP?

Tracing the metabolism of one glucose molecule, how many carbon atoms are fully oxidized to CO2 at the completion of the pyruvate oxidation stage?

how many rounds of the calvin cycle are needed to produce one molecule of glucose

For every six CO2 molecules incorporated into carbohydrate molecules, how many triose phosphates can be exported from the chloroplast? 2 12 1 6 10

2 Triose phosphate is a 3-carbon sugar, so six CO2 molecules would yield 2 triose phosphate molecules

Once they have been processed through the citric acid cycle, the acetyl-CoA molecules from a single glucose molecule produce:

2 ATP, 6 NADH, 4 CO2, and 2 FADH2

Once they have been processed through the citric acid cycle, the acetyl-CoA molecules from a single glucose molecule produce:

2 ATP, 6 NADH, 4 CO2, and 2 FADH2.

citric acid cycle substrates and products

2 acetyl CoA → 6 NADH, 2 FADH2, 4 C02, 2 ATP

Of the 6 carbons in a starting molecule of glucose, at the completion of pyruvate oxidation, _____ carbons are fully oxidized to _____, while _____ carbons remain in _____.

2 carbons; to CO2; 4 carbons; acetyl groups

What is a net product of glycolysis?

2 pyruvate

Which of the following is a net product of glycolysis?

2 pyruvate

pyruvate oxidation substrates and products

2 pyruvate → 2 acetyl CoA, 2 NADH, 2 C02

What is a net product of glycolysis?

2 pyruvate, 2 ATP, 2 NADH

how its living and where its living

2 things that affect the genome

insertion and translocation

2 types of two chromosome mutations

protein-coding sequences are approximately ____ of the human genome

Imagine you are following a particular tRNA, called tRNAQ, through the process of translation in a eukaryote. In what order does tRNAQ go through the steps listed? Note that some steps may be used more than once. 1. The polypeptide is transferred to tRNAQ. 2. tRNAQ binds the A site of the ribosome. 3. tRNAQ binds the P site of the ribosome. 4. The ribosome shifts, with tRNAQ still bound. 5. tRNAQ binds the E site of the ribosome.

2, 1, 4, 3, 4, 5 The first site with which tRNAQ binds is A. After the polypeptide is transferred to tRNAQ, the ribosome shifts, and this places tRNAQ in the P site. When the ribosome moves again, uncharged tRNAQ is transferred to the E site.

Comparison of mtDNA sequences revealed that all humans shared a common mtDNA ancestor around 200,000 years ago. What was the predicted date of the common ancestor under the multiregional hypothesis of modern human origins?

2,000,000 years ago

Which phases of cellular respiration require oxygen to occur?

2-4

The breakdown of one glucose molecule during glycolysis results in 2 molecules of pyruvate, which are then oxidized to 2 molecules of acetyl-CoA, and these, in turn, are substrates for the citric acid cycle. If all three fatty acids of a triacylglycerol molecule (a fat molecule) are palmitic acid (C16, having 16 carbons), how many acetyl-CoA molecules would result from beta-oxidation of all of these fatty acids?

A photosynthetic electron-transport chain harnesses approximately what percentage of the sun's usable energy arriving at the surface of a leaf?

24%

Approximately what percentage of the sun's usable energy, arriving at the surface of a leaf, does the photosynthetic electron transport chain capture?

24%

Nicotinamide adenine dinucleotide is an electron carrier in many important cellular reactions. It exists in an oxidized form (NAD+) and a reduced form (NADH). What is the missing component in the reaction: NAD+ + ____ + H+ → NADH?

2e-

An mRNA molecule has a sequence 5'—CAGAUCUAAUGCUUAUCGGAU—3'. When translated in a laboratory setting where translation can be initiated anywhere along the molecule, how many reading frames are possible?

How many CO2 molecules must enter the Calvin cycle for each molecule of triose phosphate exported from the chloroplast?

The product of the Calvin cycle is a triose-phosphate sugar that is either exported from the chloroplast or used to regenerate RUBP. How many times must each of the reactions in the Calvin cycle take place in order to complete the synthesis of one 3-carbon triose phosphate sugar molecule?

Which of the following is a net product of the citric acid cycle for each molecule of pyruvate generated in glycolysis? Select all correct choices.

3 NADH 1 FADH2 1 ATP

Which of these equations is/are endergonic? Equation 1: ATP + H2O → ADP + Pi ΔG1 = -7 kcal/mol Equation 2: phosphoenolpyruvate + H2O → pyruvate + Pi ΔG2 = -14.8 kcal/mol Equation 3: glucose + Pi → glucose-6-phosphate + H2O ΔG3 = +3.3 kcal/mol Equation 4: ADP + Pi → ATP + H2O ΔG3 = +7 kcal/mol equations 1 and 2 equations 1 and 4 equations 1 and 3 equations 2 and 3 equations 3 and 4

3 and 4

In aerobic cellular respiration, the approximate yield of ATP molecules from the full oxidation of a molecule of glucose is:

The approximate yield of ATP from the full oxidation of a molecule of glucose is:

Among the exons in a primary RNA transcript, two are subject to alternative splicing. In RNA processing, one or the other or neither or both regions may be excised from the primary transcript as introns. How many different amino acid sequences could this transcript encode?

Tracing the metabolism of one glucose molecule, how many carbon atoms are available for further oxidation at the completion of the pyruvate oxidation stage?

how many residues separate amino acids that are stabilized by hydrogen bonds in a helices

what is the total number of chromosomes in the cell to the right? count the X's

if the cell shown on the right divides by mitosis, what is the total number of chromosomes in each of the two new cells?

4 chromosomes

Approximately what percentage of the sun's output is available for photosynthesis?

40%

if you cross a heterozygous individual (Aa) with a homozygous recessive individual(aa) what is the probability that the offspring will be homozygous recessive

50%

According to the fossil record, when did the earliest animals appear on Earth?

580 million years ago

Tracing the metabolism of one glucose molecule, how many carbon atoms are fully oxidized to CO2 at the completion of aerobic respiration?

Within the tetrapods, if mammals are excluded, how many different sister groups can be defined?

A polycistronic mRNA with six protein-coding genes has:

6 start codons and 6 stop codons

The Baltimore System of Viral Classification states that there are ____ different types of viruses based on their genomic material.

what is the total number of chromatids in the cell shown to the right?

The diagram shown represents the four stages of aerobic cellular respiration as four simple boxes. Many of the "inputs" and "outputs" are shown as arrows. Open arrows represent "energy management molecules" (ATP and electron carriers), and closed arrows represent other inputs and outputs, such as substrates and products. Use this diagram to answer the question.

binary fission

A form of asexual reproduction in single-celled organisms by which one cell divides into two cells of the same size

Budding

A form of asexual reproduction in which a new cell grows out of the body of a parent.

G0 phase

A nondividing state occupied by cells that have left the cell cycle, sometimes reversibly.

Consider the refrigerator in your kitchen. Based on what you know about the first and second laws of thermodynamics, how does a refrigerator most likely work?

A refrigerator removes heat from its interior and transports this energy outside, into the kitchen

Consider the refrigerator in your kitchen. Based on what you know about the first and second laws of thermodynamics, how does a refrigerator most likely work? A refrigerator removes heat from its interior and transports this energy outside, into the kitchen. A refrigerator removes the potential energy contained within food. A refrigerator destroys any heat in its interior, or in the food it contains. A refrigerator both destroys any heat in its interior, or in the food it contains, and creates new energy in the form of cold. A refrigerator creates new energy, although it is in the form of cold rather than heat.

A refrigerator removes heat from its interior and transports this energy outside, into the kitchen.

Protein-coding sequences are approximately _____ of the human genome? A. 2% B. 12% C. 20% D. 25% E. 92%

A. 2%

Concerning ATP, which of the following statements is FALSE? A. ATP has less potential energy than ADP B. Energy from ATP can be used to drive the synthesis of macromolecules C. ATP is produced from the phosphorylation of ADP D. ATP can be used to phosphorylate other molecules E. ATP is a type of nucleic acid

A. ATP has less potential energy than ADP

Type of inheritance pattern in which heterozygous genotypes simultaneously express the phenotypes of multiple alleles. A. Codominance B. Polygenic C. Pleiotropy D. Incomplete Dominance

A. Codominance

Which of the following biological processes is likely responsible for the origin of eukaryotic cells from prokaryotic ancestors? A. Endosymbiotic evolution B. Spontaneous generation C. Organic polymerization D. Panspermia E. None of the above

A. Endosymbiotic evolution

Which of the following statements is FALSE? A. Genes that are closer to each other will recombine more frequently B. X-linked genes are typically not found on the Y chromosome C. Someone who "carries" a trait is heterozygous D. Polygenic traits produce relatively larger amounts of phenotypic variation E. Recombination produces two recombinant and two non-recombinant chromosomes

A. Genes that are closer to each other will recombine more frequently

Which of the following statements about homologous chromosomes is TRUE? A. Homologous chromosomes carry the same alleles B. Homologous chromosome pairs are never separated during Mitosis C. Homologous chromosomes are aligned in the center of the cell during metaphase of Mitosis D. There are 23 pairs of homologous chromosomes in a human somatic cell E. In a homologous chromosomes pair, one chromosome is maternal and the other chromosome is paternal in origin

A. Homologous chromosomes carry the same alleles

Why do moths, which are active at night, only visit white flowers? Which of the following is a prediction based on this question? A. If moth navigation is dictated by sight, then moths will not visit white flowers that have been painted red. B. Moths are active at are active at night. C. Moths navigate by sight and white flowers are easier to see at night D. Only 5% of painted flowers were visited by moths.

A. If moth navigation is dictated by sight, then moths will not visit white flowers that have been painted red.

Which one of the following statements BEST represents the relationship between cellular respiration and photosynthesis? A. Photosynthesis stores energy in carbohydrates, while respiration releases it. B. Photosynthesis occurs only during the day and respiration occurs only at night. C. Respiration occurs only in animals and photosynthesis occurs only in plants. D. Respiration stores energy in organic molecules, while photosynthesis releases it. E. Photosynthesis reverses the biochemical pathways of respiration.

A. Photosynthesis stores energy in carbohydrates, while respiration releases it.

Which of the following accurately describes the role of CRP-cAMP in the Lac Operon? A. Positive regulator B. Gene coding sequence C. Operator D. Promoter. E. Negative regulator.

A. Positive regulator

Which of the following is a true statement about sympatric speciation? A. Sympatric speciation requires a selective disadvantage of hybrids (e.g., medium-billed birds) in two diverging populations. B. Sympatric speciation requires physical separation of two populations. C. Sympatric speciation requires a population in which all individuals have an equal chance of mating with one another. D. Sympatric speciation requires that all individuals use the same resources in the area where they are found.

A. Sympatric speciation requires a selective disadvantage of hybrids (e.g., medium-billed birds) in two diverging populations.

What did the results of the Gurdon experiment tell us? A. That cell differentiation is due to changes in gene expression B. That cell differentiation is due to nuclear transfer and recombination C. That cell differentiation is due to random mutations. D. That cell differentiation is due to gene loss.

A. That cell differentiation is due to changes in gene expression

Examine the DNA molecule shown below with parent strands separating in preparation for replication and synthesis of new daughter strands. Which of the follow is a TRUE statement? (the top strand is 3 --> 5) A. The top strand will produce a lagging daughter strand B. Each original parent strand will be read in the 5' to 3' direction. C. The new leading daughter strand will begin with: CAACGT D. New daughter strands are constructed in the 3' to 5' direction (the opposite direction of their parent strand) E. None of these answer choices are true statements regarding the DNA molecule below

A. The top strand will produce a lagging daughter strand

The blood type A can be produced by what genotypes?

The energy currency of a cell is ____________.

ATP

The hydrolysis of _____ is an exergonic reaction that drives many endergonic reactions in a cell.

ATP

The hydrolysis of ____________ is an exergonic reaction that drives many endergonic reactions in a cell.

ATP

Which of the following is needed directly to produce both triose phosphates and RuBP in the Calvin cycle?

ATP

Which of the following is needed directly to produce both triose phosphates and RuBP?

ATP

Which of the following is needed directly to produce both triose phosphates and RuBP? Please choose the correct answer from the following choices, and then select the submit answer button. ATP rubisco NADPH photosystem II O2

ATP

Which of the following is required for the preparatory phase of glycolysis and then produced during the payoff phase?

ATP

Which one of the following is the most common energy "currency" for a cell?

ATP

what is produced by cyclic electron flow in the light reactions?

ATP

Phosphofructokinase-1 inhibitors

ATP citrate

Which of the following are produced directly as a result of the movement of electrons through the photosynthetic electron transport chain? ATP and NADPH carbohydrates and ATP water and carbohydrates oxygen and carbohydrates

ATP and NADH

In photosynthesis, the reduction of 3-phosphoglycerate to form carbohydrate requires:

ATP and NADPH

Which of the following are produced directly as a result of the movement of electrons through the photosynthetic electron transport chain?

ATP and NADPH

Which of the following are produced directly as a result of the movement of electrons through the photosynthetic electron transport chain? Please choose the correct answer from the following choices, and then select the submit answer button. carbohydrates and ATP ATP and NADPH oxygen and carbohydrates water and carbohydrates

ATP and NADPH

Which of the following are produced directly as a result of the movement of electrons through the photosynthetic electron transport chain? water and carbohydrates carbohydrates and ATP ATP and NADPH oxygen and carbohydrates

ATP and NADPH

Which of the following are products of the light-dependent reactions of photosynthesis that are required by reactions in the Calvin cycle? Please choose the correct answer from the following choices, and then select the submit answer button. ATP and oxygen ATP and NADPH NADP+ and oxygen Water and NADPH

ATP and NADPH

the light reactions of photosynthesis supply the calvin cycle with

ATP and NADPH

what are products of the light reactions of photosynthesis that are utilized in the calvin cycle?

ATP and NADPH

In photosynthesis, the reduction of 3-phosphoglycerate to form carbohydrate requires:

ATP and NADPH.

In photosynthesis, the reduction of 3-phosphoglycerate to form carbohydrate requires: Please choose the correct answer from the following choices, and then select the submit answer button. rubisco. RuBP. ATP and NADPH. ATP. NADPH.

ATP and NADPH.

In photosynthesis, the reduction of 3-phosphoglycerate to form carbohydrate requires: NADPH. RuBP. ATP. rubisco. ATP and NADPH.

ATP and NADPH.

Which regulatory mechanism is activated when the overall energy availability of a cell is high?

ATP inhibits phosphofructokinase 1.

Which regulatory mechanism is activated when the overall energy availability of a cell is high?

ATP inhibits phosphofructokinase-1

ATP consists of..

ATP is a nucleotide composed of adenine, ribose, and three phosphate groups.

During the citric acid cycle

ATP is synthesized by substrate-level phosphorylation

During the citric acid cycle:

ATP is synthesized by substrate-level phosphorylation

During the citric acid cycle: ATP is synthesized by oxidative phosphorylation. fuel molecules are completely reduced. high-energy electrons are removed from NAD+ and FADH. ATP is synthesized by substrate-level phosphorylation.

ATP is synthesized by substrate-level phosphorylation

During the citric acid cycle:

ATP is synthesized by substrate-level phosphorylation.

Biology example of a potential → kinetic energy conversion

ATP is used to move motor molecules like actin

If plants are exposed to a toxin that makes the thylakoid membrane leaky to protons, predict the rate of ATP production by the plants. ATP production will decrease. ATP production does not change. ATP production will increase.

ATP production will decrease.

If plants are exposed to a toxin that makes the thylakoid membrane leaky to protons, what would you predict about the rate of ATP production by the chloroplasts?

ATP production will decrease.

what is the role of ATP in the calvin cycle

ATP provides the energy needed to drive the cycle

During a long bout of sustained exercise, in which order will your body's energy stores/sources be used?

ATP stored in muscle, glycogen stored in muscle, glycogen stored in the liver, fatty acids

Some drugs allow protons [H+] to diffuse across the mitochondrial inner membrane. When such a drug is added, what will happen to ATP synthase?

ATP synthesis will decrease; because the diffusion of protons decreases the concentration gradient that powers ATP synthase

Glycolysis is a series of chemical reactions (endergonic and exergonic) by which the cell can obtain ATP. NAD+ plays a crucial role in the reactions of glycolysis by:

Accepting electrons during glycolysis, with the overall result that glucose is partially oxidized to pyruvate

gametes in the ratio of 1 A allele: 1 a allele

According to Mendel's principle of segregation, a heterozygous (Aa) plant will produce: *gametes with only the A allele *gametes with only the a allele *gametes in the ratio of 1 A allele: 1 a allele *gametes in the ratio of 3 A alleles: 1 a allele *some gametes with the A allele and some with the a allele, but in no predictable ratio

Which statement is true about the presence or absence of plasma membranes?

All cells have a plasma membrane.

Cann's studies involving mitochondrial DNA showed that the two deepest branches of the human family tree are African. Which of the observations explains this statement?

All humans evolved in Africa and only later migrated to other places.

The tree of human evolution is shallow. What does that mean?

All humans, no matter how distantly related they are, share a recent common ancestor.

Imagine that a researcher tries to reduce the size of an enzyme by removing all the amino acids from the protein except those flanking, and constituting, the active site. Why wouldn't this work? Without the additional amino acids, the protein may not fold properly. The removal of the amino acids may affect the ability of the enzyme to bind to substrates. The removal of the amino acids will likely affect the shape of the active site. All of these choices are correct.

All of the above

During the pyruvate oxidation stage of cellular respiration, which of the following occurs? -the formation of CO2 -the formation of acetyl-CoA -the oxidation of pyruvate -the formation of NADH -All of these choices are correct

All of these choices are correct

Xanthophyll pigments: Please choose the correct answer from the following choices, and then select the submit answer button. prevent formation of reactive oxygen species. absorb light energy. convert light energy into heat. reflect yellow light. All of these choices are correct.

All of these choices are correct

During the pyruvate oxidation stage of cellular respiration, which of the following occurs?

All of these choices are correct.

Which of the following statements is true regarding reactive oxygen species? Please choose the correct answer from the following choices, and then select the submit answer button. Reactive oxygen species are formed when excess electrons are added to O2. Reactive oxygen species are likely to form if NADP+ is rare in a cell. Reactive oxygen species can form when O2 is exposed to excess light energy. Reactive oxygen species can be "neutralized" by antioxidants. All of these choices are correct.

All of these choices are correct.

Xanthophyll pigments: prevent formation of reactive oxygen species. absorb light energy. convert light energy into heat. reflect yellow light.

All of these choices are correct.

If a mutation blocked the function of the signal recognition particle, making it unable to bind signal sequence, what would result?

All proteins would be translated on free ribosomes in the cytoplasm.

genome

All the genetic material in an organism

How would inbreeding affect allele frequencies and genotype frequencies in a population?

Allele frequencies would not change; genotype frequencies would change.

_____ is the gradual emergence of two or more species as a result of the geographic separation of two or more groups of animals of the same species.

Allopatric speciation

ADP increases the phosphofructokinase-mediated reaction by binding at a distinct binding site. This is an example of _______

Allosteric inhibition

allosteric enzyme

An enzyme whose activity is affected by binding a molecule at a site other than the active site. Typically, allosteric enzymes change their shape on binding an activator or inhibitor.

Assuming that all is working properly, which of the following is at a higher energy level?

An excited-state antenna chlorophyll

Assuming that all is working properly, which of the following is at a higher energy level? An excited-state reaction center chlorophyll An excited-state antenna chlorophyll

An excited-state antenna chlorophyll

Which of the following statements is FALSE? A. Heritability is the degree to which phenotypic variations are due to genotypic variations B. Francis Galton showed that the average height of offspring was the same as their parents C. High concordance rates equal high heritability D. Complex traits are often polygenic traits E. Francis Galton showed that the environment affects phenotypic variation

B. Francis Galton showed that the average height of offspring was the same as their parents

Which of the following bind to promotors during the regulation of transcription in eukaryotes? A. Enhancers B. General/basal transcription factors C. Activators D. Mediators

B. General/basal transcription factors

Condition in which homologous chromosomes carry different alleles. A. Codominance B. Heterozygous C. Homozygous D. Incomplete dominance

B. Heterozygous

What does it mean when we say "populations evolve, not individuals"? A. Evolution only occurs in large populations B. Individuals cannot change their genetic makeup, but genotype frequencies in a population can change C. Evolution is a change in the genetic make-up of an individual over their lifespan D. Only alleles change over time, not genotype frequencies.

B. Individuals cannot change their genetic makeup, but genotype frequencies in a population can change

Which of the following statements about mutations is FALSE? A. Synonymous point mutations do not alter the amino acid sequence B. Nonsense point mutations produce a start codon C. Missense point mutations alter the amino acid sequence D. A duplication mutation occurs on a single chromosome E. None of the answer choices are correct (they are all true)

B. Nonsense point mutations produce a start codon

Which of the following statements is FALSE? A. Heterotrophs obtain carbon from organic macromolecules B. Plants occupy a trophic level that contains the least biological energy C. The disorganized energy (entropy) of a system is never decreasing D. A molecule is reduced when it gains an electron(s) and energy E. None of these answer choices are FALSE

B. Plants occupy a trophic level that contains the least biological energy

The genome size of which of the following is approximately 30,000 base pairs. A. Free living bacteria B. SARS CoV-2 C. Viroid D. Obligate symbiont bacteria E. Multiple answer choices are correct

B. SARS CoV-2

Sloths are arboreal (tree-dwelling) creatures so why do they defecate (poop) on the ground? Which of the following is a hypothesis based on this question? A. If sloth defecating behaviors are to facilitate mating, then the removal of sloth feces will not affect mating success. B. Sloths defecate in this way in order to attract mates C. Removal of sloth feces is the best way to answer this question D. No sloths successfully mated in areas where sloth feces was removed E. None of the above

B. Sloths defecate in this way in order to attract mates

What is the primary function of photosynthesis? A. To produce oxygen B. To produce carbohydrates C. To produce carbon dioxide D. To produce water E. All of the above

B. To produce carbohydrates

In Mendel's peas, an individual that is heterozygous for seed color: A. has only one allele for seed color. B. has two different alleles for seed color. C. will express the recessive allele in the phenotype. D. will express both the dominant and recessive allele in the phenotype.

B. has two different alleles for seed color.

In the absence of oxygen, lactic acid fermentation: A. regenerates NAD+ from the oxidation of pyruvate. B. regenerates NAD+ from the reduction of pyruvate. C. generates ATP from the oxidation of pyruvate. D. generates ATP from the reduction of pyruvate. E. regenerates NADH from the reduction of pyruvate.

B. regenerates NAD+ from the reduction of pyruvate.

Lactic acid fermentation occurs in:

Bacteria and animals

A little girl has a male dog and a female cat in her house at the same time. The dog and cat are the same size, and they are friendly with each other. Why don't these two animals ever mate?

Because the dog and cat are behaviorally isolated from each other

Why is the photosynthetic electron transport chain sometimes referred to as the "Z scheme"? Because the electrons zigzag through the electron transport chain as they travel from one photosystem to another in the thylakoid membrane. Because the electrons zigzag through the antenna chlorophyll molecule to get to the reaction center. Because the energy level of the electrons increases and decreases and increases and decreases.

Because the energy level of the electrons increases and decreases and increases and decreases.

If Archaeopteryx was instead a sister taxon to Oviraptosaurs, how would this change our conclusions about the evolution of birds? Please choose the correct answer from the following choices, and then select the submit answer button.

Birds would be most closely related to the group Oviraptosaurs.

If you cross a heterozygous individual (Aa) with a homozygous recessive individual (aa), what is the probability that the offspring will be homozygous recessive? A. 0% B. 25% C. 50% D. 75%

C. 50%

Which of the following is considered a pluripotent embryonic stem cell? A. A cell from mesodermal tissue B. A zygote C. A cell from the inner cell mass D. A cell from the umbilical cord. E. An egg.

C. A cell from the inner cell mass

Suppose you discovered a mutant strain of spinach in which the thylakoid membranes were slightly permeable to protons and thus allowed a slow leakage of protons. How would this leakage affect the yield of ATP and/or NADPH from the light dependent reactions? A. NADPH yield would decrease. B. NADPH yield would increase. C. ATP yield would decrease. D. ATP yield would increase. E. There would be no change.

C. ATP yield would decrease.

Which of the following is not part of the polymerase chain reaction (PCR) process? A. Annealing B. Extending C. Annotating D. Denaturing

C. Annotating

Which question cannot be answered by the question cannot be answered by the scientific method? A. Is eyewitness testimony in criminal proceedings reliable? B. Does chemical runoff give rise to hermaphrodite fish? C. Does a child conceived from a sperm donor have the right to know right to know who the donor was? D. Does hair that is shaved grow back coarser? E. Does the vaccine for measles cause autism?

C. Does a child conceived from a sperm donor have the right to know right to know who the donor was?

Which of the following statements about gametes is FALSE? A. Sperm, pollen, & eggs are all gametes B. Compared to somatic cells, gametes contain half the number of chromosomes C. Gametes contain homologous pairs of chromosomes D. Once produced, gametes will not divide any further E. Each gamete is genetically unique

C. Gametes contain homologous pairs of chromosomes

Which of the following has the smallest genome? A. Free living bacteria B. SARS CoV-2 C. Human mitochondria D. Obligate symbiont bacteria E. Japanese white birch chloroplast

C. Human mitochondria

Which of the following statements about CpG Islands is FALSE? A. The cytosines in CpG Islands can become methylated B. The "G" in CpG Islands stands for Guanine. C. Methylation of CpG Islands promotes transcription. D. >50% of CpG Island sequences are CG sequences.

C. Methylation of CpG Islands promotes transcription.

What is the primary function of cellular respiration? A. To produce carbon dioxide B. To produce oxygen C. To produce ATP D. To produce water E. All of the above

C. To produce ATP

How do mass extinction events influence subsequent species composition and diversity? A. by immediately increasing species diversity B. by permanently altering climate C. by reducing competition among surviving organisms D. by eliminating smaller organisms instead of larger organisms

C. by reducing competition among surviving organisms

According to Mendel's principle of segregation, a heterozygous (Aa) plant will produce: A. gametes with only the A allele. B. gametes with only the a allele. C. gametes in the ratio of 1 A allele:1 a allele. D. gametes in the ratio of 3 A alleles:1 a allele. E. some gametes with the A allele and some with the a allele, but in no predictable ratio.

C. gametes in the ratio of 1 A allele:1 a allele.

If you crossed a true-breeding yellow-seeded plant (AA) with a heterozygous yellow-seeded plant (Aa), the offspring: A. genotypic ratio would be 3 AA:1 Aa. B. genotypic ratio would be 1 Aa:1 aa. C. genotypic ratio would be 1 AA:1 Aa. D. phenotypic ratio would be 1/2 yellow-seed plants and 1/2 green-seed plants. E. None the answer choices are correct

C. genotypic ratio would be 1 AA:1 Aa.

An individual is heterozygous for a gene if: A. his or her mother is heterozygous for the gene. B. his or her father is heterozygous for the gene. C. he or she developed from a sperm and egg that carried different alleles for that gene. D. he or she developed from a sperm and egg that carried the same allele for that gene. E. only one allele is present in the population.

C. he or she developed from a sperm and egg that carried different alleles for that gene.

Overall reactions of cellular respiration [equation]

C6H12O6 + 6 O2 → 6 CO2 + 6 H2O + energy

Which of these reactions summarizes the overall reactions of cellular respiration?

C6H12O6 + 6 O2 → 6 CO2 + 6 H2O + energy

What is the reaction that summarizes the overall reaction of cellular respiration?

C6H12O6 + 6O2 = 6CO2 + ^H2O + energy

cellular respiration equation

C6H12O6 + 6O2 →6CO2+ 6H2O + ATP

in respiration, what is oxidized and what is reduced

C6H12O6 is being oxidized and O2 is being reduced

Nicotine from cigarette smoke acts as a ligand and associates with the acetylcholine receptor on specific cells in the nervous system. Nicotine eventually produces feelings of pleasure and well-being. The listed statements are descriptions of the events that happen in the cellular response to nicotine. Place the events in the correct order to describe the steps in the signaling pathway. A) The acetylcholine receptor is an ion channel, and when a ligand binds, the ion channel opens. B) An influx of ions carries the signal to the reward areas of the brain. C) Nicotine binds to the transmembrane protein that normally binds the neurotransmitter acetylcholine. D) The signal causes release of dopamine in the brain, which causes good feelings. E) Nicotine is quickly eliminated from the body (causing cravings for more cigarettes to produce good feelings).

C; A; B; D; E When nicotine binds, it mimics the ligand of the acetylcholine receptor, which is a ligand-gated ion channel. Upon activation, ions flow through the channel and cause a cellular response of the release of dopamine in the brain. Nicotine is cleared quickly from the body, so the effect of it is temporary.

G1/S cyclin

CDK complex prepares cell for DNA replication

S cyclin

CDK helps initiate DNA synthesis

M cyclin

CDK helps prepare the cell for mitosis

Carbon enters the Calvin cycle in the form of:

CO2

Each molecule of acetyl-CoA that enters the citric acid cycle carries two of the carbon atoms from the original starting glucose molecule. These carbon atoms will ultimately leave the citric acid cycle as carbon atoms in which of the following?

CO2

The ethanol resulting from fermentation of glucose only accounts for four of the six starting carbon atoms. In which of the following are the other two carbon atoms found?

CO2

What is the initial carbon input in the Calvin cycle?

CO2

When a single pyruvate is converted to acetyl-CoA during pyruvate oxidation, the other products of the reaction are:

CO2 and NADH.

Some bacteria run the citric acid cycle in reverse. Without any other modifications to the cycle, what inputs would be required to do this?

CO2, FADH2, NADH, and ATP

Which of the following is/are rubisco substrates?

CO2, O2, and RuBP

Which of the following is/are rubisco substrates? Please choose the correct answer from the following choices, and then select the submit answer button. CO2 O2 CO2, O2, and RuBP RuBP CO2 and RuBP

CO2, O2, and RuBP

Which of the following is/are rubisco substrates?O2 CO2 and RuBP CO2 CO2, O2, and RuBP RuBP

CO2, O2, and RuBP

Autotrophs typically obtain their carbon from:

CO2.

During photosynthesis, _____ is reduced to _____.

CO2; sugar

Imagine that one of your friends has just learned about the multiregional hypothesis, and she is astonished that humans evolved independently on different continents. What evidence would you provide your friend that contradicts the multiregional hypothesis?

Cann's research using mitochondrial DNA demonstrated that humans originated in Africa and subsequently migrated to other continents.

Energy

Capacity for a organism to do work

During exercise, as muscles go into anaerobiosis, the body will increase its consumption of ______

Carbohydrates

The most stable and least reactive form of carbon is:

Carbon dioxide

According to the figure, what is a key difference between cell signaling by a cell-surface receptor and cell signaling by an intracellular receptor?

Cell-surface receptors bind polar signaling molecules; intracellular receptors bind nonpolar signaling molecules.

Which of these statements is true regarding chimpanzees?

Chimpanzees do not have a universal grammar. Chimpanzees could be said to have their own distinct culture. All of these choices are correct. Chimpanzees are capable of teaching and learning. Chimpanzees in different populations have different methods of performing the same task, such as catching ants.

recombinant chromosomes

Chromosomes that carry genes from each parent.

homologous chromosomes

Chromosomes that have the same sequence of genes and similar size and shape; carry the same TYPE of information but not the exact same information

Which regulatory mechanism is important in keeping glycolysis and the citric acid cycle in relative balance to each other?

Citrate inhibits phosphofructokinase 1.

CO2 is produced during _____

Citric Acid Cycle and Acetyl CoA production

What metabolic process would you conclude could be taking place in this organelle? Glucose- no change CO2- Increase O2- No change ATP- Increase NADH- Increase

Citric acid cycle

Which of the following is an example of anabolism?

Combining glucose molecules to make glycogen

Which one of the following complexes does not actively move protons from the mitochondrial matrix to the intermembrane space?

Complex II

Which statement about diversity in eye development is correct?

Compound eyes consist of one lens covering many individual facets on a convex surface that produces a single image. Both squids and vertebrates have single-lens eyes, and are very similar in their development, anatomy, and physiology. Evolution of compound eyes improved images as animals evolved. The percentage of living animals possessing true eyes that can produce an image is high.

The Baltimore System of Viral Classification states that there are ____ different types of viruses based on their genomic material. A. 2 B. 3 C. 5 D. 7 E. more than 10

D. 7

Examine the DNA molecule shown below. If the bottom strand is transcribed into mRNA (sequence in red box only), which of the following is the correct mRNA sequence (5' to 3') from that transcription? (TTAGGCAG) A. AATCCGTC B. UUTCCGTC C. CTGCCTAA D. CUGCCUAA E. None of these answer choices are correct

D. CUGCCUAA

Which of the following is a catabolic reaction? A. Releasing amino acids from a protein B. Conversion of NADH to NAD+ C. Conversion of ATP to ADP D. Converting Glucose to Glucose 6-phosphate E. None of the answer choices are catabolic processes

D. Converting Glucose to Glucose 6-phosphate

Which of the following statements about cyclins is FALSE? A. Cyclins bind with enzymes that phosphorylate other substrates B. There are several different cyclins produced by the cell C. Cyclin production fluctuates throughout the cell cycle D. Cyclins are lipids E. The term cyclin was coined by English biochemist Thomas Hunt

D. Cyclins are lipids

Concerning enzymes, which of the following statements is FALSE? A. Enzymes are substrate-specific B. Enzymes catalyze reactions by lowering the EA C. Enzymes contain peptide bonds D. Enzymes are competitively inhibited via the allosteric site E. Substrates bind to enzyme's active site

D. Enzymes are competitively inhibited via the allosteric site

Which of the following is not part of transcriptional regulation on the Lac Operon in E. coli? A. RNA polymerase binds to a promoter (lacP) B. A repressor protein binds to an operator (lacO). C. Lactose inhibits the repression of transcription. D. Glucose bind to an activator which promotes transcription.

D. Glucose bind to an activator which promotes transcription.

Which of the following statements about mutations is false? A. Mutations are the fundamental source of genetic variation B. Somatic mutations are heritable only within a cell lineage C. Germ cell mutations are heritable across generations D. Humans average 300 genome mutations per generation E. Mutations and their impact on organisms is random

D. Humans average 300 genome mutations per generation

Which of the following is not part of the eukaryotic somatic cell cycle? A. Mitosis B. Interphase C. Cytokinesis D. Meiosis E. All of these answer choices are part of the eukaryotic somatic cell cycle

D. Meiosis

How is Meiosis II similar to Mitosis? A. Both involve the splitting of sister chromatids B. Both involve the preservation of chromosome number (ploidy) C. Both involve the alignment of homologous pairs during metaphase D. Multiple answer choices are correct E. All answer choices are correct

D. Multiple answer choices are correct

Which of the following contribute to the atomic weight of atoms as seen on the periodic table? A. Electron B. Proton C. Neutron D. Protons and Neutrons E. All of these contribute to atomic weight

D. Protons and Neutrons

Which of the following statements about the Pax6 gene is FALSE? A. The Pax6 gene in mice and fruit flies is very similar B. A mouse Pax6 gene can promote fruit fly eye development C. Genes downstream of Pax6 can vary greatly among organismal groups D. The Pax6 gene is only present in organisms with more complex eyes E. The Pax6 gene codes for a transcription factor.

D. The Pax6 gene is only present in organisms with more complex eyes

Which of the following is NOT a method for lateral gene transfer between bacterial cells? A. Transformation B. Transduction C. Conjugation D. Translation

D. Translation

Which of the following represents a post-zygotic mechanism that causes reproductive isolation? A. None of these answer choices are correct B. Two groups of beetles are reproductively isolated because they have different foraging behaviors C. Two groups of birds are reproductively isolated because they produce sterile/infertile offspring D. Two groups of snakes are reproductively isolated because their gametes are incompatible

D. Two groups of snakes are reproductively isolated because their gametes are incompatible

Which of the following types of chemical bonds rely on the electrostatic attraction between positive and negative charges? A. ionic bond B. hydrogen bonds C. covalent bonds D. ionic and hydrogen bonds E. all of the above

D. ionic and hydrogen bonds

During the citric acid (Krebs) cycle, the release of CO2 is the result of __________ reactions that are coupled to the _______ of _______. A. reduction; reduction; NADH B. oxidation; reduction; ATP C. reduction; oxidation; FAD D. oxidation; reduction; NAD+

D. oxidation; reduction; NAD+

When you exhale, there is more CO2 than was present in the air that you inhaled. This CO2 comes from reactions in: A. glycolysis and the citric acid (Krebs) cycle. B. glycolysis and pyruvate oxidation. C. glycolysis, pyruvate oxidation, and the citric acid (Krebs) cycle. D. pyruvate oxidation and the citric acid (Krebs) cycle. E. the citric acid (Krebs) cycle and oxidative phosphorylation

D. pyruvate oxidation and the citric acid (Krebs) cycle.

What is the primary function of Meiosis? A. to produce new somatic cells B. to regulate gene expression C. to produce new proteins D. to produce haploid gametes

D. to produce haploid gametes

nucleosome

DNA coiled around a histone; can pack tightly but separate to allow for the reading of DNA

Put the following enzymes of DNA Replication in the order in which they are active: DNA polymerase III DNA helicase RNA primase DNA ligase DNA polymerase I

DNA helicase DNA polymerase III RNA primase DNA polymerase I DNA ligase

Allele frequency can be measured using what technique?

DNA sequencing

bacterial transduction

DNA transferred from one bacterium to other via virus

blending inheritance

Darwin's theory; black rabbit crossed with white rabbit will be grey

What is the fundamental concept that causes gel electrophoresis of proteins to work?

Different proteins have different charges and sizes

A zookeeper is very upset because one of the lions jumped the fence of his enclosure and mated with a neighboring tigress. This mating produced a "liger." Which of the statements is likely true of this liger cub?

Due to genetic incompatibility between the lion and tiger, the liger cub will likely be sterile.

less energetic than the acetyl group

During pyruvate oxidation, pyruvate is broken down into CO2 and an acetyl group. The CO2 is: 1. less oxidized than the acetyl group. 2. more reduced than the acetyl group. 3. more energetic than the acetyl group. 4. less energetic than the acetyl group. 5. None of the other answer options is correct.

If the cell shown on the right divides by Mitosis, what is the total number of chromatids in each of the two new cells? A. 2 B. 4 C. 8 D. 16 E. 0

E. 0

Which of the following are associated with chromatin remodeling? A. Heterochromatin is converted to euchromatin B. An inaccessible/inactive genes becomes accessible/active. C. Acetyl groups are added to histone tails D. Multiple answer choices are correct. E. All of these answer choices are correct.

E. All of these answer choices are correct.

What method is specifically used to separate macromolecules (e.g., nucleic acids) based on their size and charge? A. Polymerase Chain Reaction B. Sanger C. Shotgun Sequencing D. Lederberg Conjugation E. Gel Electrophoresis

E. Gel Electrophoresis

Which of the following has the lowest membrane permeability? A. Water B. Steroids C. Carbon dioxide D. Sodium ion E. Glucose

E. Glucose

Which of the following statements about diffusion is FALSE? A. Molecules always diffuse down a concentration gradient B. Carrier proteins are involved in facilitated diffusion C. Of the same substance, more concentrated samples will diffuse faster than less concentrated samples D. Heavier substances will diffuse slower than lighter substances E. The sodium-potassium pump is involved in facilitated diffusion

E. The sodium-potassium pump is involved in facilitated diffusion

Compared with more distantly related taxa, the DNA sequences in the genomes of two closely related taxa are expected to show: E. fewer differences because mutation rates are usually relatively constant and recently diverging species have had less time to accumulate differences F. fewer differences because mutation rates slow down after speciation events so that recently diverging species have fewer mutations G. fewer differences because mutation rates are highly variable and it is just by chance that recently diverging species accumulate fewer differences in DNA sequences. H. more differences because mutation rates are relatively constant and recently diverging species have had more time to accumulate differences I. more differences because mutation rates accelerate during speciation events, leading to more changes in DNA sequences.

E. fewer differences because mutation rates are usually relatively constant and recently diverging species have had less time to accumulate differences

Where is water produced?

ETC in the inner membrane

Why does the CAC shut down without oxygen?

ETC stops so the e- produced by the CAC have nowhere to go and the cycle stops

Many early biologists would use the outward appearance of organisms to classify species. There were some species of fish that, for many years, were considered a single species. After further examination it was discovered the "one" species was actually three species. What types of data could explain the designation of three species instead of one?

Each species is descended from a different common ancestor.

Which of the scenarios would force us to reevaluate the findings that Cann discovered with regard to the human family tree?

Early human material is discovered in Asia that has mtDNA completely different from the mtDNA found in early Homo sapiens in Africa.

During glycolysis, pyruvate oxidation, and the citric acid cycle, the chemical energy in glucose is transferred to:

Electron carriers and ATP

Without O2, what do you predict will happen to the electron transport chain?

Electron transfer will

O2 is used during ____

Electron transport

Where is O2 used?

Electron transport chain in the inner membrane of mitochondrion

Even though evolution may decrease the entropy of living organisms, it increases the entropy of the Earth (or the universe) as organisms release heat.

Imagine that you are talking with one of your friends. He states that evolution has actually violated the second law of thermodynamics because complex living organisms are more ordered than the nucleic acids, amino acids, and other molecules that compose them. Why doesn't evolution contradict the second law of thermodynamics? Because evolution takes place over millions of years, the loss of entropy is negligible and thus the laws of thermodynamics are not violated. Evolution actually does violate the second law of thermodynamics, and this fact is problematic for scientists. Evolution is a biological process, and biological processes do not have to conform to the laws of physics. Evolution doesn't affect entropy, as living organisms eventually die and become "disordered." Even though evolution may decrease the entropy of living organisms, it increases the entropy of the Earth (or the universe) as organisms release heat.

Even though evolution may decrease the entropy of living organisms, it increases the entropy of the Earth (or the universe) as organisms release heat.

The fossil record is often used to infer phylogenetic history. Which of the statements accurately supports this assumption?

Events that occur early in the fossil record are represented by branching events nearer to the root of a phylogenetic tree.

Which of the following is true about exergonic reactions? Exergonic reactions are found only in biological systems. Exergonic reactions consume energy. Exergonic reactions measure the strength of an ionic bond. Exergonic reactions have a positive ΔG. Exergonic reactions are catabolic.

Exergonic reactions are catabolic.

Which of the following is true about exergonic reactions? Exergonic reactions have a positive ΔG. Exergonic reactions consume energy. Exergonic reactions are found only in biological systems. Exergonic reactions are catabolic. Exergonic reactions measure the strength of an ionic bond.

Exergonic reactions are catabolitic

In animal cells, most ATP synthesis takes place in mitochondria, but in plant cells, most of the ATP used by plant cells is made in the chloroplasts. Please choose the correct answer from the following choices, and then select the submit answer button. False True

False

Prokaryotes account for roughly half of terrestrial photosynthesis.

False

Pyruvate oxidation produces a large amount of ATP through substrate-level phosphorylation.

False

T/F Eukaryotes conduct all of the photosynthesis that occurs in the ocean.

False

The Calvin cycle is a relatively constant process, the rate of which is independent of factors such as temperature and nitrogen concentration.

False

The energy from the movement of electrons through the electron transport chain is directly used to synthesize ATP

False

The glycolysis stage is responsible for producing most of the ATP during cellular respiration.

False

True or False: In animal cells, most ATP synthesis takes place in the mitochondria, but in plant cells, most of the ATP used by plant cells is made in the chloroplasts.

False

True or false: The Calvin cycle is a relatively constant process, the rate of which is independent of factors such as temperature and nitrogen concentration.

False

(T/F) The energy from the movement of electrons through the electron transport chain is directly used to synthesize ATP.

False- proton gradient used to make ATP

True or False: The first photosynthetic organisms probably used chlorophyll as the primary light-absorbing pigment.

False. On page 170 of your book, it says, "Similarly, it is unlikely that these first photosynthetic organisms employed chlorophyll as a means of absorbing sunlight for the simple reason that the biosynthetic pathway for chlorophyll is complex, consisting of at least 17 enzymatic steps".

True or False: Not all photosynthetic organisms are plants, but one thing they all have in common is that they can only be found within a narrow temperature and moisture range.

False. Photosynthetic organisms can be in the photic zone which is from the surface of the ocean to about 100 meters deep because enough sunlight penetrates to enable photosynthesis. Photosynthesis can also occur in places that are moist and warm like grasslands and tropical rainforests. Photosynthesis can occur in dry regions as well with a combination of photosynthetic bacteria and unicellular algae that form an easily disturbed layer on the surface of the soil known as desert crust.

If the position of birds and turtles are switched, the tree will still reflect the accurate evolutionary relationships between these three taxa.

False. Turtles are now a sister group to crocodiles and alligators.

Recall that fatty acids (such as palmitic acid) can yield substantially more ATP when compared with a similar weight of glucose. Why doesn't aerobic respiration rely solely on fatty acids as energy sources, rather than glucose?

Fatty acids cannot be used by some vital tissues in the human body, such as the brain.

Which one of the following is believed to have served as the first electron donor?

Fe2+

The reaction of iron with oxygen to form iron oxide is an example of an oxidation-reduction reaction: 4Fe + 3O2 → 2Fe2O3. In this reaction ______ loses electrons and is _________.

Fe; oxidized

After glycolysis, there are two alternative pathways for producing energy. What are the names of the two pathways and what conditions determine which pathway will be used?

Fermentation - No oxygen Cellular respiration - oxygen

The energy required to drive the synthesis of the majority of the ATP generated during aerobic respiration comes most directly from:

Flow of protons through an ATP synthase complex. - The flow of electrons and stepwise lowering of the energy level of those electrons by the electron transport chain drives formation of a proton gradient between the matrix and the intermembrane space. The potential energy of this gradient drives ATP formation as the protons flow back to the matrix through ATP synthase.

Fossil data can be used to generate phylogenies that include extinct taxa. Which of the statements indicates how fossil data can be used to refine phylogenies constructed with molecular data?

Fossil data can be used to confirm the time since divergence between extant taxa estimated from sequence data.

Constructing a phylogeny that shows an equivalent branching pattern using either morphologic or molecular data sets strongly suggests that the phylogeny is an accurate representation of the evolutionary history of the group being studied. Why does additional data from fossils give increased support to our understanding of the evolutionary history for certain groups?

Fossils are one way to calibrate the timing of events on a phylogeny.

How do fossils provide evidence of evolutionary history?

Fossils provide a record of extinct species.

Which molecule has the greatest chemical potential energy?

Fructose 1,6 bisphosphate

Which type of selection increases overall genetic variation in a population? E. directional selection F. stabilizing selection G. disruptive selection H. All of the above are equal in this regard

G. disruptive selection

A hypothetical endangered species of wildflower has been reduced to a single small population in a mountain meadow. A rare early spring blizzard kills all but three of the remaining plants, one of which has a rare mutation. This is an example of: E. artificial selection. F. sexual selection. G. genetic drift/bottleneck. H. genetic drift/founder event. I. None of the answer options is correct.

G. genetic drift/bottleneck.

Which of the statements is true regarding the biological species concept?

Given the generation time of certain organisms, the biological species concept can be difficult to test.

You are trying to find the maximum source of energy for an organism, and you are limited to 0.1 moles of a molecule for a compound. Which compound would you choose to provide 0.1 moles for maximum energy?

Glucose

which of the following is not part of transcriptional regulation on the Lac Operon in E. coli?

Glucose binds to an activator which promotes transcription.

What happens when glucose is phosphorylated during phase 1 of glycolysis?

Glucose is destabilized so that it can be broken apart in phase 2.

During their experiments with chlorella, Calvin and Benson found no free glucose. Why do you think this is?

Glucose is stored as starch.

During their experiments with chlorella, Calvin and Benson found no free glucose. Why do you think this is? Glucose is an isomer of fructose. Glucose takes too long to synthesize. Glucose is stored as starch. Glucose would cause H2O to leave the Chlorella cells. Green algae do not respire when illuminated.

Glucose is stored as starch.

During their experiments with chlorella, Calvin and Benson found no free glucose. Why do you think this is? Please choose the correct answer from the following choices, and then select the submit answer button. Glucose is an isomer of fructose. Glucose would cause H2O to leave the Chlorella cells. Green algae do not respire when illuminated. Glucose is stored as starch. Glucose takes too long to synthesize.

Glucose is stored as starch.

The first stage in the production of ATP via the oxidation of glucose molecules is referred to as:

Glycolysis

Through beta-oxidation, fatty acids are converted to acetyl-CoA. Entering the pathway as acetyl-CoA bypasses which part of aerobic respiration?

Glycolysis

Where is glucose used?

Glycolysis in the cytosol

In which order does one molecule of glucose undergoing cellular respiration go through processes?

Glycolysis, pyruvate oxidation, citric acid cycle, oxidative phosphorylation

What stages of glucose metabolism convert NAD+ to NADH?

Glydolysis, conversion of pyruvate to acetyl CoA, citric acid cycle

Photosystem II and photosystem I differ in:

H+ production, and electron donors and acceptors.

Photosystem II and photosystem I differ in: H+ production and electron donors. H+ production. H+ production, and electron donors and acceptors. plants and algae. electron donors and acceptors.

H+ production, and electron donors and acceptors.

If photosynthesizing Chlorella (a unicellular green alga) cells are supplied with either water made with 18O (H218O) or with carbon dioxide made with 18O (C18O2), and the cells are allowed to photosynthesize for a short period of time, which would result in production of increased 18O2?

H2 18O

In plants, the initial electron donor in photosynthesis is:

H20

What is the flow of electrons during photosynthesis?

H20 -> Photosystem II -> ETC -> NADPH -> photosystem I -> NADPH -> calvin cycle

In plants and algae, ____ is the source of the electrons needed for photosynthesis.

H2O

In plants and algae, ____ is the source of the electrons needed for photosynthesis. Please choose the correct answer from the following choices, and then select the submit answer button. NADPH H+ CO2 O2 H2O

H2O

In plants and algae, _____ is the source of the electrons needed for photosynthesis. H+ NADPH H2O O2 CO2

H2O

What is the correct order of steps taken by electrons through the light dependent reactions of photosynthesis?

H2O → photosystem II → cytochrome b6f → photosystem I → NADPH

During photosynthesis in plants and algae, ____ is oxidized and ____ is reduced.

H2O; CO2

During photosynthesis in plants and algae, ____ is oxidized and ____ is reduced. Please choose the correct answer from the following choices, and then select the submit answer button. NADPH; ATP H2O; CO2 H2O; O2 O2; CO2 CO2; H2O

H2O; CO2

In the overall reactions of photosynthesis, the electrons from _____ are used to reduce _____.

H2O; CO2

In photosynthesis, light energy drives the transfer of electrons from _____ to _____.

H2O; sugar

What is an example of photoheterotrophs?

Heliobacteria and most green non-sulfur bacteria

_____ are organisms that derive carbon from organic compounds.

Heterotrophs

____________ are organisms that derive carbon from organic compounds.

Heterotrophs

Excessive reactive oxygen species (ROS) can cause damage to cells. What is a cause of ROS formation during photosynthesis?

High energy electrons are unable to be passed to NADP+.

Of the taxa listed, which of the nonmodern humans was the last to go extinct?

Homo floresiensis

anaphase I

Homologous chromosomes are pulled to opposite ends of the cell. Note that chromatids do not separate

by glycolysis

How did the earliest organisms on Earth most likely produce ATP? 1. by pyruvate oxidation 2. by glycolysis 3. by the citric acid cycle 4. by oxidative phosphorylation

DNA polymerase fixes damaged DNA sequences

How do organisms reduce the frequency of mutations during replication?

*both involve the splitting of sister chromatids *both involve the preservation of chromosome number (ploidy)

How is meiosis II similar to mitosis? *both involve the splitting of sister chromatids *both involve the preservation of chromosome number (ploidy) *both involve the alignment of homologous pairs during metaphase

30,000

How many base pairs does COVID have?

1 million

How many base pairs does a megabase (MB) have?

1,000

How many base pairs does a viroid have?

160,000

How many base pairs in chloroplasts?

16,500

How many base pairs in the mitochondria?

How many groups or viruses are in the Baltimore system of viral classification?

0.5-1.5MB

How many megabases does an obligate symbiont or pathogens have?

5-10MB

How many megabases does free living bacteria have?

2-5MB

How many megbases does a recent or facultative pathogen have?

What is the primary difference between natural selection and artificial selection?

Humans drive artificial selection.

The outer surface of the Fo subunit of ATP synthase must be _________ to be embedded in the membrane

Hydrophobic

sister chromatids

Identical copies of a chromosome; full sets of these are created during the S subphase of interphase.

he or she developed from a sperm and egg that carried different alleles

If an individual is heterozygous for a gene if: *his or her mother is heterozygous for the gene *his or her father is heterozygous for the gene *he or she developed from a sperm and egg that carried different alleles for that gene *he or she developed from a sperm and egg that carried the same allele for that gene *only one allele is present in the population

There is a phenomenon called paternal leakage in which a small amount of the mitochondrial DNA from the father is found in the offspring. If paternal leakage is assumed to occur in most matings, how would it change our interpretation of studies of mitochondrial DNA in human ancestors and in groups of different modern humans?

If it is truly a small amount, then those deviations should not influence the conclusions generated from the study.

There is a phenomenon called paternal leakage in which a small amount of the mitochondrial DNA (mtDNA) from the father is found in the offspring. If paternal leakage is assumed to have occurred throughout human history, how does it change our interpretation of Matthias Krings and Svante Pääbo's studies of mitochondrial DNA in specimens of Neanderthals and modern humans?

If paternal mtDNA with Neanderthal sequences was found in the offspring alongside maternal mtDNA, these would have immediately indicated that the two groups interbred.

John Gurdon performed nuclear transplant experiments in frogs to test two different hypotheses to explain why specialized cells become restricted in their fates during development. His results supported the hypothesis that differentiation involves genome regulation, where unneeded genes are progressively turned off, but are not lost from the genome of cells as they differentiate. However, Gurdon's results showed that only 10 out of 726 eggs that received transplanted nuclei from mature cells differentiated into tadpoles, whereas 716 did not. Why did Gurdon use these rare successful nuclear transplantations as evidence for the gene regulation hypothesis?

If the gene regulation hypothesis was wrong, and genes were lost from the genome during development, none of the eggs would have been able to differentiate into tadpoles.

50%

If you cross a heterozygous individual (Aa) with a homozygous recessive individual (aa), what is the probability that the offspring will be homozygous recessive?

genotypic ratio would be 1AA:1Aa

If you crossed a true breeding yellow seeded plant (AA) with a heterozygous yellow seeded plant (Aa), the offspring: *genotypic ration would be 3AA:1Aa genotypic ration would be 1Aa:1aa *genotypic ration would be 3AA:1Aa genotypic ration would be 1AA:1Aa *phenotypic ratio would be 1/2 yellow seeded and 1/2 green seeded

has two different alleles for seed color

In Mendel's peas, an individual that is heterozygous for seed color: *has only one allele for seed color *has two different alleles for seed color will express the recessive allele in the phenotype *will express both the dominant and recessive allele in the phenotype

oxidized; reduced

In cellular respiration, glucose is _____ to CO2 and oxygen is _____ to water. 1. reduced; oxidized 2. deoxygenated; phosphorylated 3. oxidized; reduced 4. oxidized; oxidized 5. phosphorylated; deoxygenated

gains electrons and is an oxidizing agent

In cellular respiration, oxygen: 1. gains electrons and is an oxidizing agent. 2. loses electrons and is a reducing agent. 3. gains electrons and is a reducing agent. 4. loses electrons and is an oxidizing agent. 5. None of the other answer options is correct.

Which statement is true regarding fossils?

In the plant fossil record, fossilized pollen can provide evidence of extinct plant groups.

phosphorylated sugar molecule is cleaved and the products rearranged

In the second phase of glycolysis: 1. phosphate groups are added to glucose. 2. phosphorylated sugar molecule is cleaved and the products rearranged. 3. ATP is generated by oxidative phosphorylation. 4. NAD+ is reduced to NADH. 5. ATP is generated by substrate-level phosphorylation.

sex-linked inheritance

Inheritance of a genetic trait located on the sex chromosomes

PFK-1 is _________ by ATP and _________ by ADP

Inhibited; activated

Protons in a mitochondrion flow through an ATP synthase from the:

Intermembrane space to the matrix. - The electron transport chain transforms the energy from the high energy electrons of FADH2 and NADH into an electrochemical gradient by pumping protons from the mitochondrial matrix into the intermembrane space. Those protons flow back into the matrix by passing through a special enzyme embedded in the membrane called ATP synthase.

Which of the following is one explanation for why glycolysis is believed to have arisen very early in the evolution of life?

It does not require oxygen.

Some present-day bacteria use a system of anaerobic respiration characterized by an electron transport chain analogous to that found in aerobic organisms. Which of the following correctly characterizes the anaerobic electron transport chain? -It establishes a proton gradient between the intermembrane space and the cytoplasm. -It uses oxygen as a final electron acceptor. -It is embedded in the outer mitochondrial membrane, rather than -the inner mitochondrial membrane. -It establishes a proton gradient between the cytoplasm and the extracellular fluid.

It establishes a proton gradient between the cytoplasm and the extracellular fluid

Which statement describes the proton gradient generated by the electron transport chain

It is an electrochemical gradient

During the citric acid cycle, which is shown, what happens to the coenzyme A that is part of acetyl-CoA?

It is recycled for use in other reactions

During the citric acid cycle, which is shown, what happens to the coenzyme A that is part of acetyl-CoA?

It is recycled for use in other reactions.

What happens to pyruvate during the process of fermentation?

It is reduced to ethanol.

Which of the statements about Archaeopteryx is false?

It is the direct ancestor of modern birds.

Why is genetic variation critical for evolution?

It is the source material for natural selection.

Why is agreement between the fossil record and phylogenies constructed from living organisms considered strong evidence of evolution?

It is unlikely that two independent methods of investigation would result in the same pattern by chance alone.

In human cells, such as those in muscle tissue, the product of fermentation is:

Lactic acid

What are the byproducts of the two fermentation pathways?

Lactic acid - fermentation Ethanol, CO2 - yeast

Red blood cells in the human bloodstream do not have mitochondria . What metabolic process would you predict these cells use to provide cellular energy/ATP?

Lactic acid fermentation

less

Larger genomes have ______ frequent mutation rates at sites within the genome

If the researchers added a transmembrane protein channel that allows protons to freely pass through it, what result would you predict?

Less ATP would be produced when the light is on because protons would bypass the ATP synthase. - In order for ATP to be generated, there must be a proton concentration and electrical gradient. If there was a new protein that freely allowed the protons to flow through the membrane, then eventually the protons would reach equilibrium and there would not be a gradient to drive the synthesis of ATP.

The reactions of photosynthesis are an important part of the energy conversion pathways in plants. Suppose you are conducting research on photosynthesis with the following conditions in the plants you are studying: - high concentrations of NADPH in the chloroplasts - low concentrations of ATP in the chloroplasts - low intracellular concentrations of glyceraldehyde-3-phosphate (G3P) - the plant is growing in full sunlight Which of the following statements are true? Please choose the correct answer from the following choices, and then select the submit answer button. Carbohydrate production is elevated. Levels of antioxidants in the cells are elevated. The rate of CO2 fixation by rubisco is elevated. Cellular metabolic processes slow due to decreased ATP levels in the chloroplasts.

Levels of antioxidants in the cells are elevated.

If modern humans came from Africa, what explains the loss of pigmentation seen in different races?

Lighter pigment allows for more efficient production of vitamin D, which is an advantage in areas with less sunlight.

Ligers (hybrid offspring from lions and tigers) and tigons (hybrid offspring from tigers and lions) do exist, and mating that produces the hybrid offspring has occurred at conservation sanctuaries where both species are kept in common areas. Yet, we consider tigers and lions to be separate species according to the biological species concept. Which of the statements reflects how the BSC can still be used to categorize these species? Please choose the correct answer from the following choices, and then select the submit answer button.

Lions and tigers can be considered separate species under the BSC because they are not typically in the same place, so breeding does not normally occur.

Acetate is the starting point for synthesis of a cell's:

Lipids

When a substance in a reaction is oxidized, it:

Loses electrons

What are chemoheterotrophs?

Make energy from chemical compounds and obtain carbon from organic compounds

What are chemoautotrophs?

Make energy from chemicals and obtain carbon from inorganic sources

What are photoheterotrophs?

Make energy from the sun and obtain carbon from organic compounds

Photoautotrophs can be defined as....

Making energy from the sunlight while gaining carbon from inorganic sources

In April of 1986, there was a nuclear reactor meltdown at the Chernobyl Nuclear Reactor site in Ukraine. Individuals that responded to the disaster were exposed to high levels of ionizing radiation and showed mutation rates up to 6 times higher than rates found in individuals not exposed to the radiation. When researchers sequenced the genomes of the offspring of these individuals, they found that many of the offspring had the same mutations, even though they had never been to the site of the nuclear accident. Which statement could explain these data?

Many of the mutations occurred in reproductive cells and were inherited by the offspring.

Each of the following is known to aid in the functioning of cellular enzymes except:

Mercury

Transcription is repressed when the cytosines within CpG islands in genes' promoters are methylated. Which answer option could account for this effect on gene expression?

Methylated cytosines bind to enzymes that cause the removal of acetyl groups from histones, causing chromatin to coil more tightly.

When Rebecca Cann decided to conduct research on the evolution of humans, she chose to study mitochondrial DNA. Which of the statements explains why she chose this type of DNA?

Mitochondrial DNA is more abundant and therefore easier to extract.

The oxidation of pyruvate occurs in the:

Mitochondrial matrix

What is an example of chemoheterotrophs?

Most bacteria and animals

Fermentation produces ______which allows glycolysis to continue for production of anaerobic ATP

NAD+

One of the enzymatic results of the pyruvate oxidation stage of cellular respiration is the reduction of _____ to _____.

NAD+; NADH

One of the enzymatic results of the pyruvate oxidation stage of cellular respiration is the reduction of _________ to ___________.

NAD+; NADH

What product of the pyruvate oxidation stage of cellular respiration will have the two electrons that are lost from pyruvate?

NADH

Which of the following is an electron carrier in its reduced form?

NADH

Which molecule(s) serve as electron donors for the mitochondrial electron transport chain?

NADH & FADH2

The immediate source of electrons for the electron transport chain is:

NADH and FADH2.

What glycolysis products are transported into the mitochondria? Select all that apply.

NADH and pyruvate

Which of the molecules are reduced during photosynthesis?

NADP+ and 3-phosphoglycerate

ATP, NADPH, and NADH contain stored energy used by plant cells. Which of these molecules provides the energy that is stored in carbohydrate during the Calvin cycle?

NADPH

ATP, NADPH, and NADH contain stored energy used by plant cells. Which of these molecules provides the energy that is stored in carbohydrate during the Calvin cycle? Please choose the correct answer from the following choices, and then select the submit answer button. NADH ATP NADPH

NADPH

The primary reducing agent in the Calvin cycle is:

NADPH

The reducing agent during the Calvin cycle is: ATP. NADH. NADPH. FADH2. oxygen.

NADPH

Which of these molecules contributes to the energy that is stored in carbohydrate during the Calvin cycle?

NADPH

what is the role of NADPH in the calvin cycle

NADPH provides the electrons needed for the reduction of CO2

In the light-dependent reactions of photosynthesis, light energy is captured and stored as potential energy. In which of the following is this energy stored in the light-dependent reactions? Please choose the correct answer from the following choices, and then select the submit answer button. carbohydrate molecules an electrochemical gradient NADPH, ATP, and an electrochemical gradient. NADPH, ATP, and carbohydrate molecules NADPH and ATP

NADPH, ATP, and an electrochemical gradient.

Imagine that alien scientists are carrying out an experiment on Earth. They effectively construct a "shield" surrounding the planet that limits the amount of sunlight/UV radiation that reaches Earth's surface. If the alien scientists return after 60,000 years, what may they discover?

Natural selection would likely have selected for humans with little skin pigmentation.

What is an exergonic reaction?

Negative reaction Releases energy

Which of these places was the last to be colonized by humans?

New Zealand

What would happen if complexes I-IV of the electron transport chain pumped protons in the opposite direction?

No ATP would be synthesized.

Is natural selection the same thing as evolution?

No, because forces other than natural selection can also cause evolution.

Very low concentrations of detergent make membranes leaky to small molecules and ions without damaging proteins. In isolated mitochondria exposed to detergent, the molecules of the electron transport chain and of ATP synthase remain intact. Do you except ATP synthesis to continue in the presence of low concentrations of detergent?

No, because with a leaky membrane, the proton gradient cannot be maintained

In the lab, you isolate a chlorella mutant that is unable to switch xanthophyll pigments into the inactive, non-heat-dissipating form. If you released that mutant into a small pond shaded by trees, would the mutation spread, and why?

No, because xanthophyll dissipates absorbed light as heat, and in low light environments, such dissipation would decrease photosynthesis and therefore growth.

How many molecules of NADPH are required for 12 molecules of RuBP to be carboxylated by rubisco?

None of the above

Which of the following statements is true regarding the Calvin cycle?

None of the answer choices.

How many molecules of NADPH are required for 12 molecules of RuBP to be carboxylated by rubisco? 36 24 None of the other answer options is correct 10 12

None of the other answer options are correct

How many molecules of NADPH are required for 12 molecules of RuBP to be carboxylated by rubisco? 10 24 36 12 None of the other answer options is correct.

None of the other answer options is correct.

How many molecules of NADPH are required for 12 molecules of RuBP to be carboxylated by rubisco? 10 36 24 12 None of the other answer options is correct.

None of the other answer options is correct.

Which of the statements is true regarding speciation?

None of the other answer options is correct.

None of the unfertilized eggs receiving nuclei from mature cells would be able to differentiate into tadpoles.

In plants and algae, what is a by-product of photosynthesis?

In plants and algae, which is a by-product of photosynthesis?

In plants and algae, which of the following is a by-product of photosynthesis?

In plants and algae, which of the following is a by-product of photosynthesis? Please choose the correct answer from the following choices, and then select the submit answer button. H+ C6H12O6 O2 carbohydrates CO2

In plants and algae, which of the following is a by-product of photosynthesis? CO2 C6H12O6 H+ O2 carbohydrates

Photorespiration occurs when rubisco reacts RuBP with

in respiration, which molecule is the electron acceptor

How is the rate of O2 disappearance a measure of electron transport?

O2 is used to become water in ETC so less oxygen indicates this is occurring

what is produced by non-cyclic electron flow in the light reactions?

O2, ATP, NADPH

products when photosystem II oxidizes a molecule of H2O?

O2, protons, electrons

The reaction of iron with oxygen to form iron oxide is an example of an oxidation-reduction reaction: 4Fe + 3O2 → 2Fe2O3. In this reaction ______ gains electrons and is _________.

O2; reduced

According to the figure shown, which of the answer choices is responsible for amplifying the signal in a cell responding to adrenaline? Select all that apply.

One molecule of adenylyl cyclase can activate many molecules of protein kinase A (PKA). (One adrenaline molecule binds to change the conformation of the receptor protein.) Not correct One activated receptor can activate many G proteins. One molecule of protein kinase A (PKA) can phosphorylate and activate many target proteins.

A molecule that is ________ loses electrons, and a molecule that is ___________ gains electrons

Oxidized Reduced

Some drugs allow protons to diffuse across the mitochondrial inner membrane. When such a drug is added, what will happen to O2 consumption?

Oxygen consumption will not change because it creates the gradient and is not powered by the gradient like ATP synthase is

The terminal electron acceptor of a mitochondrial electron transport chain is:

Oxygen. - Once the available energy of the electrons passing along the electron transport chain has been extracted and used to pump protons into the intermembrane space, they are passed to O2 as the final step

metaphase I

Pairs of homologous chromosomes move to the equator of the cell.

How do mitogen-activated protein (MAP) kinases get deactivated?

Phosphatases remove phosphate groups.

Phosphofructokinase is an allosteric enzyme in the pathway that breaks down glucose to produce ATP. Regulation of glycolysis is directly related to the level of ATP and citrate. If ATP or citrate levels are high, phosphofructokinase is inhibited. What will happen to this enzyme when ATP levels drop? Phosphofructokinase is inhibited. Phosphofructokinase is activated. Metabolism of citrate is inhibited. Metabolism of phospholipids is activated. Metabolism of phospholipids is inhibited.

Phosphofructokinase is activated.

The coronary arteries supply oxygenated blood to heart muscle. Following a heart attack, which of the events would occur in heart tissue due to a block in the coronary arteries? Select all that apply.

Phosphofructokinase, an intermediary enzyme of glycolysis, would be activated. The production of ATP would decrease. Lactic acid would accumulate in the tissue due to glycolysis and fermentation.

Biological example of a kinetic → potential energy conversion

Photon drives ATP and NADPH production

What is the relationship between photosynthesis and cellular respiration?

Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water.

Which one of the following statements BEST represents the relationship between cellular respiration and photosynthesis? Photosynthesis occurs only during the day and respiration occurs only at night. Photosynthesis stores energy in organic molecules, while respiration releases it. Photosynthesis reverses the biochemical pathways of respiration. Respiration stores energy in organic molecules, while photosynthesis releases it. Respiration occurs only in animals and photosynthesis occurs only in plants.

Photosynthesis stores energy in organic molecules, while respiration releases it.

Which one of the following would least likely be found in the outer regions of the granal stacks?

Photosystem II

_____ are organisms that derive energy from sunlight.

Phototrophs

____________ are organisms that derive energy from sunlight.

Phototrophs

Which of the statements is true regarding a phylogenetic tree?

Phylogenetic trees could be considered physical representations of hypotheses that seek to establish the evolutionary relationships between different organisms.

You are an experienced naturalist and biologist and you observe two birds mating that you do not believe are members of the same species. The eggs from this breeding do not hatch, and when you obtain one of the eggs, you find embryonic development stopped not long after fertilization. Which of the following conclusions is supported by these observations?

Post-zygotic factors prevented successful production of offspring.

Reproductive isolating mechanisms are divided into categories based on when they act. _____ isolating factors prevent fertilization from taking place; _____ isolating factors result in failure of the fertilized egg to develop into a fertile individual.

Pre-zygotic; post-zygotic

Which of the characteristics separates primates from other mammals?

Primates have nails instead of claws.

crossing over

Process in which homologous chromosomes exchange portions of their chromatids during meiosis.; increases genetic diversity

spindle fibers

Protein structures which move the chromosomes during cell division; microtubules

false

Pyruvate oxidation is remarkably similar to glycolysis in that when one molecule of pyruvate enters into a mitochondrion, two molecules of acetyl-CoA are formed. true false

Which stages of cellular respiration produce CO2 as a waste product?

Pyruvate oxidation, and the citric acid cycle

____ is the end product of glycolysis. It is oxidized into ____, which enters the citric acid cycle.

Pyruvate; acetyl CoA

A particular human gene is expressed in both the heart and the lung. However, analysis of the products of this gene show that the protein encoded by this gene is larger in lung tissue than in heart tissue, even though the mRNAs in both of those tissues are the same size. Which answer option could have caused the size difference in the proteins, but not the mRNAs, between the heart and lung?

RNA editing that occurs in the heart but not the lung

Which statement is true regarding reactive oxygen species?

Reactive oxygen species are likely to form if NADP+ is in low supply. Reactive oxygen species can be "neutralized" by antioxidants. Reactive oxygen species are formed when excess electrons are added to O2. Reactive oxygen species can form when O2 is exposed to excess light energy.

A researcher is evaluating the role of a growth factor during embryonic development. She notices that this factor functions in both neural development and limb development. How is that possible?

Receptors for the growth factor must be present in both neurons and cells in the developing limb.

When electrons move closer to oxygen during cellular respiration energy is _____.

Released

Which compound is required for the carboxylation step of the Calvin cycle?

RuBP

Which of the following compounds is required for the carboxylation step of the Calvin cycle?

RuBP

Which of the following compounds is required for the carboxylation step of the Calvin cycle? Please choose the correct answer from the following choices, and then select the submit answer button. ATP and NADPH NADPH RuBP 3-PGA ATP

RuBP

The Calvin cycle includes 15 enzymes, most of which are involved in:

RuBP regeneration

The regeneration of RuBP typically limits the rate of photosynthesis under low light intensities. This is because:

RuBP regeneration requires ATP.

The regeneration of RuBP typically limits the rate of photosynthesis under low light intensities. This is because: RuBP regeneration requires ADP. RuBP regeneration requires ATP. RuBP regeneration is part of the "dark reactions." photosynthesis occurs only in high light. None of the answer options is correct.

RuBP regeneration requires ATP.

The regeneration of RuBP typically limits the rate of photosynthesis under low light intensities. This is because: RuBP regeneration requires ADP. RuBP regeneration is part of the "dark reactions." photosynthesis occurs only in high light. None of these answer choices is correct. RuBP regeneration requires ATP.

RuBP regeneration requires ATP.

The Calvin cycle includes 15 enzymes, most of which are involved in:

RuBP regeneration.

The Calvin cycle includes 15 enzymes, most of which are involved in: Please choose the correct answer from the following choices, and then select the submit answer button. RuBP regeneration. ATP synthesis. starch synthesis. reduction. RuBP carboxylation.

RuBP regeneration.

Which of the answer choices correctly describes the role of rubisco in the Calvin cycle?

Rubisco incorporates CO2 from the atmosphere into an organic molecule.

Which of the following correctly describes the role of rubisco in the Calvin cycle?

Rubisco incorporates CO2 from the atmosphere into an organic molecule.

Which of the following correctly describes the role of rubisco in the Calvin cycle? Please choose the correct answer from the following choices, and then select the submit answer button. Rubisco incorporates CO2 from the atmosphere into an organic molecule. Rubisco uses NADPH to reduce 3-phosphoglycerate to a three carbon sugar. None of the other answer options is correct. Rubisco uses ATP to regenerate RUBP.

Rubisco incorporates CO2 from the atmosphere into an organic molecule.

Which of the following correctly describes the role of rubisco in the Calvin cycle? Rubisco incorporates CO2 from the atmosphere into an organic molecule. Rubisco uses NADPH to reduce 3-phosphoglycerate to a three carbon sugar. None of the other answer options is correct. Rubisco uses ATP to regenerate RUBP.

Rubisco incorporates CO2 from the atmosphere into an organic molecule.

the genome size of which of the following is approximately 30.000 base pairs?

SARS CoV-2

What are autotrophs?

Self feeders Make their own organic carbon using inorganic carbon as the starting material

A research team is carrying out an experiment where they label a protein with a fluorescent tag (so they can visualize its location in a cell) and introduce this tagged protein into the lumen of a single thylakoid. They observe the treated cells periodically and note that the labeled protein can move between grana, but is always observed in the lumen, never in the stroma. What can they deduce?

Since the labeled protein molecule can migrate between grana (thylakoid sacs) without exiting across the membrane into the stroma, all of the lumen spaces must be connected.

Which of the answer choices is an example of how natural selection is responsible for the variation seen in the human population? Please choose the correct answer from the following choices, and then select the submit answer button.

Some individuals in warm tropical areas have a tall and skinny body that more readily dissipates heat than other body types. Some individuals in Northern cooler latitudes have a stocky body shape that is adapted to retain heat. Africans carry the sickle trait in areas where malaria is prevalent. People in the Northern regions have less pigmentation, which allows more UV light to penetrate the skin to produce vitamin D.

Why don't steroid hormones bind to transmembrane cell-surface receptors?

Steroid hormones are nonpolar and therefore are able to cross the cell's plasma membrane, binding to receptors inside the cell.

Potential Energy

Stored Energy

In which lettered location in the figure would you find carbohydrate synthesis taking place?

Stroma

The fluid-filled interior compartment of the thylakoid network is referred to as the _____ in specialized membranes.

Stroma

____________ bind to the active site of an enzyme.

Substrates and competitive inhibitors

In 1937, two German biochemists published a paper proposing the following reactions as part of the glucose oxidation: citrate → isocitrate → α-ketoglutarate → succinate → fumarate → malate → oxaloacetate Adding succinate, fumarate, or malate to thin slices of tissue increased oxygen consumption, supporting the hypothesis that these molecules are intermediates in the process. However, a puzzling observation was that intermediates were still present in the reaction mixture at the end of the experiment. If they are intermediates, then they should be consumed as the next product in the pathway is formed. What explains this observation?

Succinate, fumarate, and malate are constantly regenerated in the citric acid pathway.

What is an example of chemoautotrophs?

Sulfur-oxidizing bacteria and hydrogen bacteria

Which of the statements is true regarding sympatric speciation?

Sympatric speciation requires a selective disadvantage of hybrids (e.g., medium-billed birds) of two diverging populations.

Active β-galactosidase enzyme is observed only in E. coli growing in the presence of lactose. One hypothesis is that the enzyme is always being produced but is produced in an unstable form that breaks down rapidly in the absence of lactose (hypothesis 1). A second hypothesis is that the enzyme is stable but is produced only in the presence of lactose (hypothesis 2). An experiment was performed to test these hypotheses. A culture of growing cells was exposed to lactose, which was later removed. The amount of β-galactosidase present in the culture during the course of the experiment was measured. The data are shown in the following graph. Which statement is a conclusion that can be obtained from these experimental data?

Synthesis of β-galactosidase is turned on when lactose is added and turned off when lactose is removed, in support of hypothesis 2.

Collectively, most photosynthesis carried out in the ocean is performed by single-celled organisms as opposed to large, multicellular marine plants. T F

false

T/F: Homologous chromosomes carry the same alleles

You are translating an mRNA in the lab and notice that the protein produced is only two amino acids long when you were expecting a length of forty amino acids. You have checked the sequence of the mRNA and everything appears to be correct. What could be happening in your reaction?

The E (exit) site of the ribosome is not functioning.

Which of the statements is the most likely explanation for why the human brain is capable of so much more than what is required for evolutionary fitness?

The additional capabilities are byproducts of what was necessary for evolutionary fitness.

Gibbs free energy is defined as: the amount of energy lost as heat. the amount of entropy. spontaneous energy. the amount of energy available to do work. the amount of potential energy in a system.

The amount of energy available to do work

A researcher is comparing the amount of protein contained in inner and outer mitochondrial membranes. What do you predict they will find?

The amount of proteins will be greater in the inner membrane

Which of the statements is true regarding the ancestors of early humans and chimpanzees (those present 6 million years ago)?

The ancestors of humans and chimpanzees likely resembled one another, but would not appear identical to either present-day chimpanzees or humans.

beta-oxidation

The breakdown of fatty acids takes place

Imagine that you are examining a mouse that does not produce basal lamina in the skin. How will this mouse be different from a normal, wild-type mouse?

The cells of the epidermis would not be properly connected to form a water-resistant barrier.

many of these bonds are C-C and C-H bonds

The chemical bonds of carbohydrates and lipids have high potential energy because: 1. they are strong oxidizing agents. 2. many of these bonds are C—C and C—H bonds. 3. they are easy to hydrolyze. 4. they are strong reducing agents. 5. they are easy to phosphorylate.

The citric acid cycle produces _____ and _____ which serve as ________ source for the ________

The citric acid cycle produces [electron donors NADH and FADH2] which serve as an [electron] source for the [electron transport chain]

You sequence the DNA of chromosome 12 from reproductive cells of 40 individuals in a population. You find that 10 individuals each have the same neutral, reproductive cell mutation. The following year, you sequence the same chromosome in all the offspring from those 12 individuals, but find that none of the offspring has the mutation. Which statement reflects how this could occur?

The copy of chromosome 12 with the mutation was not in the gametes involved in fertilization producing the offspring.

In eukaryotic cells, glycolysis occurs in

The cytoplasm

Which statement about Pax6 and eye development is correct?

The downstream target genes for Pax6 protein are different in different organisms.

A biologist working in a lab adds a compound to a solution that contains an enzyme and substrate. This particular compound binds reversibly to the enzyme at the active site. Once the compound is bound to the enzyme, the catalysis of substrate to product stops. Which of the statements is true of the compound?

The effect of the compound can be overcome by adding more substrate.

Which of the answer choices is an advantage of having two slightly different photosystems in the chloroplasts?

The electrons can be elevated to a higher energy level than is possible with a single photosystem.

As electrons flow from one photosystem to another, the amount of energy present in the electrons decreases. How does the plant cell use the energy lost by the electrons?

The energy is used to create and maintain a proton gradient.

As electrons flow from one photosystem to another, the amount of energy present in the electrons decreases. How does the plant cell use the energy lost by the electrons? The energy is used to create and maintain a proton gradient. The energy is used to reduce NADP+ to NADPH. The energy is used to increase the pH of the thylakoid lumen. The energy is used directly by ATP synthase to make ATP.

The energy is used to create and maintain a proton gradient.

Imagine that several atoms bond to form a carbohydrate, creating a more orderly system. Which of the following statements is true regarding the universe after this carbohydrate forms?

The entropy of the universe increases.

Imagine that several atoms bond to form a carbohydrate, creating a more orderly system. Which of the following statements is true regarding the universe after this carbohydrate forms? The energy of the universe increases. The energy of the universe decreases. The entropy of the universe increases. The entropy of the universe decreases. Both the energy and entropy of the universe increases

The entropy of the universe increases.

Cytochrome c

The enzyme to which electrons are transferred in complex III of the electron transport chain.

substrate-level phosphorylation: definition

The enzyme-catalyzed formation of ATP by direct transfer of a phosphate group to ADP from an intermediate substrate in catabolism.

G1 phase

The first gap, or growth phase, of the cell cycle, consisting of the portion of interphase before DNA synthesis begins; basic cell growth

The following are two genotypes of the lactose operon in E. coli:I. I+ P- Oc Z+ Y+II. I- P+ O+ Z+ Y+ Do either of these genotypes produce β-galactosidase and permease in the presence of lactose? Please choose the correct answer from the following choices, and then select the submit answer button.

The first one does not produce β-galactosidase and permease, the second one does.

Anhidrosis Ectodermal Dysplasia is caused by a single gene mutation that affects the ability of sweat glands to function properly. Human males affected by this mutation cannot produce sweat properly anywhere on their body, whereas females with this condition are affected in a mosaic pattern in which some patches of skin cannot produce sweat while other areas can. Which answer option could account for this mosaicism in females but not males?

The gene causing this disorder is located on the X chromosome.

Which of the statements explains how chimpanzees and humans can be so different with such similar genomes?

The genetic differences could have occurred in regulatory regions of genes responsible for development.

How will a healthy individual's ATP production change during an eight-hour fast? (assuming daily activity is not changed)

The individual's ATP production will not change significantly although they haven't eaten. Production will use storage to power the same usage.

What would be the consequence of a mutation in the lacI repressor gene that produces a repressor protein that is able to bind the operator, but is not able to bind allolactose?

The lacZ and lacY genes would not be expressed even when lactose is present.

We can tell from their structure that fatty acids are a good source of energy because of:

The large number of carbon-carbon and carbon-hydrogen bonds they contain

Imagine that you walk out of your warm house on a cold winter's day. What is different between the air inside and outside of your house in this scenario? The molecules in the warm air have more potential energy than those outside. The molecules in the warm air of your house are moving faster than those outside. The molecules in the cold air outside of your house are moving faster than those inside. The molecules in the warm air inside of your house have less entropy than those outside. The molecules in the cold air outside of your house have more kinetic energy than those inside.

The molecules in the warm air of your house are moving faster than those outside.

You are estimating the time since the divergence of two species and used hemoglobin for your molecular clock. You would like to get independent support for your estimate. If you also use cytochrome c, which result do you expect?

The number of amino acid differences between the two species will be fewer for cytochrome cthan for hemoglobin.

variable number tandem repeats (VNTR)

The number of tandem repeats at specific places (loci) in DNA that varies among individuals.

Which statement is true regarding the earliest photosynthetic organisms on Earth? The organisms likely used molecules other than H2O (that is, H2S) as electron donors. Given the abundance of H2O on early Earth, these organisms used H2O as an electron donor. These organisms likely possessed two photosystems. These organisms likely used both inorganic molecules and H2O as electron donors. The organisms likely produced O2 as a waste product, resulting in Earth's current atmosphere.

The organisms likely used molecules other than H2O (that is, H2S) as electron donors.

Which of the following statements is true regarding the earliest photosynthetic organisms on Earth?

The organisms likely used molecules other than water (i.e., H2S) as electron donors.

pH is a measure of the acidity of a solution and equals the negative logarithm of the proton concentration. If the proton concentration decreased on the inside of the vesicle, what would happen to the pH measured on the outside of the vesicle?

The pH would decrease outside of the vesicle. - As the proton concentration decreases on the inside of the cell, they are increasing on the outside of the vesicle. Increased proton concentration makes the pH lower (more acidic).

A researcher is carrying out an experiment where she labels a protein with a fluorescent tag (so she can visualize its location in a cell) and introduces this tagged protein into the lumen of a single thylakoid. She observes her treated cells periodically and notices that the labeled protein can move between grana and is always in the lumen, but is never observed in the stroma. What can she deduce? The protein becomes part of the thylakoid membrane itself and moves freely throughout the interconnected membranes. This protein easily diffuses through the thylakoid membrane. The protein likely travels through a common lumen shared by thylakoid membranes and grana, and cannot easily diffuse through the thylakoid membrane. This protein likely travels between different thylakoid membranes by moving through the stroma, but its movement through the stroma is very brief. This protein can easily transfer between the inner and outer mitochondria membranes.

The protein likely travels through a common lumen shared by thylakoid membranes and grana, and cannot easily diffuse through the thylakoid membrane.

A researcher is carrying out an experiment where she labels a protein with a fluorescent tag (so she can visualize its location in a cell), and introduces this tagged protein into the lumen of a single thylakoid. She observes her treated cells periodically, and notices that the labeled protein can move between grana, but is never observed in the stroma. What can she deduce? Please choose the correct answer from the following choices, and then select the submit answer button. The protein likely travels through a common lumen shared by thylakoid membranes and grana, and cannot easily diffuse through the thylakoid membrane. This protein can easily transfer between the inner and outer mitochondria membranes. All thylakoid membranes and grana share a common lumen, through which the labeled protein can move. This protein cannot easily diffuse through the thylakoid membrane. This protein likely travels between different thylakoid membranes by moving through the stroma, but its movement through the stroma is very brief.

The protein likely travels through a common lumen shared by thylakoid membranes and grana, and cannot easily diffuse through the thylakoid membrane.

A researcher is carrying out an experiment where she labels a protein with a fluorescent tag (so she can visualize its location in a cell), and introduces this tagged protein into the lumen of a single thylakoid. She observes her treated cells periodically, and notices that the labeled protein can move between grana, but is never observed in the stroma. What can she deduce? This protein can easily transfer between the inner and outer mitochondria membranes. This protein cannot easily diffuse through the thylakoid membrane. All thylakoid membranes and grana share a common lumen, through which the labeled protein can move. This protein likely travels between different thylakoid membranes by moving through the stroma, but its movement through the stroma is very brief. The protein likely travels through a common lumen shared by thylakoid membranes and grana, and cannot easily diffuse through the thylakoid membrane.

The protein likely travels through a common lumen shared by thylakoid membranes and grana, and cannot easily diffuse through the thylakoid membrane.

If a mutation occurs such that photosystem I no longer functions as efficiently as it should, what might be MOST directly affected? The rate of ATP synthesis by ATP synthase in the chloroplast. The amount of oxygen produced. The rate at which NADPH is produced. The rate at which protons are transported into the thylakoid.

The rate at which NADPH is produced.

You strip off all proteins on the cell surface by using a protease (an enzyme that destroys proteins). Now, when you add a specific signaling molecule, the cell still responds. What is the most reasonable explanation of this?

The receptor for this signal is inside the cell, and the signaling molecule is nonpolar and can diffuse into the cell.

Why do the functions of many receptor kinases depend on the fluid nature of the plasma membrane?

The receptor monomers must move together and dimerize to be activated.

Suppose a plant is exposed to a toxin that causes the thylakoid membranes to become much more permeable to protons than normal. Which of the following would be true?

The reduction and regeneration steps of the Calvin cycle would slow down and eventually stop.

G2 phase

The second growth phase of the cell cycle, consisting of the portion of interphase after DNA synthesis occurs; prep for division

You have found a sample of part of a wing, perhaps from an insect, in amber. You have no other body parts to this specimen and are interested to know if it was a species that underwent metamorphosis. You are able to get a bit of DNA from the sample. You are using the phylogeny in the tree shown as a reference for your sample.

The sequence for the specimen would be a sister taxon to the beetle.

In a particular layer of rock, a number of fossilized ferns are found, but no fossilized mosses. What conclusions can be drawn from this finding?

The soft tissues of mosses may not have fossilized as readily as the more decay-resistant tissues of ferns, so it is difficult to draw any conclusions from this limited sample.

You are investigating a mutant eukaryotic cell line that makes all of its mRNAs much longer than the mRNAs from normal cells. Intrigued, you examine the proteins in these cells and note that many of them are either much longer or much shorter than the normal proteins from nonmutant cells. Assuming there is just one mutant defect in these cells, which of the possibilities is most likely?

The spliceosome is nonfunctional.

Suppose there is a mutation in a laminin-binding integrin gene that causes a loss of function in the cytoplasmic domains of the integrin. Which one of the outcomes would you expect to observe as a result of this mutation?

The strength of tissues would decrease because the integrin could no longer associate with microfilaments.

Why do histone genes have a very slow molecular clock?

The structure of the histone gene must be conserved for DNA to function properly.

S phase

The synthesis phase of the cell cycle; the portion of interphase during which DNA is replicated.

The enzyme rubisco can catalyze two seemingly conflicting reactions. When the enzyme first evolved, why was this probably less of a problem?

There was very little O2 in the atmosphere.

A beaker contains two solutions of salt dissolved in water. The two solutions have different concentrations of salt (measured by molarity, M) and are separated by a membrane that is permeable to both salt and water. The salt and water will move through the membrane by diffusion. Which statement is true about the diffusion of these solutions?

There will be a net movement of salt from side B to side A and net movement of water from side A to side B.

The coronary arteries supply blood to the heart muscles. Which of the following events would occur in heart tissue following a heart attack due to a block in the coronary arteries? Choose all correct answers.

There would be a decrease in the production of ATP. There would be a stimulation of phosphofructokinase, an intermediary enzyme of glycolysis. There would be an accumulation of lactic acid in the tissue due to glycolysis and fermentation.

Recall from the text in the example of cell communication in Streptococcus pneumoniae that the rate of DNA uptake by pneumococcal cells increases sharply when they are at high density, due to changes in gene expression brought about by signaling between cells. If the pneumococcal cells did not express receptor protein, how would the rate of DNA uptake be affected when the cells reach high density?

There would be no increase in the rate of DNA uptake.

Many scientists use chemical inhibitors to interfere with normal signaling pathways within eukaryotic cells. If such inhibitors are large, nonpolar molecules, what is the likely method of action of these chemical inhibitors?

These chemical inhibitors likely bind to receptors on the cell surface and interfere with receptor activation or signal-receptor binding.

Which statement is true regarding Earth's earliest organisms?

These organisms likely carried out fermentation and may have had rudimentary proton pumps.

The only known "solution" to the loss of efficiency caused by the oxygenation of RuBP by rubisco is to raise the concentration of CO2 in the cell using energy from ATP. Which of the following is most correct of such plants?

They are often found in bright, sunny habitats.

Which of the following best describes the benefit to early photosynthetic organisms gained by having two different photosystems in one cell? Please choose the correct answer from the following choices, and then select the submit answer button. These organisms produced carbohydrates at twice the rate of organisms with a single photosystem. They produced oxygen. They could use water as an electron donor They could thrive in places where there was little or almost no light.

They could use water as an electron donor

Which of these best describes the benefit to early photosynthetic organisms gained by having two different photosystems in one cell?

They could use water as an electron donor.

Which is a true statement about receptors that are localized to the nucleus?

They move through a nuclear pore. They are synthesized in the cytosol. They bind nonpolar ligands. They carry a nuclear-localization signal.

Which of the answer choices is true when comparing the Calvin cycle and light-harvesting reactions of photosynthesis?