BioMed Semester 1 Finals Review - Amy Weller (PLTW) (PBS)
List the following in order of complexity: cells (1), organs (2), organelles (3), organism (4), tissues (5), organ systems (6)
3 1 5 2 6 4
Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of nucleotides in the sample will be guanine?
38
A person is found dead by a neighbor. What career is involved in notifying the police and calling an ambulance?
911 Operator
Given the DNA strand GAATTCCTCGAG, what would be the complementary strand to make the double-stranded DNA?
CTTAAGGAGCTC
Which body system is most closely associated with transport and delivery?
Cardiovascular
What person is responsible for providing short-term care for people being transported to the hospital?
EMT
According to Chargaff's rule, what are the base pair matches?
G and C; A and T
What law allows healthcare professionals to reveal private patient information under specific circumstances?
HIPAA
A doctor calls a patient at home to give her the results of a cancer screening. The patient's brother is staying with the family for a week and answers the phone. The doctor gives him the test results to pass on to the patient. Is this a violation of HIPAA?
IDK!!
Scientists are able to separate DNA sequence through what?
IDK!!!!
Why do scientists load DNA of known sizes into the agarose gel?
It makes it easier to determine the size of unknowns using comparison techniques
The bodily system that in vertebrates receives and interprets stimuli and transmits impulses to the effector organs is called...
Nervous (system)
A receptionist faxes the result of a patient's blood work to their private office as per patient request. Is this a violation of HIPAA?
No
After a tornado disaster, the medical facility notifies the media on the condition of the mayor's daughter, who was a victim. Is this a violation of HIPAA?
No
What is the basic structural unit of DNA called?
Nucleotide
What body system is most closely associated with the support and protection of the body organs?
Skeletal
The sequence of one strand of DNA is AATTGCTAT. What would its complementary strand read?
TTAACGATA
In experimental design, why is data collection important?
To support your conclusion
What is the shape of an incision made in the chest during an autopsy?
Y (shape)
A doctor texts his wife about seeing one of their neighbors as a patient. Is this a violation of HIPAA?
Yes
A nurse suspects that her neighbor is leaving her 7-year-old daughter home alone in the evening while working and contacts Child Protective Services. Is this a violation of HIPAA?
Yes
A nurse tweets about her celebrity patient. Is this a violation of HIPAA?
Yes
A patient arrives in the ER and is suspected of having tuberculosis, the physician contacts the health department with the information. Is this a violation of HIPAA?
Yes
The hospital contacts the media about a patient with a gunshot wound. Is this a violation of HIPAA?
Yes
The hospital contacts the police department about a patient with a gunshot wound. Is this a violation of HIPAA?
Yes
A person was texting while driving and ran into the side of an overpass on the highway. What is the manner of death?
accidental
What two nitrogenous bases are purines?
adenine; guanine
What ridge pattern is this fingerprint?
arch
An examination of the body after death that includes a dissection of vital organs to determine cause of death is a(n)
autopsy
What evidence found at the crime scene would contain DNA?
blood
A person was texting while driving and ran into the side of an overpass on the highway. What is the cause of death?
blunt force trauma (to the body)
The transport system of the body responsible for carrying oxygen and nutrients to the body cells and carrying away carbon dioxide and other wastes is called...
cardiovascular (system)
How can the time of death be determined?
core body temperature
Name the three parts of a nucleotide.
deoxyribose molecule, phosphate group, nitrogenous base
The sides of the DNA ladder are composed of:
deoxyribose sugar, phosphate
What step would directly follow making a hypothesis in experimental design?
design and carry out an experiment
The group of organs that break down foods into chemical components that the body can absorb and use for energy, and for building and repairing cells and tissues is called...
digestive (system)
In the DNA isolation lab, what was the purpose of the detergent?
dissolve the cell and nuclear membrane
If the following DNA sequence were cut using the restriction enzyme KB502, how many pieces of DNA would be made? (KB502 restricts (cuts) at the end of the sequence TCCT). ATAACGTCCTAAACTATCTCCTATCCGAATCCTACCGATTCA
four
The diameter of a blood drop can be used to estimate the...
height from which the drop fell
What type of chemical bond is found between paired bases of the DNA double helix?
hydrogen
The one factor in an experiment that the scientist changes in each trial is the...
independent variable
Who would be responsible for performing an autopsy on a cadaver (dead body)?
medical examiner
Gel electrophoresis is used to separate the fragments of DNA. The larger pieces of DNA will travel __________ than the smaller fragments through the gel.
more slowly
Which body system is most closely associated with information assessment?
nervous
DNA is a very large molecule (a polymer) made up of a long chain of repeating sub-units called what?
nucleotide
When running a gel electrophoresis, DNA will migrate towards the ______ end because DNA has a ______ charge.
positive negative
A system of organs, functioning in the process of gas exchange between the body and the environment is called...
respiratory (system)
DNA is cut at specific nucleotide sequences by what?
restriction enzymes
The shape of a DNA molecule is:
spiral staircase
What characteristic separates DNA fragments during gel electrophoresis?
the length of the DNA fragment
What property of DNA causes it to migrate to the positive pole of the electrophoresis apparatus?
the negative change of DNA
If every human's DNA is made up of the same four nucleotide bases, why do we have differences?
the order of the bases
An experiment was conducted to test the effectiveness of a blood pressure drug. Before the trial, all of the patients' blood sugar was recorded. One hundred patients were given the drug for six months and one hundred different patients were given a placebo. After six months, all the patients' blood pressures were measured. What is the DEPENDENT VARIABLE in this experiment?
the patients' blood sugar
Which career involves the study of symptoms, mechanisms, treatments, and detection of poisonings, drugs, and other toxins, especially in people?
toxicologist
What body system's main role is waste removal?
urinary
A body system that is responsible for disposing of waste in the body and fluid levels is called...
urinary (system)
