Chapter 12

"Sticky ends" are A) produced by the action of DNA ligase. B) produced by PCR. C) always long sequences of a single nucleotide. D) DNA fragments with single-stranded ends.

d

The polymerase chain reaction relies upon unusual, heat-resistant ________ that were isolated from bacteria living in hot springs. A) DNA polymerases B) phages C) restriction enzymes D) plasmids

a

A nucleic acid probe is A) a virus that transfers DNA to a recipient cell. B) a piece of radioactively labeled DNA that is used to locate a specific gene. C) an enzyme that locates a specific restriction site on RNA. D) a plasmid that recognizes a specific DNA sequence.

b

Approximately what percentage of human DNA is noncoding? A) 49% B) 79% C) 98.5% D) 99.9%

c

Genetically modifying ________ cells may directly affect future generations. A) bone marrow B) somatic C) gamete-forming D) photoreceptor

c

The production of multiple identical copies of gene-sized pieces of DNA defines A) gene cloning. B) transformation. C) DNA technology. D) genetic engineering.

A

Which of the following is an example of a genetically modified organism but not a transgenic organism? A) Flavr Savr peaches (peaches that express larger quantities of a peach stability enzyme) B) Golden Rice (rice that expresses daffodil and bacteria beta-carotene synthesis enzymes) C) AquAdvantage salmon (Atlantic salmon that expresses Chinook salmon growth hormone) D) Roundup Ready soybeans (soybeans that express bacterial pesticide enzymes)

A

Cystic fibrosis is a genetic disease that results from a defective CFTR protein that alters ion flow through the cell membrane such that water does not cross the cell membrane. Gene therapy is being used to attempt to help cystic fibrosis patients. Which of the following steps is not needed to develop a gene therapy treatment for cystic fibrosis? A) Clone the normal-functioning CFTR gene and make an RNA version of the gene. B) Make antibodies to the defective CFTR protein to enhance the patient's immune system. C) Remove cells from a patient and infect them with the recombinant virus. D) Insert the RNA version of the CFTR gene into a virus.

B

After DNA fragments with matching sticky ends are temporarily joined by complementary base pairing, the union can be made permanent by the "pasting" enzyme A) DNA ligase. B) DNA polymerase. C) DNA helicase. D) ATP methylase.

a

Gel electrophoresis is normally set up with the negative electrode at the top of the gel and the positive electrode at the bottom of the gel. The DNA products are loaded at the top of the gel, and then a current is applied to separate them. However, when preparing to run a gel, you accidentally switched the locations of the negative and positive electrodes such that the positive electrode is at the top and the negative electrode is at the bottom. You still loaded the DNA products at the top of the gel as normal. What result are you most likely to observe if you apply an electric current to this gel setup? A) All DNA molecules will migrate up the gel toward the positive electrode. B) All DNA molecules will migrate down the gel toward the negative electrode. C) Shorter DNA molecules will move up the gel, and longer DNA molecules will move down the gel. D) Longer DNA molecules will move up the gel, and shorter DNA molecules will move down the gel.

a

If you commit a crime, you need to make sure that you do not leave even the smallest speck of blood, hair, or other organic matter from your body. If you do, the DNA in this material can be amplified by ________, subjected to genetic analysis, and used to identify you as the perpetrator of the crime. A) PCR B) STR analysis C) RFLP D) restriction digests

a

In the process of human gene cloning using plasmids, the bacterial plasmid A) is used as the vector. B) is the source of the gene to be cloned. C) is cultured inside the human cell, which contains the gene to be cloned. D) is used to insert the human gene into the bacterial chromosome.

a

Some restriction enzymes do not leave sticky ends when cutting DNA molecules; rather, they cut a restriction site down the middle and leave "blunt-ended" DNA molecules, which do not have any single-stranded nucleotide extensions. Which of the following is not a likely outcome when trying to insert a gene into a plasmid when have both been cut with the same "blunt-ended" restriction enzyme? A) The gene might be inserted into the plasmid by forming hydrogen bonds. B) The gene might be inserted into the plasmid multiple times in a row. C) The gene might insert into the plasmid in the proper (forward) orientation. D) The gene might insert into the plasmid in the wrong (backward) orientation.

a

TPOX is one of the STRs that is used to compare DNA between different people. Why is TPOX useful for comparing DNA between different people? A) TPOX varies in the number of repeats between different people. B) TPOX varies in sequence between different people. C) TPOX is only present in some people's genomes. D) TPOX is present in different places in different people's genomes.

a

The ________ approach to gene cloning employs a mixture of fragments from the entire genome of an organism and results in the production of thousands of different recombinant plasmids. A) shotgun B) genetic engineering C) restriction D) cloning

a

What is the current standard tool used for DNA profiling by forensic scientists? A) STR analysis B) gene cloning C) genetic engineering D) RFLP analysis

a

When cloning a gene, one of the steps is to use restriction enzymes to insert the gene of interest into a vector. If you separated the empty vector (the vector without the gene of interest) and the cloned vector (the vector that has the gene of interest added) using agarose gel electrophoresis, what do you expect to observe on the agarose gel if both vectors are loaded at the same position at the top of the gel? A) The empty vector would migrate farther down than the cloned vector. B) The cloned vector would migrate farther down than the cloned vector. C) The empty vector would migrate the same distance as the cloned vector. D) It is impossible to know without knowing the identity of the gene of interest.

a

When genetic variation in one nucleotide is found in at least 1% of the population, it is known as a A) single nucleotide polymorphism. B) short tandem repeat. C) recombinant DNA molecule. D) genomic library.

a

Which of the following statements about nucleic acid probes is false? A) A nucleic acid probe is a double-stranded section of DNA. B) A nucleic acid probe can be used to find a specific gene. C) A nucleic acid probe binds to a complementary sequence in the gene of interest. D) A nucleic acid probe is usually labeled with a radioactive isotope or fluorescent tag to help identify its location.

a

You prepare a genomic library and use this as a source to produce recombinant proteins in E. coli. However, after producing the proteins you find that they are all too long or too short. In fact, you don't find a single protein that is the correct size. What is the best explanation for this result? A) Since a genomic library was used as the source of the genes, the introns were included during transcription and translation. B) Since bacteria were used to produce the proteins, sugar groups were not properly added on to the proteins that were being made. C) Since a genomic library was used as the source, the recombinant bacterial plasmid DNA was likely incorporated into the proteins being made. D) Since bacteria were used to produce the proteins, the native bacterial plasmid DNA was likely incorporated into the proteins being made.

a

A vaccine works by A) inhibiting bacterial replication. B) stimulating the immune system. C) inhibiting viral replication. D) preventing the translation of mRNA.

b

Researchers are trying to make a genetically modified (GM) pig that expresses bovine (cow) growth hormone to make it grow bigger. They isolated the bovine growth hormone gene, cut it and a plasmid with the same restriction enzyme, and mixed them together. They inserted the mixture into pig zygotes, but only normal pigs, not GM pigs, grew. What did they likely do wrong? A) They are trying to make a GM animal, which is impossible. B) They forgot to add DNA ligase after mixing the plasmid and gene together. C) They should have used different restriction enzymes to cut the plasmid and the gene. D) They forgot to use PCR and make multiple copies of the growth hormone gene.

b

Restriction enzymes A) facilitate nucleotide base pairing. B) cut DNA at specific sites. C) stop transcription and translation. D) bind together strands of DNA.

b

The advantage of being able to clone the gene for human insulin is that A) there are too few cows, pigs, and horses to provide an adequate supply of their insulin. B) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin. C) cow, pig, or horse insulin cannot keep a diabetic alive for more than three months. D) using human insulin increases the probability that, in the future, the person suffering from diabetes can be weaned from a dependence on insulin.

b

The enzyme that converts information stored in RNA to information stored in DNA is A) DNA ligase. B) reverse transcriptase. C) a restriction enzyme. D) RNA polymerase.

b

The type of repetitive DNA composed of sequences of large repeated units is often associated with A) tandem repeats. B) transposable elements. C) sex-linked genes. D) transcription factors.

b

What is the smallest number of cells needed to perform a successful DNA profile? A) 1 B) 20 C) 200 D) 1,000

b

When DNA from two sources is combined into one single piece of DNA, it is known as A) cloned DNA. B) recombinant DNA. C) a vector. D) a plasmid.

b

When DNA molecule "A" is cut with the restriction enzyme EcoRI, it is cut into four pieces. When DNA molecule "B," which is exactly identical to DNA molecule "A" except for the presence of one SNP, is cut with EcoRI, it is cut into three pieces. What is the best explanation for this observation? A) The SNP occurs in all EcoRI restriction sites in DNA molecule "B." B) The SNP occurs in a single EcoRI restriction site in DNA molecule "B." C) Not enough EcoRI was used to cut DNA molecule "B." D) An excess of EcoRI was used to cut DNA molecule "A."

b

Which of the following has not been a significant issue in the creation of genetically modified (GM) organisms? A) the fact that some plants carrying genes from other species might represent a threat to the environment B) the fact that GM organisms cannot be modified to prevent them from reproducing once they pass beyond the experimental stage C) the fact that rogue microbes might transfer dangerous genes into other organisms D) the fact that the protein products of transplanted genes might lead to allergic reactions

b

Which of the following is an example of a transgenic organism? A) a fern grown from a single fern root cell B) a rat with rabbit hemoglobin genes C) a cow that has been fed pig growth hormone in its food D) a human given a corrected human blood-clotting gene

b

Which of the following is the best definition of a genomic library? A) a collection of cloned DNA fragments that includes some parts of organism's genome B) a collection of cloned DNA fragments that includes an organism's entire genome C) a collection of cloned DNA fragments that includes multiple organisms' genomes D) a collection of cloned DNA fragments that includes only exons from an organism's genome

b

Which of the following statements regarding DNA is false? A) Long stretches of repetitive DNA are prominent at centromeres and ends of chromosomes. B) Human and E. coli genomes contain approximately the same proportions of noncoding DNA. C) Current estimates are that there about 21,000 genes in the human genome. D) Telomeres seem to have a structural function.

b

Which of the following statements regarding repetitive DNA is false? A) Repetitive DNA is usually found between genes. B) Repetitive DNA is identical in all humans. C) Repetitive DNA is usually repeated multiple times in the genome. D) Repetitive DNA can show great variation among individuals.

b

You are trying to produce a cDNA library starting from mRNA in skeletal muscle cells. You add the following components to a tube and let the reaction proceed: skeletal muscle mRNA, free nucleotides, and DNA polymerase. After inspecting the products of the reaction, you do not find any cDNA molecules at all. What is the most likely explanation for this result? A) You used mRNA instead of genomic DNA as the source material. B) You used DNA polymerase instead of reverse transcriptase. C) cDNA libraries can only be made from skin cell mRNA molecules. D) You forgot to add a radiolabeled nucleic acid probe to the tube.

b

A transgenic animal is A) an animal that is the first of its kind to bear a particular allele. B) an animal in which a genetic defect has been corrected using recombinant DNA therapy. C) an animal containing a gene from another organism, typically of another species. D) an animal containing genes from three or more species.

c

Biotechnology A) is a modern scientific discipline that has existed for only a few decades. B) is strictly concerned with the manipulation of DNA. C) has been around since the dawn of civilization. D) is generally considered more harmful than valuable to society.

c

DNA ligase binds A) recombinant DNA to transformed bacterial cells. B) recombinant DNA to recombinant proteins. C) nucleotides in the DNA backbone together. D) nucleotide base pairs together.

c

Genome sequence analysis suggests that Neanderthals A) never interbred with humans. B) are more closely related to chimpanzees than humans. C) at least sometimes had pale skin and red hair. D) could not speak.

c

Golden Rice is golden in color because it is rich in A) vitamin A. B) vitamin C. C) beta-carotene. D) chromium picolinate.

c

Segments of eukaryotic DNA that can move or be copied from one site to another in the genome are called A) exons. B) plasmids. C) transposable elements. D) vectors.

c

The feature of "sticky ends" that makes them especially useful in DNA recombination is their ability to A) bind to DNA and thereby activate transcription. B) bind to ribosomes and thereby activate translation. C) form hydrogen-bonded base pairs with complementary single-stranded stretches of DNA. D) allow plasmids to attach to the main bacterial chromosome.

c

The only cells that can correctly attach sugars to proteins to form glycoprotein products are A) yeast cells. B) E. coli cells. C) mammalian cells. D) algal cells.

c

The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI? A) two B) three C) four D) five

c

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? A) two B) three C) four D) five

c

The type of recombinant bacteria most often used to mass-produce genes is A) Pseudomonas aeruginosa. B) Agrobacterium tumefaciens. C) Escherichia coli. D) Saccharomyces cerevisiae.

c

What is the preferred name of the technique used to determine if DNA comes from a particular individual? A) DNA technology B) DNA analysis C) DNA profiling D) DNA microarrays

c

When plasmids are used to produce a desired protein, A) the plasmids are inserted into the bacterial chromosome. B) the plasmids multiply and produce the protein outside of the bacterium. C) the desired gene is inserted into the plasmid, and the plasmid is returned to the bacterium by transformation. D) the bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene (often the cell of a plant or animal).

c

Which of the following genetically modified organisms has not been developed by genetic engineers (at least, not yet)? A) transgenic rice with genes for milk proteins B) transgenic salmon with a growth hormone gene that allows them to grow more quickly C) transgenic corn with the gene for human insulin D) transgenic pigs with a roundworm gene that allows them to make more omega-3 fatty acids

c

Which of the following statements about genome sequencing is false? A) The genomes of nearly 7,000 species have been completely sequenced. B) The first eukaryotic organism to have its genome sequenced was yeast. C) Most of the genomes that have been sequenced to date are eukaryotes. D) The genome of a mouse has been sequenced.

c

Which of the following statements regarding proteomics is true? A) Proteomics is the study of protein interaction within a cell. B) Proteomics involves the complete analysis of the prokaryotes. C) Proteomics is the systematic study of the full set of proteins encoded by a genome. D) Proteomics and genomics allow scientists to study life in an ever-increasing reductive approach.

c

Why is the whole-genome shotgun method currently the tool of choice for analyzing genomes? A) It is extremely accurate. B) Multiple genomes can be analyzed simultaneously. C) It is fast and inexpensive. D) It is very labor-intensive.

c

hich of the following statements about DNA technology is false? A) DNA technology is now used to mass-produce human insulin. B) DNA technology is now used to mass-produce human growth hormone. C) DNA technology is now used to create cells that can identify and kill cancer cells. D) DNA technology is now used to produce vaccines that are harmless mutants of a pathogen.

c

A cDNA library differs from a genomic library in that A) the cDNA was constructed from introns only. B) genomic libraries are only stored in bacterial cells. C) cDNA libraries are more stable. D) cDNA libraries only contain information from genes that have been transcribed.

d

An advantage of using reverse transcriptase to prepare a gene for cloning is that A) reverse transcriptase is more efficient than RNA polymerase. B) the resulting DNA strand will lack exons. C) reverse transcriptase is more efficient than DNA polymerase. D) the resulting DNA strand will lack introns.

d

Approximately what percentage of the human genome is identical to that of a chimpanzee? A) 50.0% B) 62.3% C) 92.0% D) 98.8%

d

Biotechnology companies sell kits that allow you to do PCR to amplify STR regions from human blood samples that you have collected. What components would you expect to find in the kit in order to be able to do successful PCR reactions? A) human DNA polymerase, primers that flank STR regions B) heat-stable DNA polymerase, primers that flank STR regions C) human DNA polymerase, primers that flank STR regions, free nucleotides D) heat-stable DNA polymerase, primers that flank STR regions, free nucleotides

d

During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size. A) sample mixture B) positively charged electrode C) negatively charged electrode D) agarose gel

d

Gel electrophoresis sorts DNA molecules on the basis of their A) nucleotide sequence. B) ability to bind to mRNA. C) solubility in the gel. D) size.

d

Genomic libraries can be constructed using either bacterial plasmids or what other vector? A) ribosomes B) tRNA C) human chromosomes D) bacteriophages

d

In order for gene therapy to be permanent in the patient being treated, A) the defective gene must first be removed from all somatic cells. B) the normal gene must be added to the germ line cells. C) the normal gene must first be treated with UV radiation to ensure noninfectivity. D) the normal gene must be transferred to somatic cells that can continuously multiply.

d

Restriction enzymes specifically recognize and cut short sequences of DNA called A) introns. B) exons. C) sticky ends. D) restriction sites.

d

The number of proteins in humans A) is approximately equal to the number of genes. B) cannot be determined because the human genome is too complex. C) is less than half the number of genes. D) is much greater than the number of genes.

d

Which of the following pieces of evidence would be considered the best for establishing biological relatedness? A) birth certificates B) pictures from family reunions C) testimony from relatives D) a very close match in the DNA profile

d

Which of the following statements about genomics is false? A) The first complete genome to be sequenced was a prokaryote. B) Whole sets of genes and their interactions are studied in the field of genomics. C) Genes from different species that have analogous sequences suggest similar function. D) DNA technology limits genomic studies to prokaryotes.

d

You are setting up a PCR reaction and add a primer for one end of the target sequence, but you forget to add the primer for the other end of the target sequence. If you added the other necessary components, what do you expect to observe after running the PCR reaction for 40 cycles? A) The PCR reaction will produce billions of copies of the target DNA. B) The PCR reaction will produce millions of copies of the target DNA. C) The PCR reaction will produce one copy of the target DNA. D) The PCR reaction will produce zero copies of the target DNA.

d

________ are a major source of restriction enzymes. A) Plant cells B) Human cells C) Archaea cells D) Bacterial cells

d