Chapter 12 bio (copied)

Lakukan tugas rumah & ujian kamu dengan baik sekarang menggunakan Quizwiz!

Which type of RNA is involved in protein synthesis?

-mRNA -tRNA -rRNA

The genetic code consists of ____ codons that specify amino acids, and ____ codons that do not specify amino acids

61/3

The most common eukaryotic ribosome carries out its function in the

cytosol.

Because more than one codon can specify the same amino acid, the genetic code is said to be

degenerate

Which of the following best describes transcription?

DNA -> RNA

Which of the following does not occur during translation in eukaryotes?

Introns are removed by the ribosome.

Which of the following best describes translation?

RNA -> Protein

Of which type of molecules are spliceosomes composed?

RNA and protein

The enzyme that accomplishes transcription is termed

RNA polymerase

During the process of transcription in a eukaryote

RNA polymerase synthesizes new nucleotide chains in the 5' to 3' direction.

________ is to transcription as ________ are to translation.

RNA polymerase; ribosomes

Identify the anticodon sequence for an mRNA sequence that is 5′AUG-GGC-ACU-CAU3′.

3′UAC-CCG-UGA-GUA5′

Which of the following do snRNPs bind to?

5' and 3' ends of the intron

If a DNA template strand has a sequence of 3′ TACAATGTAGCC 5′, then the RNA produced from it will be which sequence?

5′AUGUUACAUCGG3'

Translation is terminated when a stop codon is presented at the ________ site.

A

What stimulates the ribosome to move down one codon?

The formation of a bond between the peptide in the P site and the amino acid in the A site

What enzyme catalyzes the attachment of amino acids to tRNA molecules?

aminoacyl-tRNA synthetase

The processes of transcription and translation are collectively known as

gene expression

Intervening sequences that are transcribed, but not translated into protein are called

introns

During the process of translation in a eukaryote

mRNA interacts with ribosomes in the cytoplasm.

The amino acids of a growing polypeptide chain are held together by what kind of bond during the elongation stage of translation?

peptide

The transcription process in a eukaryotic gene directly produces

pre-mRNA

The transcription enzyme first attaches to the ________ of the gene.

promoter

Transcription begins near a site in the DNA called the ______

promoter

Translation is the synthesis of

proteins from mRNA.

The snRNPs are also called

snurps

The reason that the genetic code can correctly specify the order of amino acids in a polypeptide is

specific tRNAs become attached to specific amino acids

Which of the following serves as the "translator" or intermediary between an mRNA codon and an amino acid?

tRNA

In eukaryotes, transcription to produce an mRNA must occur in

the nucleus, where the chromosomal DNA is found.

Which of the following occurs as the ribosome shifts down the mRNA by a distance of three nucleotides?

the tRNA that was in the P site moves into the E site

A characteristic shared by eukaryotic mRNA, tRNA, and ribosomal RNA is that

they are all transcribed from DNA

The process that produces mRNA from DNA is called

transcription.

A single gene always encodes for an enzyme.

False

The genetic code is degenerate. That means

a particular amino acid can be specified by more than one codon.

There is only one start codon, AUG. This means that

all newly-made polypeptides have a methionine at their amino end.

An organized unit of DNA sequences that enables a segment of DNA to be transcribed into RNA and ultimately results in the formation of a functional product is called a _______.

gene

The amino acid sequence of a protein determines its shape and specific function.

Yes it's True

A 5'-CUA-3' codon in an mRNA could be recognized by which of the following anticodon sequences in a tRNA?

3'-GAU-5'

How many nucleotides are contained in a single codon?

three

The termination of translation occurs when a release factor recognizes the stop codon.

True

The following mRNA transcript would result in what polypeptide sequence? 5′ ACU-UUC-ACU-AUG-UUU-UUA-UCC-UCC-ACU-CCU-UGA 3′

Met-Phe-Leu-Ser-Ser-Thr-Pro

Which of the following statements about the segment of DNA below is TRUE? 5' CTATGGGCCATTTTTTAACGGGAGGCCCATGAA 3' 3' GATACCCGGTAAAAAATTGCCCTCCGGGTACTT 5'

There are two possible transcripts that are transcribed on opposite strands of the helix.

More than one codon can specify the same amino acid.

True

The molecule mRNA, which contains the information to make a polypeptide, is constructed from a DNA template.

True


Set pelajaran terkait

Optics of the Eye Quiz #1 Material (Lectures 1-9)

View Set

Chapter 8: Chemical Equations and Reactions

View Set

Chapter 9 Teaching and Counseling

View Set

3411 Adult Health Pre-Lecture Quiz Week 1

View Set

Accounting Chapter 21 - True/False

View Set