Chapter 12 bio (copied)
Which type of RNA is involved in protein synthesis?
-mRNA -tRNA -rRNA
The genetic code consists of ____ codons that specify amino acids, and ____ codons that do not specify amino acids
61/3
The most common eukaryotic ribosome carries out its function in the
cytosol.
Because more than one codon can specify the same amino acid, the genetic code is said to be
degenerate
Which of the following best describes transcription?
DNA -> RNA
Which of the following does not occur during translation in eukaryotes?
Introns are removed by the ribosome.
Which of the following best describes translation?
RNA -> Protein
Of which type of molecules are spliceosomes composed?
RNA and protein
The enzyme that accomplishes transcription is termed
RNA polymerase
During the process of transcription in a eukaryote
RNA polymerase synthesizes new nucleotide chains in the 5' to 3' direction.
________ is to transcription as ________ are to translation.
RNA polymerase; ribosomes
Identify the anticodon sequence for an mRNA sequence that is 5′AUG-GGC-ACU-CAU3′.
3′UAC-CCG-UGA-GUA5′
Which of the following do snRNPs bind to?
5' and 3' ends of the intron
If a DNA template strand has a sequence of 3′ TACAATGTAGCC 5′, then the RNA produced from it will be which sequence?
5′AUGUUACAUCGG3'
Translation is terminated when a stop codon is presented at the ________ site.
A
What stimulates the ribosome to move down one codon?
The formation of a bond between the peptide in the P site and the amino acid in the A site
What enzyme catalyzes the attachment of amino acids to tRNA molecules?
aminoacyl-tRNA synthetase
The processes of transcription and translation are collectively known as
gene expression
Intervening sequences that are transcribed, but not translated into protein are called
introns
During the process of translation in a eukaryote
mRNA interacts with ribosomes in the cytoplasm.
The amino acids of a growing polypeptide chain are held together by what kind of bond during the elongation stage of translation?
peptide
The transcription process in a eukaryotic gene directly produces
pre-mRNA
The transcription enzyme first attaches to the ________ of the gene.
promoter
Transcription begins near a site in the DNA called the ______
promoter
Translation is the synthesis of
proteins from mRNA.
The snRNPs are also called
snurps
The reason that the genetic code can correctly specify the order of amino acids in a polypeptide is
specific tRNAs become attached to specific amino acids
Which of the following serves as the "translator" or intermediary between an mRNA codon and an amino acid?
tRNA
In eukaryotes, transcription to produce an mRNA must occur in
the nucleus, where the chromosomal DNA is found.
Which of the following occurs as the ribosome shifts down the mRNA by a distance of three nucleotides?
the tRNA that was in the P site moves into the E site
A characteristic shared by eukaryotic mRNA, tRNA, and ribosomal RNA is that
they are all transcribed from DNA
The process that produces mRNA from DNA is called
transcription.
A single gene always encodes for an enzyme.
False
The genetic code is degenerate. That means
a particular amino acid can be specified by more than one codon.
There is only one start codon, AUG. This means that
all newly-made polypeptides have a methionine at their amino end.
An organized unit of DNA sequences that enables a segment of DNA to be transcribed into RNA and ultimately results in the formation of a functional product is called a _______.
gene
The amino acid sequence of a protein determines its shape and specific function.
Yes it's True
A 5'-CUA-3' codon in an mRNA could be recognized by which of the following anticodon sequences in a tRNA?
3'-GAU-5'
How many nucleotides are contained in a single codon?
three
The termination of translation occurs when a release factor recognizes the stop codon.
True
The following mRNA transcript would result in what polypeptide sequence? 5′ ACU-UUC-ACU-AUG-UUU-UUA-UCC-UCC-ACU-CCU-UGA 3′
Met-Phe-Leu-Ser-Ser-Thr-Pro
Which of the following statements about the segment of DNA below is TRUE? 5' CTATGGGCCATTTTTTAACGGGAGGCCCATGAA 3' 3' GATACCCGGTAAAAAATTGCCCTCCGGGTACTT 5'
There are two possible transcripts that are transcribed on opposite strands of the helix.
More than one codon can specify the same amino acid.
True
The molecule mRNA, which contains the information to make a polypeptide, is constructed from a DNA template.
True
