Genetics Final Exam

Which of these is a property of both prokaryotic and eukaryotic genes?

DNA binding proteins influence the ability of RNA polymerase to initiate transcription of a gene

In humans, what types of mutation can be passed from parent to offspring?

germ cell mutations

Which of the following elements are involved in the process of translation? (select all that apply) -TATA-binding protein -sigma factor -aminoacyl-tRNAs -Protein polymerase III -introns -peptidyl transferase -5' cap and poly-A-tail -ribosomes -wobble

-aminoaycl-tRNAs -peptidyl transferase -5' cap and poly-A-tail -ribosomes -wobble

Match each mutagenic agent with its action. -base analogs -base modifiers -intercalating agents -UV radiation -X-ray or gamma radiation

-base analogs (mimic bases, cause mispairing) -base modifiers (chemically alter bases, cause mispairing) -intercalating agents (fit in between adjacent nucleotides, cause insertions) -UV radiation (cause pyrimidine dimers) -X-ray or gamma radiation (break covalent bonds)

Which of the following statements about gene flow is true? -it decreases variation in populations -the term gene flow is interchangeable with migration -all of the other answers are correct -it makes populations genetically more similar to each other

-it makes populations genetically more similar to each other

Which of the following statements about prokaryotic and eukaryotic translation are accurate? Select all that apply. -a growing polypeptide chain can at different times be in the E, P, or A site of a ribosome -there are two stop codons in prokaryotes -there are three stop codons in eukaryotes -first amino acid of a polypeptide chain is always methionine (MET)

-there are three stop codons in eukaryotes -first amino acid of a polypeptide chain is always methionine (MET)

Which of the following are assumptions of the Hardy-Weinberg equilibrium model? Select all that apply. -very large population size -random mutation -no natural selection -no gene flow

-very large population size -random mutation -no natural selection -no gene flow

Cystic fibrosis is a recessive condition that affects about 1 in 2,500 babies in the Caucasian population of the United States. What is the frequency of the recessive allele (cf) in the population, assuming HWE?

0.02

Cystic fibrosis is a recessive condition that affects about 1 in 2,500 babies in the Caucasian population of the United States. What is the frequency of heterozygous carriers in the population, assuming HWE?

0.0392

If 91% of a population of monsters in HWE is purple-scaled, what is q = f(p)? Scale color: PP = purple Pp = purple pp = blue

0.3

What is p= f(A)? AA 40% AB 30% BB 30%

0.55

Cystic fibrosis is a recessive condition that affects about 1 in 2,500 babies in the Caucasian population of the United States. What is the frequency of the dominant allele (CF) in the population, assuming HWE?

0.98

Each of the following amino acid changes can occur with the change of a single nucleotide in a codon. Determine whether they could be caused by a change in the first position, second position, or third position. 1. PHE -> ILE 2. PRO -> ALA 3. HIS -> GLN 4. PRO -> HIS 5. LEU -> GLN 6. LEU -> ILE

1. first 2. first 3. third 4. second 5. second 6. first

The bug operon produces enzymes that convert compound A into compound B. The operon is controlled by a regulatory gene R. Normally, the enzymes are synthesized only in the absence of compound B. If gene R is mutated so it's nonfunctional, the enzymes are synthesized in the presence and in the absence of compound B. 1. Does gene R produce a regulatory protein that exhibits positive or negative control? 2. Is the operon inducible or repressible? Why?

1. gene R likely codes for a repressor protein that requires compound B as a corepressor 2. it is repressible because wild type transcription is repressed in the presence of compound B

Match the type of chromatin modification with the most likely effect on gene expression near the modified region. 1. Histone acetylation 2. Histone methylation 3. CpG methylation

1. increased expression 2. may increase or decrease 3. decreased expression

A mutation at the operator site of an operon prevents the repressor from binding. 1. What effect will this mutation have on transcription in a repressible operon? 2. What effect will this mutation have on transcription in an inducible operon?

1. the operon will always be transcriptionally active 2. the operon will always be transcriptionally active

In a population of 300 with these genotype frequencies, how many are heterozygotes? fAA = 0.2 fAB = 0.4 fBB = 0.4

120

Which of the following is NOT a type of pre-mRNA processing in eukaryotes? -5' cap addition -splicing -3' mRNA degradation -polyadenylation -RNA editing

3' mRNA degradation

If 91% of a population of monsters in HWE is purple-scaled, what percentage is heterozygous? Scale color: PP = purple Pp = purple pp = blue

42%

In a population of 100 geese that is in HWE, 64 are blue (dominant) and 36 are white (recessive). How many of the blue geese are carriers of the b allele?

48

In a species of irises petal color is controlled by a single locus with two alleles, and red petal color is dominant to white petal color. If there are 245 white petaled irises in a population of 2,000 that is in Hardy-Weinberg equilibrium, how many of the red petaled irises are heterozygous?

910

nonsynonymous mutation

A mutation in a gene that changes the amino acid sequence of the protein that gene encodes.

synonymous (silent) mutation

A mutation resulting in a codon that does not alter the corresponding amino acid in the polypeptide.

nonsense mutation

A mutation that changes an amino acid codon to one of the three stop codons, resulting in a shorter and usually nonfunctional protein.

For the codon AAA, which codes for the amino acid lysine, which mutation would NOT result in a different amino acid being added during translation?

AAA -> AAG

Why are recessive traits more frequently expressed in the offspring of matings between relatives?

Inbreeding leads to an increase in homozygosity because relatives are more likely to carry and pass on the same alleles

Which of the following statements is true? -Inducers can bind to corepressors -Inducers can bind to all three of the options -Inducers can bind to two of the three options -Inducers can bind to repressors -Inducers can bind to activators

Inducers can bind to two of the three options (repressor and activators)

Which of these is a cis-acting regulatory sequence/protein? -LacP -Lacl -LacY -LacZ

LacP

Which nonfunctional products would be expressed only in the presence of lactose in this partial diploid? lacI+ lacOc lacZ- lacY+ / lacI- lacO+ lacZ+ lacY-

LacY-

Which functional products would be expressed only in the presence of lactose in this partial diploid?lacI+ lacOc lacZ- lacY+ / lacI- lacO+ lacZ+ lacY-

LacZ+

A portion of a bacterial double-stranded DNA molecule is: 3' TTTAATAAGTCGTACGTATGGCGCATTTC 5' 5' AAATTATTCAGCATGCATACCGCGTAAAG 3' If the top strand is the template and the first base is the transcription start site, what polypeptide would be translated from that mRNA transcript?

MET-HIS-THR-ALA

Which is true of a negative inducible system? -The regulator protein is bound to the operator when the inducer is present -There is no operator sequence -Transcription increases when the regulator protein binds to the operator -Transcription increases when the inducer binds to the repressor

Transcription increases when the inducer binds to the repressor

Which is true of a positive inducible system? -The regulator protein is a repressor -Transcription decreases in the presence of the corepressor -Transcription increases when the regulator protein binds to the operon

Transcription increases when the regulator protein binds to the operon

Which of the following is a nonsense mutation? UGU ➞ UGG UGU ➞ UGC UGU ➞ UGA

UGU-> UGA

Which of the following is a synonymous mutation? UGU-> UGA UGU-> UGC UGU-> UGG

UGU-> UGC

Which of the following is a nonsynonymous mutation? UGU ➞ UGG UGU ➞ UGC UGU ➞ UGA

UGU-> UGG

What is UASg?

an enhancer

A population is found to have lower than expected heterozygosity at four loci, while all other loci studied appear to be in HW equilibrium. Which phenomenon most likely explains this?

assortative mating

A trans-acting sequence/protein is one that:

can affect genes on chromosomes other than its own

DNA methylation most commonly occurs on which base?

cytosine

What is degeneracy?

different mRNA codons can result in the same AA

In New Mexico, large expanses of black lava create patches of unique habitat. If, in every generation, selection favors the darkest colored pocket mice in those habitats because they are best hidden from predators, this would be an example of:

directional selection

Black-bellied seedcrackers are a species of bird found in central Africa. They live in various habitats where individuals eat either hard, large seeds or small soft seeds. Individuals with thick, shorter beaks can eat the harder seeds. Individuals with thin, longer beaks can eat softer seeds. Individuals with beaks of intermediate thickness and length cannot really eat either type of seed very well. If you measured beak width and length in populations of black-bellied seedcrackers what type of selection would you expect to find?

disruptive/ diversifying selection

A change in gene expression due to DNA methylation or chromatin modification is an example of:

epigenetic regulation

A polypeptide consists of the amino acids met-trp-tyr-arg-gly. A single point mutation occurs, resulting in the polypeptide met-cys. What type of mutation could this be?

frameshift

In a protein-coding region of DNA, the insertion of a single base pair is a:

frameshift mutation

Histone methylation tends to ____ gene expression, and histone acetylation tends to ____ gene expression.

increase or decrease; increase

Ethidium bromide, which is often used in the lab to stain DNA, is an example of what type of chemical mutagen?

intercalating agent

Chromosomal inversions and translocations are most likely to be caused by what type of mutagen?

ionizing radiation

What is the role of aminoacyl-tRNA synthesis?

it catalyzes tRNA charging reactions

How does histone acetylation act to modify gene expression?

it decreases the positive charge of histone tails, causing them to not bind DNA as tightly

What is the role of the Shine-Dalgarno sequence?

it facilitates ribosomal recognition of mRNA molecules in prokaryotes

Which of the following statements about genetic drift is true?

it leads to a loss of genetic variability

What is the role of peptidyl transferase?

it moves the growing polypeptide chain from the P site to the A site of the ribosome during translation

Which products (functional or nonfunctional) would be expressed regardless of whether lactose present in this partial diploid? lacI+ lacOc lacZ- lacY+ / lacI- lacO+ lacZ+ lacY-

lacZ- and lacY+

Which allele is dominant, lacl+ or lacl^s

lacl^s

The lactose (lac) operon if of which type?

negative inducible

Transcription is up-regulated when a molecule binds to the regulatory protein, causing it to leave the operator. What type of operon is this?

negative inducible

The trp operon is of which type?

negative repressible

Is it possible for an activator protein to be involved in a negatively regulated operon?

no

Is this population in Hardy-Weinberg equilibrium? AA 40% AB 30% BB 30%

no

If genotypes A1A1, A1A2, and A2A2 have average survival rates of 0.4, 0.8, and 0.6 respectively, this is an example of what pattern of selection?

overdominance

Transcription is up-regulated when a molecule binds to the regulatory protein, causing it to bind to the operator. What type of operon is this?

positive inducible

Transcription is down-regulated when a molecule binds to the regulatory protein, causing it to leave the operator. What type of operon is this?

postitive repressible

Which of the following is NOT a difference between eukaryotic and bacterial expression regulation?

regulatory proteins

Which part of the amino acid differs among different types of amino acids?

the radical (R) group

Which of the following is NOT part of the operon? -the operator -the regulator gene -the promoter -the structural genes

the regulator gene

What is wobble?

the same tRNA can match multiple different mRNA codons

Which of the following is true about response elements? -their function is similar to operons in terms of coordinating the expression of multiple related genes -individual genes typically only have a single associated response element -they play a role in RNA alternative splicing

their function is similar to operons in terms of coordinating the expression of multiple related genes

What does it mean to say that an allele is "fixed" in the population?

there is no genetic variation at that locus in the population

What do the following have in common?Enhancers, Insulators, Operators, Promoters, Response Elements, Silencers

they are all cis-acting

How do response elements work to regulate transcription?

they are binding sites for transcriptional activators in response to stimuli

Which of the following mutations are transversions? Select all that apply. -cytosine to thymine -adenine to guanine -uracil to thymine -thymine to adenine -thymine to cytosine -guanine to uracil

thymine to adenine guanine to uracil

Do errors during replication most often lead to transitions or transversions?

transitions

Is it possible for a corepressor molecule to be involved in a positively regulated operon?

yes