genetics hw ch 21

What three molecular mechanisms alter chromatin structure and are responsible for many epigenetic phenotypes?

(1) changes in DNA methylation; (2) chemical modifications of histone proteins (3) RNA molecules that affect chromatin structure and gene expression.

What is the major form of DNA methylation that is seen in eukaryotes? At what type of DNA sequence is DNA methylation usually found?

5-methylcytosine. In eukaryotes DNA methylation is often seen at CpG dinucleotides. in plants, DNA methylation is also frequently seen at CpNpG trinucleotides.

What evidence suggests that differences in monozygotic twins may be caused by epigenetic effects?

A study by Mario Fraga and his colleagues at the Spanish National Cancer Center looked at 80 monozygotic twins. DNA methylation patterns and histone acetylation patterns were more similar in younger twins than in older twins. These patterns for older twins had significant differences that affected gene expression. This altered gene expression could explain differences between the twins.

A cross between the F1 individual in Figure 21.6 and a plant with genotype B-I B-I will produce progeny with what phenotype?

All progeny will be lightly pigmented. The cross will produce progeny with genotype B-I B′ but, through paramutation, the B′ allele will convert the B-I allele to B′*. The resulting offspring will be B′ B′* and have a lightly pigmented phenotype.

The use of embryonic stem cells has been proposed for replacing cells that are destroyed by disease or injury. Because of ethical concerns about creating and destroying embryos to produced embryonic stem cells, researchers have attempted to create induced pluripotent cells (iPSCs). In this chapter we discussed studies showing that iPSCs retain some epigenetic marks of the differentiated adult cells from which they were derived. What implications might this research have for attempts to use iPSCs to regrow cells and tissue?

Although the iPSCs have characteristics of embryonic stem cells, the retention of epigenetic marks of differentiated adult cells from which they derived could result in differences in gene expression when compared to cell lines generated from true embryonic stem cells. Potentially, the epigenetic memory in cell lines and tissues produce from iPSCs could result in altered gene expression and the display of characteristics from the cell types from which the iPSCS were induced. Additionally, the epigenetic marks could result in regrown cells and tissues that are not fully functional or have functions not associated with the regrown tissue type.

Based on the information from studies of the long-term effects of diet on metabolism in mice, what might the epigenetic effects be on the children and grandchildren of people from who were exposed to famine as children? Include in your answer the types of epigenetic changes to chromatin you might expect to see and the phenotypic effects on lipid and cholesterol metabolism.

Based on the rodent studies, we might expect to see differences in DNA methylation and acetylation in the children and grandchildren compared to people whose ancestors were not exposed to famine. We might also expect that there would be an increase in the expression of genes involved in lipid and cholesterol metabolism, as well as a decrease in the levels of cholesterol. Although humans do not always respond in the same way as rodents, this would be our predicted effect in the absence of actual studies on humans.

In recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed (see Chapter 22). Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an egg cell only a small percent of the resulting embryos complete development and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred into an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science 293:1095-1098). Propose a possible reason for why successful development of cloned embryos is higher when the nucleus transferred comes from an undifferentiated embryonic stem cell.

During the process of development of a somatic cell, many genes that are not necessary for a particular cell type become silenced. Epigenetic changes to chromatin are often responsible for this type of gene silencing and thus numerous epigenetic changes have occurred in the nuclear material from a differentiated somatic cell. These changes may silence genes that are necessary for successful development of all cell types in a developing embryo. The most likely explanation for failure of embryos created by nuclear transfer is the inability to "reprogram" epigenetic changes that occurred as the somatic cell developed. In contrast, nuclear material from undifferentiated embryonic stem cells has undergone less epigenetic reprogramming, allowing all genes to be activated when they are needed in development.

What would be required to prove that a phenotype is caused by an epigenetic change?

Epigenetic effects are traits that are heritable in the sense that they are passed on to other cells or across generations. So, a first step would be to show that the phenotype was stable across cell divisions or generations. To rule out direct environmental effects, it would be important to make sure that the environments of individuals with and without the trait were the same. A second step would be to show that the phenotype is not the result of differences at the nucleotide sequence level. This would require isolating the gene associated with the phenotype and demonstrating that its DNA sequence was the same in individuals who have the phenotype and individuals who do not have it. A third step would be to find differences in chromatin structure or DNA methylation in individuals with and without the phenotype. A final step might be to alter the chromatin or DNA structure experimentally and show that this alteration results in the appearance of the phenotype.

What evidence suggests that cognition in mice is influenced by epigenetic changes?

Evidence indicates that mouse offspring who receive more licking and grooming behavior from their mothers have lower hormonal responses to stress and less fearful behavior than mice who experience less grooming behavior from their mothers. Additionally, mice who receive more grooming behavior from their mothers display differences in DNA methylation patterns when compared to mice who received less licking and grooming. These different methylation patterns result in differences in acetylation patterns for histone proteins between the mouse offspring. When a deacetylase inhibitor that prevents removal of acetyl groups from histone proteins is injected into the brains of young mice, the changes in DNA methylation and histone acetylation patterns associated with increased licking and grooming are blocked. The mice that received the deacetylase inhibitor also demonstrated similar fear and stress responses to those mice who did not receive as much licking and grooming behavior from their mothers.

What are induced pluripotent stem cells? How are they derived from adult somatic cells?

Induced pluripotent stems result when adult somatic stems cells are induced to dedifferentiate and revert to stem cells. Induced pluripotent stem cells are generated by treating cultured fibroblast cells with a cocktail of transcription factors that cause extensive epigenetic reprogramming to the treated cells including changes in methylation patterns and histone modifications.

Briefly explain how patterns of DNA methylation are transmitted across cell division.

Methyltransferase enzymes recognize the hemimethylated state of CpG dinucleotides following replication and add methyl groups to the unmethylated cytosines, resulting in two new DNA molecules that are fully methylated.

What types of histone modifications are responsible for epigenetic phenotypes?

Modifications of histone proteins especially in the positively charged tail are responsible for many epigenetic changes. The histone modifications include covalent modifications such as the addition or removal of chemical groups such as acetyl groups, methyl groups, phosphates, and ubiquitin to the positively charged tail. These modifications can change chromatin structure thus altering gene expression. Additionally, some modifications may change gene expression through their effect on the recruitment of transcription factors.

Much of DNA methylation in eukaryotes occurs at CpG dinucleotides, but some individual cytosine nucleotides are also methylated to form 5-methylcytosine. Considering what you know about the process by which DNA methylation at CpG dinucleotides is maintained across cell division, do you think that methylation at individual C nucleotides would also be maintained by the same process? Explain your reasoning.

No. At CpG dinucleotides, two cytosine nucleotides site diagonally across from each other on both DNA strands and both are methylated. The presence of 5- methylcytosine on both strands is required for maintaining methylation after replication. Following replication, one strand of each new DNA molecule is methylated and one is not. Special methyltransferase enzymes recognize the methyl group on one strand and methylate the cytosine on the other strand, perpetuating the methylated state of the DNA. Individual cytosine nucleotides will not have a cytosine nucleotide on the opposite strand that can be methylated following replication. Therefore, no new methyl groups will be added by the methyltransferases after replication.

Give an example of an epigenetic effect of diet on metabolism.

Nutritional-based epidemiology studies in mice indicate that male mice fed a low- protein diet produced offspring that had increased expression of genes associated with lipid and cholesterol metabolism when compared to a control mice offspring group that had male parents fed a normal diet. In both the experimental and control groups the male parents were separated from the females after mating and had no exposure to their offspring. Additionally, different methylation patterns were seen in the offspring from the different male parents. A second experiment using male rats fed a high fat diet indicated that their daughters had increased incidences of type II diabetes when compared to a control group of female offspring who had male parents fed a normal diet. In the experimental female offspring group, expression of 642 genes linked to glucose tolerance and insulin secretion were altered when compared to the control group.

Briefly describe paramutation at the Kit locus in mice. What evidence suggests that small RNA molecules play a role in this phenomenon?

The Kit locus codes for a tyrosine kinase receptor, which has functions in pigment production along with growth and development. Mice homozygous for the wild-type Kit allele (Kit+) have a solid coat color. Mice heterozygous for the wild-type allele and the mutant allele (Kitt) have white feet and white tail tips. In classical Mendelian inheritance, crosses between homozygous Kit+ Kit+ mice and the heterozygous Kit+ Kitt mice would be expected to produce 1:1 phenotype ratio of wild-type to mutant. However, in the offspring many of the Kit+ Kit+ mice also have white feet and white tail tips. The presence of Kitt allele in the parent altered the phenotype of the Kit+ allele so that it now has the same phenotype as the Kitt allele. The altered Kit+ is referred to as Kit*. The Kitt allele has a paramutation effect on the Kit+ allele. The injection of miRNAs that specifically degrade Kit mRNAs into Kit+ Kitt mice embryos result in an increase in mice with white feet and white tail tips. When nonspecific miRNA molecules are injected into Kit+ Kit+ embryos no increase in the frequency of white feet and white tail tips is observed. This data suggest that miRNA molecules could be responsible for this paramutation.

Briefly describe the molecular processes that cause one X chromosome in each female cell to be active and the other X chromosome to become inactivated.

The X-inactivation center, a 100,000 to 500,000 bp region within the X chromosome, contains genes that can initiate X chromosome inactivation and other genes that maintain X chromosome activation. Within the X-inactivation center, the Xist gene codes for a long noncoding RNA (lncRNA) that coats the X chromosome. The IncRNA attracts the polycomb repressor complex 2 (PRC2) and subsequently the polycomb repressor complex 1 (PRC1) to the coated X chromosome. The presence of PRC2 and PRC1 on the X chromosome results in histone methylation and additional methylation of CpG DNA sequences that repress gene expression on the inactivated X chromosome. The lncRNA transcribed from the Jpx gene stimulates express of the Xisc gene lncRNA on the inactivated X chromosome therefore promoting X chromosome inactivation. There are additional lncRNAs produced within the X-inactivation region associated with maintaining activation of the X chromosome. On the activated X chromosome the Tist gene produces a lncRNA that is complementary and antisense to the Xist gene. Expression of the Tist gene lncRNA results in the repression of the Xist gene. The lncRNA produced from the Xite gene stimulates expression of the Tist gene lncRNA. Ultimately, the expression of the Tist lncRNA represses the expression of the Xist lncRNA keeping the X chromosome active.

How does DNA methylation repress transcription?

The methyl group sits within the major groove of the DNA and may inhibit the binding of transcription factors and other proteins required for transcription to occur attracts proteins that directly repress transcription. attracts histone deacteylase enzymes, which remove acetyl group histone proteins, altering the chromatin structure that represses transcription.

How do epigenetic traits differ from traditional genetic traits, such as the differences in color and shape of peas that Mendel studied?

The phenotypic differences in traditional genetic traits such as the color and shape of peas that Mendel studied are due to differences in the DNA base sequences within the alleles. In epigenetics, the phenotypic differences are not due to changes in allele DNA base sequences, but are differences in the expression of genes that are passed on to other cells and sometimes to other generations.

What would be the effect of deleting the Dnmt3 gene in honeybees?

The silencing of the Dnmt3 gene expression results in the development of queen bees. If the Dnmt3 was deleted in honeybees, it would likely result in all female bees developing reproductive organs and becoming queen bees because the methylating enzyme could not be produced.

Which honeybee in Figure 21.4 (the worker or the queen) will have more copies of 5-methylcytosine in its DNA? Explain your answer

The worker bees will have more copies of 5-methylcytosine in its DNA. Queen bees have been fed royal jelly, which silences the expression of the Dnmt3 gene. The normal function of the Dnmt3 gene product is to add methyl groups to DNA. Because the queen bees lack expression of the Dnmt3 gene, their DNA will be less methylated. Worker bees however express the Dnmt3 gene resulting in more methylation.

A DNA fragment with the following base sequence has some cytosine bases that are methylated (indicated by C*) and others that are unmethylated. To determine the location of methylated and unmethylated cytosines, researchers sequenced this fragment both with and without treatment with sodium bisulfite. Give the sequence of bases that will be read with and without bisulfite treatment. —ATCGC*GTTAC*GTTGC*GTCA—

Treatment of a DNA molecule with sodium bisulfite results in the chemical conversion of cytosine to uracil, which is detected as thymine during DNA sequencing. However, cytosines that are methylated are unaffected by the sodium bisulfite treatment and will be detected as cytosine during DNA sequencing. With treatment: —ATTGCGTTACGTTGCGTTA— Without treatment: —ATCGCGTTACGTTGCGTCA—

A scientist does an experiment in which she removes the offspring of rats from their mother at birth and has her genetics students feed and rear the offspring. Assuming that the students do not lick and groom the baby rats as the mother rats normally do, what long-term behavioral and epigenetic effects would you expect to see in the rats when they grow up?

We would also expect that the adults would show increased fear and heightened hormonal response to stress. We would expect to see differences in DNA methylation and histone acetylation that altered expression of genes involved in response to stress.

How is X inactivation an epigenetic phenotype?

X inactivation in female mammals occurs when one X chromosome in each cell is randomly inactivated turning off much of the gene expression of the inactivated chromosome. The change in gene expression due to the inactivated X chromosome in one cell can be passed along stably to other cells that are produced from the original cell where X inactivation occurred, which is an epigenetic effect.

What would be the effect on X inactivation of adding siRNAs that eliminated the products of each of the following genes? a. Xist b. Jpx

a. Both X chromosomes would be active. b. Both X chromosomes would be active.

The introduction to this chapter describes the long-term effects of famine on people conceived during the Dutch Hunger Winter. a. What evidence is there to suggest that these are epigenetic effects? b. What additional evidence would help to demonstrate that these changes are due to epigenetic changes?

a. Comparison of methylation patterns at 15 loci associated with growth and metabolic disease between siblings prenatally exposed to the famine and those siblings who were not prenatally exposed demonstrated that six loci had different patterns of methylation for the children born during the famine. These differences in methylation patterns suggest that an epigenetic effect could have caused the noted phenotype. The changed methylation patterns could result in differences in gene expression patterns at these loci as well as differences in phenotypes between the siblings born at these different times. b. Additional genetic comparisons between individuals whose ancestors were exposed to famine conditions with those individuals who ancestors were not exposed to food shortages including siblings born after the food shortage would be useful. Differences in DNA methylation and histone acetylation patterns between these groups of individuals would be evidence supportive of epigenetic changes. Differences in gene expression patterns for certain metabolic genes between these groups would be additional evidence. DNA sequencing of genes associated with cardiovascular health and diabetes would potentially help to demonstrate if any differences are linked to nucleotide sequence differences as opposed to epigenetic changes.

What is paramutation? What are the key features of this phenomenon?

an inhertible change in the expression of one allele that is the result of an interaction of this allele with a second allele for the same trait. can be passed to subsequent generations even if the original allele that created the effect is no longer present. the altered allele can convert other alleles to the new phenotype. the altered phenotype is not due to a change in the DNA sequence of a converted allele.

What are the important characteristics of an epigenetic trait?

stable and passed on to cells or offspring but does not involve changes to the DNA base sequence. Many are caused by changes in gene expression resulting from modifications to chromatin. many can be influenced by environmental factors.

What is the epigenome?

the overall nature and types of chromatin modifications possessed by an organism.

Define genomic imprinting.

the sex of the parent that contributed the allele to the offspring determines if the expression of the transmitted allele occurs within the offspring.

A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the presence of methylated cytosines.Sequence without treatment: —AATTGCCCGATCGATTAAGCCA— Sequence with treatment: —AATTGTTTGATCGATTAAGCTA—

—AATTGCCCGATC*GATTAAGC*CA— (Asterisks indicate the presence of methylated cytosines.)