Intro to Cell- Final Exam w/Coach Moon

Imagine a beaker with solutions separated by a planar membrane (like what is shown in Figure 6.12, step 3). Predict what will happen after addition of a new solute to the solution on the left side, if the new solute (1) crosses the membrane readily or (2) is incapable of crossing the membrane.

(1) The new solute will diffuse from left to right to establish equilibrium. (2) The water level on the right will fall.

If a DNA double helix contains 28% T nucleotides, then what is the percentage of A nucleotides?

28%

Exam 3

3

A DNA template strand has the following base sequence. 5' TTACACGTGGACTGAGGACCTCTCCAT 3' Answer the following: What is the complementary strand of this template? (label the ends) Input your answer by labeling the end with the prime number followed by a space and the the nucleotide letters suquentially (no spaces) and finally at the end of the base sequence, insert a space followed by the prime number for the end. For example if the answer was as follows use this format: 5' AAAGCATTAGCC 3'

3' AATGTGCACCTGACTCCTGGAGAGGTA 5'

What would be the expected frequency of agouti brown offspring in the litter?

3/16

Different ratios occur in crosses with single gene pairs or two gene pairs. What types of ratios are likely to occur in crosses dealing with a single gene pair?

3:1, 1:1, 1:2:1

Exam 4

4

Exam 5

5

Glucose (C6H12O6) has a single carbonyl group (C=O) in its linear form. Based on the number of oxygen atoms in glucose, how many hydroxyl groups (OH) would you expect glucose to have?

5

A DNA template strand has the following base sequence same as above repeated for convenience. 5' TTACACGTGGACTGAGGACCTCTCCAT 3' Write the mRNA in the same direction that it would be produced by the RNA pol enzyme and label the ends using the same format as in Part A above.

5' AUGGAGAGGUCCUCAGUCCACGUGUAA 3'

If one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', the other complementary strand would have the sequence _____.

5'TGCAAT3'

What proportion of chromosomes in a human skin cell are paternal chromosomes?

50%

Indentify the diploid (2n) number for cells of this organism.

8

For the oxidation of pyruvate shown in Figure 9.9, which answer correctly identifies molecules involved in the positive (+) and negative (−) control of this reaction?

+: NAD+, CoA, and AMP; −: Acetyl CoA, NADH, and ATP

Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus?

-A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA. -Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes. -A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA.

Based on what you have learned about how cells ensure that proteins end up in the right place (Chapter 7), what type of signal would you expect to be exposed on a cytosolic receptor after a steroid hormone changes the receptor's conformation?

Amino acids required for transport through the nuclear pore complex

Which answer best explains why aerobic respiration produces more ATP per mole of glucose than either anaerobic respiration or fermentation?

Among known electron ACCEPTORS, O2 is MOST electronegative.

Which answer correctly associates a phase of mitosis with what happens to chromosomes during that phase?

Anaphase: Sister chromatids separate.

The molecular formula for glucose is C6H12O6. What would be the molecular formula for a molecule made by linking three glucose molecules together by dehydration reactions?

C18 H32 O16

The molecular formula for glucose is C6H12O6. What would be the molecular formula for a polymer made by linking 10 glucose molecules together by dehydration reactions?

C60H102O51

Which of the listed statements describes the results of the following reaction? C6H12O6 + 6 O2 → 6 CO2 + 6 H2O + Energy

C6H12O6 is oxidized and O2 is reduced.

Which statement is correct concerning the relationship between chromosomes and either genes, chromatin, or sister chromatids?

Each replicated chromosome consists of two sister chromatids.

Which of the regulatory sequences above would be bound by transcription factors that would result in the production of uniquely different proteins in liver cell compared to muscle cells?

Enhancer

Which of the following statements is a logical consequence of the second law of thermodynamics?

Every chemical reaction must increase the total entropy of the universe.

The red blood cell liposomes are more hypotonic relative to water than the frog egg liposomes.

False, because the interior solution in both sets of liposomes is the same.

Which statement best explains the effect on membrane permeability of cholesterol and/or temperature?

Adding cholesterol reduces permeability because its steroid rings fill gaps in the hydrophobic membrane interior.

Which of the following results provided evidence of a nuclear localization signal in the nucleoplasmin protein?

After cleavage of the protein, only the tail segments appeared in the nucleus.

Which answer correctly identifies a cell-cycle checkpoint with a criterion for passing it?

G2 checkpoint: Chromosomes have replicated successfully.

Glucose is taken up into cells through a carrier (transport) protein called a _________ transporter Type the correct term to fill the blank (use all capital letters for the acronym for this transporter).

GLUT

Which statement best predicts the results of the cross MmDdPp x mmddpp assuming that all three genes are linked?

All eight possible phenotypes could occur, but a greater proportion of the offspring would have the parental phenotypes.

Which statement is FALSE concerning gametes produced by meiosis?

Gametes contain nonrandom combinations of maternal and paternal chromosomes.

The Golgi apparatus has a polarity, or sidedness, to its structure and function. Which of the following statements correctly describes this polarity?

All of the listed responses correctly describe polarity characteristics of the Golgi function.

Suppose that an induced mutation removes most of the 5' end of the 5' UTR of an mRNA. What is most likely to happen?

Removal of the 5' UTR also removes the 5' cap and the mRNA will quickly degrade.

Which of the following is a protein produced by a regulatory gene?

Repressor

Which event makes meiosis a reductional division and why?

Separation of homologs in meiosis I, because it produces 2 haploid (n) daughter cells from a single diploid (2n) parent cell

For the experiment shown in Figure 12.6, which answer best describes what the prediction would be if chromosome movement were based on microtubule shortening at the spindle pole?

The darkened section will move toward the spindle pole but the distance between chromosomes and the darkened section will remain constant.

Which of the following statements correctly describe(s) the driving forces for diffusion of Na+ and K+ ions through their respective channels? Select all that apply.

The diffusion of Na+ ions into the cell is facilitated by the electrical gradient across the plasma membrane. The diffusion of K+ ions out of the cell is facilitated by the K+ concentration gradient across the plasma membrane. The diffusion of K+ ions out of the cell is impeded by the electrical gradient across the plasma membrane.

Of the three modes of gene regulation shown in Figure 18.1, which is the most efficient in resource use?

Transcriptional control

The red blood cell liposomes contain more aquaporins than the frog egg liposomes.

True, because aquaporins allow for an increased rate of water transport.

The frog egg liposomes contain ion channels, which are not present in the red blood cell liposomes.

True, because if the Na or Cl ions can cross the membrane in frog eggs, then osmosis may be reduced or even be prevented from occurring.

Starting at the 5' end, what is the base sequence of the RNA strand shown in Figure 4.3?

UAGC

Use the 3 letter code for the amino acid

Val

When is the overall free energy change ΔG in a reaction most likely to be negative (meaning that the reaction is exergonic)?

When products have lower potential energy and higher entropy than reactants

Based on Bob and Eleanor's family history, what inheritance pattern does the skin condition most likely follow?

X-linked dominant

How can genetic principles help advise prospective parents? A boy is terminally ill with a rare genetic disorder called adrenoleukodystrophy (ALD). ALD is caused by a mutation that leads to progressive brain damage, failure of the adrenal glands, and eventual death. A pedigree of a family with ALD follows. Given the pedigree, what is the most likely mode of transmission of ALD?

X-linked recessive

There is a mutation in the repressor that results in a molecule known as a super-repressor because it represses the lac operon permanently. Which of these would characterize such a mutant?

It cannot bind to the inducer.

Which statement best explains why a relatively small difference in the location of a carbonyl or hydroxyl group can lead to dramatic changes in the properties and function of a monosaccharide?

It changes the SHAPE of the monosaccharide.

Suppose a cell is placed in a solution with a high concentration of potassium and no sodium. How would the cellular sodium-potassium pump function in this environment?

It would continue using ATP to pump sodium out of the cell and potassium into the cell.

A new mutant has been discovered such that electrons from NADH are not passed to FMN but rather to Cyt b directly. What effect would this change have on the relative magnitude of the electrochemical proton gradient across the inner mitochondrial membrane.

It would reduce the gradient

The R-group, or side chain, of the amino acid serine is -CH2-OH. The R-group, or side chain of the amino acid leucine is -CH2-CH-(CH3)2. Where would you expect to find these amino acids in a globular protein in an aqueous solution?

LEUCINE would be in the interior, and serine would be on the exterior of the globular protein.

Describe, on a molecular level, how you would expect these lipids to behave in water.

Lipids would float on the surface of the water, or collect in droplets suspended in water, reducing their interaction with water to a minimum.

What would happen if the kinase that adds the inhibitory phosphate to Cdk were defective?

M phase would begin prematurely.

Use the three letter codes and separate each with a dash. For example Met-Ser-Try-Phe (no commas or spaces).

Met-Glu-Arg-Ser-Ser-Val-His-Val

Can an enzyme make a nonspontaneous reaction occur spontaneously? Why or why not?

No, because enzymes do not affect the overall ΔG of a reaction.

Cooking oil lipids consist of long, unsaturated hydrocarbon chains. Would you expect these molecules to form membranes spontaneously? Why or why not?

No, because they have no polar end to interact with water.

Does this mean that his hypotheses are incorrect?

No, it just means that his hypotheses are limited to certain conditions.

For eukaryotic cells, which answer best describes the function of the indicated component?

Peroxisome: detox center

Which statement is most accurate concerning how the molecular composition of a plant cell wall compares with the ECM of animal cells?

Plant cell wall fibers consist primarily of carbohydrates; ECM fibers are dominated by proteins.

Which statement best summarizes a key difference in the structure of polysaccharides that function in energy storage versus those used in structural support?

Polysaccharides that function in energy storage are built from α glycosidic linkages, whereas polysaccharides used in structural support form STRAIGHT chains that bond with ADJACENT chains.

Of the three modes of gene regulation shown in Figure 18.1, which is the fastest in response time?

Post-transcriptional control

For the experiment shown in Figure 11.9, which answer correctly states the prediction of the "hypothesis" or "null hypothesis"?

Prediction of hypothesis: Antibodies to some membrane proteins will block cell-cell adhesion.

Four students were asked to draw a simple model of a nucleotide using the following color code. Sugar = red Phosphate group = yellow Nitrogenous base = blue Which model is correct?

Zubia

Which of the following secondary mutations might restore normal regulation to the lac operon in a lacOc mutant?

a LACI mutation that produces a repressor than can recognize the mutated lacOc DNA sequence

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

a frameshift deletion at the beginning of the gene

Using what you have learned about changes in free energy, would you predict the ΔG value of catabolic reactions to be positive or negative?

a negative ΔG based on a decrease in enthalpy and increase in entropy

Which of the following descriptions best fits the class of molecules known as nucleotides?

a nitrogenous base, a phosphate group, and a sugar

What about anabolic reactions?

a positive ΔG based on an increase in enthalpy and decrease in entropy

Allosteric regulation occurs when ______.

a regulatory molecule binds to a protein to change its shape and activity

Which of the following nucleotide triplets best represents a codon?

a triplet in the same reading frame as an upstream AUG

Enzymes speed up chemical reactions by ____.

decreasing the activation energy

Identify three possible components of a DNA nucleotide.

deoxyribose, phosphate group, thymine

The dominant allele ____.

determines the phenotype in a heterozygote

Lysosomes that lack mannose-6-phosphate receptors _____.

do not receive enzyme shipments from the Golgi apparatus

Oxidation and reduction reactions are chemical processes that result in a gain or loss in _______________

electrons

Which of the following characteristics determines when the refractory period ends?

how long it takes for the voltage-gated Na+ channels to REACTIVATE at the end of an action potential

Humans can digest starch but not cellulose because _____.

humans have enzymes that can hydrolyze the α-glycosidic linkages of starch but not the β-glycosidic linkages of cellulose

In a DNA double helix, what kind of chemical bonds form between the complementary nitrogenous bases?

hydrogen bonds

The condensation reaction that forms nucleic acid polymers occurs between a _____ group on the 3' carbon of one nucleotide and a 5' _____ group on a second nucleotide.

hydroxyl, phosphate

The statement, "It is a matter of chance which homolog goes to which daughter cell" best describes _____.

independent assortment

The induced-fit model

involves a conformational change in the shape of the enzyme.

Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the repressor gene (lacI), along with its promoter, to a position at some several thousand base pairs away from its normal position, we would expect the _____.

lac operon will function normally

Galactosemia is a potentially fatal disease that occurs in humans who lack the enzyme that converts galactose to glucose. To treat this disease, physicians exclude the monosaccharide galactose from the diet. Which of the following would you also predict to be excluded from the diet?

lactose

Suppose that the botanist carried out the test cross described in Parts A and B and determined that the original green-pod plant was heterozygous (Gg). Which of Mendel's findings does her test cross illustrate?

law of segregation

How can genetic principles help advise prospective parents? A boy is terminally ill with a rare genetic disorder called adrenoleukodystrophy (ALD). ALD is caused by a mutation that leads to progressive brain damage, failure of the adrenal glands, and eventual death. A pedigree of a family with ALD follows. Which phrase describes the female in the first generation?

likely to be heterozygous

Which of the following contains hydrolytic enzymes?

lysosome

During which part of meiosis (meiosis I or meiosis II) do the two alleles of a gene separate? During which phase does the separation occur? State your answer as meiosis I or meiosis II followed by a comma and the name of the phase (for example, if your answer is meiosis II and metaphase, enter meiosis II, metaphase).

meiosis I, anaphase

During cellular respiration, acetyl CoA accumulates in which location?

mitochondrial matrix.

Sister chromatids separate from each other during _____.

mitosis and meiosis II

Decreasing the saturation of the fatty acid chains on a particular type of phospholipid would result in the formation of _____.

more fluid bilayers

Of the following four groups of amino acids - nonpolar, polar, charged/acidic, charged/basic - which would likely be found in the portion that crosses the lipid bilayer?

nonpolar amino acids

Based on these data, what is the most likely function of the cells in this experiment?

phagocytosis

A key enzyme in glycolysis, whose catalytic activity is controlled by feedback regulation is ____________________. This enzyme balances the need for energy with the production of ATP.

phosphofructokinase

ALD is caused by mutations in one gene. Given the symptoms of ALD, which of the following terms describes the disease-associated allele?

pleiotropic

In which mitotic phase do the chromosomes condense and does the mitotic spindle begin to form?

prophase

As two electrons are passed from FMN to Fe-S proteins, FMN becomes ______________, whereas Fe-S protein becomes __________.

re-oxidized......reduced

Which of the following occurs in meiosis but not in mitosis?

synapsis of chromosomes

In Drosophila the gene for eye color is located on ____.

the X chromosome

The lactose operon is likely to be transcribed when _____.

the cyclic AMP and lactose levels are both high within the cell

When an amino acid is specified by more than one codon, what is usually shared by the set of codons that specify this amino acid?

the first and second bases

What is an active site?

the location on an enzyme where substrates bind and react

What is the difference between an aldose sugar and a ketose sugar?

the position of the carbonyl group

What is/are the variable structure(s) of a nucleotide?

the sugar AND the base

What feature of single nucleotides provides the energy needed for polymerization when nucleic acids are formed?

their phosphate groups

Once within the lumen of the RER the CFTR protein begins to be modified by various enzymes, which is called post translational modification. The modification of the CFTR protein continuse thourgh the golgi stanks and once it is in its final form it will be loaded into sectretory vesicles that will take it to the outside plasma membrane. The loading into these vesicles at the _______ face of the golgi is controled by specific _____________ signals that bind to functional groups on receptor proteins in the vesicle.

trans; sugar

How many carbon atoms are fed into the Krebs (citric acid)cycle as a result of the oxidation of one molecule of pyruvate?

two

If the lipid bilayer were to contain the CFTR molecule, what would pass through the membrane if you added a 1 M solution of sodium chloride on the left side and a 1 M solution of potassium ions on the right? Assume that there is an equal amount of water on each side at the start of the experiment. Select all that apply.

water will initially move from the right to the left, then backward chloride ions

What are the consequences? Check all that apply.

β-1,4-glycosidic linkages more resist to degradation. β-1,4-glycosidic linkages are much more likely to form linear fibers and sheets.

The following formula was used to calculate the standard ΔG for a reaction in the direction written for the reaction described in Part A: ΔG = - RT ln Keq where R is the gas constant, T is temperature in kelvin and RT at 25C is 592. The ΔG for this reaction is +410 Kcal/mol, which means this is a highly non-spontaneous reaction. Since this reaction takes place continuously in cells, it obviously cannot be a equlibrium. Reactions such as this take place with cells because they maintain themselves in a metable state, where ther reactions are ____________. They accomplish this by ______________.

far from thermodynamic equilibrium; having a continuous input of energy from their surroundings

When ATP is hydrolyzed into ADP and inorganic phosphate, _____.

free energy is released

Immediately after Glucose enters the cell it is phosphorylated by the enzyme __________, which adds a phophate from ATP to Glucose to produce Glucose -6- phosphate and ______________. Enter the name of the enzyme followed by the second product separated with a comma. For example if the enzyme were catalase and the second product was FAD you would enter: catalase, FAD

hexokinase, ADP

Considering the standard reduction potential (SRP), which of the following molecules would be the strongest oxidizing agent?

cytochrome a3 (SRP +0.624 Volts)

The division of the cytoplasm following mitosis is called _____.

cytokinesis

Which of the following includes all of the pyrimidines found in RNA and DNA?

cytosine, uracil, and thymine (CUT)

What type of amino acid R group might you expect to find in the active site of an enzyme that digests proteins from the N-terminal end? Select all that apply.

-Aspartate -Glutamate

Cytokinesis in animal cells is accomplished by constriction of the cell along the plane of cell division (formation of a cleavage furrow). In plant cells, which have cell walls, a completely different mechanism of cytokinesis has evolved. Which of the following statements are true of cytokinesis in plant cells? Select the two that apply.

-Vesicles from the Golgi apparatus move along microtubules, coalesce at the plane of cell division, and form a cell plate. -The cell plate consists of the plasma membrane and cell wall that will eventually separate the two daughter cells.

Click the 3 choices that show complete dominance.

-gagb -gbgc -gbgd

Click the choice that shows overdominace.

-gagc

Click the 2 choices that show incomplete dominace.

-gagd -gcgd

Click the 3 choices that show codominace.

-gbgc -gagc -gagb

All proteins are synthesized by ribosomes in the cell. Some ribosomes float freely in the cytosol, while others are bound to the surface of the endoplasmic reticulum. Most proteins made by free ribosomes function in the cytosol. Proteins made by bound ribosomes either function within the endomembrane system or pass through it and are secreted from the cell. Which of the following proteins are synthesized by bound ribosomes? Select all that apply.

-insulin -lysosomal enzyme -ER protein

Identify the events in the cell cycle that must be completed successfully for daughter cells to share an identical complement of chromosomes.

-the spindle apparatus must connect with the kinetochores of each sister chromatid in prometaphase -all the chromosomes must be replicated during the S phase -the sister chromatids of each replicated chromosome must be partitioned in anaphase and fully separated into daughter cells by cytokinesis

Select each treatment description that accurately describes the funtioning of 'inside-out' vesicles. Choose all that apply.

-will become acidic inside then NADH is added. -will make ATP from ADP and Pi if transferred to a pH7 buffered solution after incubation in a pH4 buffered solution.

If you take the Agouti Brown mice from the dihybrid cross above in Part A and mate with Solid Brown mice, what would the the frequency of offspring that are: Solid Black: Agouti Black: Agouti Brown: Solid Brown? Enter your answer for each phenotype in this order: Solid Black: Agouti Black: Agouti Brown: Solid Brown! If there are no offspring in a phenotypic class from the cross enter 0, whereas if there are offspring enter the fraction. For example if there were no Solid Black offspring, one-half Agouti Black, one-frouth Agouti Brown, and one-fourth Brown you should enter your answer as: 0, 1/2, 1/4, 1/4 (spaces don't matter just the right fractions or 0 separated by a comma).

0, 0, 2/3, 1/3

Assume that you incubate a solution containing 0.3 M Glu-6-P overnight at 25C with the enzyme phosphoglucoisomerase that catalyzes the reaction above. How many millimoles of Fru-6-P would you recover from 10 mL of the incubation mixture the next morning?

1

Exam 1

1

How can genetic principles help advise prospective parents? A boy is terminally ill with a rare genetic disorder called adrenoleukodystrophy (ALD). ALD is caused by a mutation that leads to progressive brain damage, failure of the adrenal glands, and eventual death. A pedigree of a family with ALD follows. If the son with ALD in the third generation survives to have children with a woman without any history of ALD in her family, what is the chance that a newborn son of this couple will not develop ALD?

1

Which of the following student-drawn models shows the correct numbering of carbons?

1 starting in the 2 o'clock position and rotating clockwise, counting all 5 carbons in order

Exam 2

2

Complete the following sentences about enzyme function: Enzymes speed reaction rates by ______ and lowering activation energy. Activation energies drop because enzymes stabilize _______. Enzyme specificity is a function of the active site's shape and the chemical properties of _______ at the active site.

1. orienting substrates; 2. the transition state; 3. R-groups

An AaBbCCDdee offspring from the cross AaBbCCddEe X AaBbCcDdee, Enter the answer as a fraction expressed with the numerator followed by a forward slash and then the denominator. For example if the probablity was 0.5 you would enter 1/2

1/32

Albinism is an autosomal (not sex-linked) recessive trait. A man and woman are both of normal pigmentation, but both have one parent who is albino (without melanin pigmentation). What is the probability that their first child will be an albino?

1/4

If no crossing over occurs, what is the probability that a gamete will receive only paternal chromosomes?

1/8

Imagine that you are a genetic counselor working with the first daughter in the last generation of the pedigree shown. She is married to a man with no history of ALD in his family. The couple plans to have children and they want to know the chance of their first child having ALD. How will you advise them? In the blank below indicate if the probability ( 0 if no possibility, 1 if it is certain that the child will have ALD, or the fraction between 0 and 1 if there is some probability), then seperate your second answer with a comma and indicate where the child will be a daughter only, son only or either son or daughter. For example if the probability was 50% and it could be a male or female you would enter: 1/2, either.

1/8, son

You have just received lab work back from the blood lab and the report measures the amount of urea Nitrogen by the process of atomic absorption spectrophotometry. The value of urea nitrogen is reported to be 52 mg/dL Considering the stoichiometry of urea with 2 N atoms per molecule, and the knowledge that one mole of N weighs 14 grams, calculate the milliosmolarity that urea contributes to this patient's blood plasma.

18.6

Which statement is correct concerning the relationship between chromosomes and chromatids?

A replicated chromosome contains two sister chromatids.

Consider the two-step metabolic pathway: A—(enzyme 1)—>B—(enzyme 2)—>C How would inactivating enzyme 1 affect the concentrations of molecules A, B, and C relative to what they would be if the pathway were fully functional?

A would increase; B and C would decrease.

The most abundant protein found in the extracellular matrix of animal cells is _____.

collagen

When the ATP to ADP+AMP ratio is low (indicating low energy charge) the excess _________ binds to an _______________ site on the enzyme and the binding causes a overall shape change that alters the active site in such as way that enhances the binding of substrate. The effect of this regulation speeds the production of the oxidative metabolism during times when the cell has inadequate number of energy carrier molecules available to fuel the endogonic biochemical work of the cell. Fill in the blanks with the correct terms separated by a comma

ADP, allosteric

If this represents an exergonic reaction, identify which of the five substances would have the highest-energy electrons.

AH2

Which is true of the metabolic pathway shown here? enzyme 1 enzyme 2 enzyme 3 A ————————> B ————————> C ————————> D

B is the product of enzyme 1 and the substrate for enzyme 2.

Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the promoter for the lac operon to the region between the beta galactosidase (lacZ) gene and the permease (lacY) gene, which of the following would be likely?

Beta galactosidase will not be produced.

What evidence suggests that during anaphase, kinetochore microtubules shorten at the kinetochore?

Daughter chromosomes were observed to move toward the pole faster than do the marked regions of fluorescently labeled kinetochore microtubules.

How could the botanist best determine whether the genotype of the green-pod plant is homozygous or heterozygous?

Cross the green-pod plant with a yellow-pod plant.

Study the diagram above, which shows a cell in a phase of division. Four chromosomes in the form of sister chromatids are alliged across a plane of divison with spindle fibers connecting to the kinetochore proteins on each side of the centromere of each sister chromatid. Identify below the stage of division by name.

Metaphase II

Pyruvate Processing either by a fermentation reaction or by entry to the Krebs cycle and subsequent oxidative phosphorylation, is essential to prevent glycolysis from grinding to a halt. The key need for pyruvate processing is to regenrate ________________.

NAD+

Considering the standard reduction potential (SRP), which of the following molecules is storing the most energy?

NADH (SRP -0.322 Volts)

Considering the standard reduction potential (SRP), which of the following molecules would be the strongest reducing agent?

NADH (SRP -0.322 Volts)

What would happen to NADH levels in a cell in the first few seconds after a drug has poisoned the enzyme that converts acetyl CoA to citrate?

NADH levels would decrease.

Some disease-causing microbes attack the body by turning on or off specific signal transduction pathways. In the disease cholera, the bacterium Vibrio cholera causes massive diarrhea by interfering with such a pathway. A toxin from this bacterium enters intestinal cells and chemically modifies G proteins. Once modified, the G proteins can no longer cleave GTP into GDP, What would you expect to see with the intestinal cells of a person with cholera?

The G proteins remain activated and continually activate adenylyl cyclase.

Use the figure shown above of Lineweaver-Burk Plots of a mutant enzyme and a normal enzyme. Remember that when genes are mutated (change in DNA sequence), leading to changes in amino acids in the primary sturcture of the protein, this often leads to changes in the overall shape of the protein. Consider that mutant enzymes with altered shapes almost aways have lower catalytic efficiency when compared to the normal enzyme (use this information to interpret the question below).

The blue line represents the mutant enzyme since it has the higher slope and the higher Km

How would you expect the structure of ribozymes in organisms that grow in very hot environments, such as hot springs or deep-sea vents, to differ from those in organisms that grow in cooler environments?

The hairpins would have more G's and C's in the primary structure.

Select the false statement about the G protein hormone receptor system

The hormone is a ligand for G protein

According to the lac operon model proposed by Jacob and Monod, what is predicted to occur if the operator is removed from the operon?

The lac operon would be transcribed continuously.

What is the difference between linking glucose molecules with α-1,4-glycosidic linkages versus β-1,4-glycosidic linkages? Check all that apply.

The linkages are located on opposite sides of the plane of the glucose rings. In β-1,4-glycosidic linkages every other glucose flipped in orientation. In α-1,4-glycosidic linkages the glucose monomers are linked in the same orientation. The linkages have different orientation of the glucose monomers.

How can a hormone that is present in very small quantities within the bloodstream elicit such a large response within a cell?

The message from the hormone is amplified many times within the cell.

At equlibrium what would be the osmolarity (OsM) of the Right side of the chamber. Check all answers that apply

The right side would contain 1.0 OsM of K+ ions The right side would contain 0.5 OsM of Cl- ions The total osmolarity of the right side at equilibrium would be 1.5 OsM

How could two four-sugar oligosaccharides be structurally different even if both consist of two glucose monomers and two galactose monomers?

The sequence of monomers along the chain or the location and geometry of glycosidic linkages could vary (or both).

Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the operator to the far end of the operon, past the transacetylase (lacA) gene, which of the following would likely occur when the cell is exposed to lactose?

The structural genes will be transcribed continuously.

Which statement most accurately explains why ATP hydrolysis is highly exergonic?

There is a large drop in potential energy because charge repulsion is reduced, accompanied by a large increase in entropy.

Biological researchers have studied species of bacteria that are native to the artic tundra where temperture in the winter is well below zero and summer temperture is well above freezing. It has been shown that these bacteria adapt to survive during the winter by dramatically modifying their membranes. Predict what adaptive structural features you would expect in the membranes of these bacteia as they transition from summer to winter. Check all that apply.

There would be an increase in unsaturation (number of double bonds) in the fatty acid tails. The fatty acid tails would shorten.

Which statement about the daughter cells following mitosis and cytokinesis is correct?

They are genetically identical with each other and with the parent cell.

Which statement most accurately describes how the carbohydrates you ate during breakfast today are functioning in your body right now?

They are storing chemical energy, indicating cell identity, and serving as raw material for synthesizing other molecules.

Which of the following structural features is common to cellulose, chitin, and peptidoglycan?

They can all FORM bonds between polymer chains that create parallel strands.

Which of the following intermediary metabolites enters the citric acid cycle and is formed, in part, by the removal of a carbon (CO2) from one molecule of pyruvate?

acetly CoA

The transport of pyruvate into mitochondria depends on the proton-motive force across the inner mitochondrial membrane. How does pyruvate enter the mitochondrion?

active transport

From the equation ΔG = ΔH − TΔS, it can be concluded that __________.

all of the other answer choices are true

When the ATP to ADP+AMP ratio is high (indicating high energy charge) the excess ATP binds to an _______________ site on the enzyme and the binding causes a overall shape change that prevents the binding of substrates at the acitve site. The effect of this regulation slows the production of the oxidative metabolism during times when the cell has more than enough energy carrier molecules available to fuel the endogonic biochemical work of the cell. Fill in the blanks with the correct term.

allosteric

Jacob and Monod were intellectually primed to draw the conclusions they did concerning regulation of the lac operon. In part, this was due to their fascination with mechanisms of enzyme regulation. They knew that the activity of some enzymes is regulated when their reaction product binds to the enzyme, changing its shape and, therefore, its activity. This knowledge allowed them to easily make the intellectual leap to propose _____.

allosteric regulation of the repressor

Altering patterns of gene expression in prokaryotes would most likely serve an organism's survival by _____.

allowing an organism to adjust to changes in environmental conditions

By convention, biologists write the sequence of amino acids in a polypeptide in which direction?

amino- to carboxy-terminus

A series of enzymes catalyze the reaction X → Y → Z → A. Product A binds to the enzyme that converts X to Y at a position remote from its active site. This binding decreases the activity of the enzyme. With respect to the enzyme that converts X to Y, substance A functions as _____.

an allosteric inhibitor and lowers Vmax

What two functional groups are present on every amino acid?

an amino group and a carboxyl group

The polymerization of amino acids into a protein is an example of _____.

an anabolic pathway

Which of the following types of amino acids would you predict to be present in the DNA binding sites of these proteins?

basic amino acids

Which of the following would you expect to have the most free energy per gram? The most free energy per gram would be found in a molecule with _____.

carbon and hydrogen atoms only

Which of the following polysaccharides composes the cell wall of fungi?

chitin

A "mystery molecule" was isolated in a laboratory and scientists found that the molecule readily crossed artificial membranes. Which of the following molecules can be ruled out as the "mystery molecule?"

chloride ion

The drug cytochalasin B blocks the function of actin. Which of the following aspects of the cell cycle would be most disrupted by cytochalasin B?

cleavage furrow formation and cytokinesis

If a metaboic poison irreversibly binds to cyt a, cyt a will become permanently ___________, whereas cyt a3 will be permanently _________.

reduced ...... oxidized

When an atom or molecule gains one or more electrons, it is said to be ______________ and is at a ____________ energy state.

reduced......higher

In ther fermentation reaction shown below, pyruvate (pyruvic acid) is being _________ and NADH is being _______________

reduced......oxidized

When electrons from NADH are released onto FMN, FMN becomes _____________, and since Fe-S protein is a stronger _________ agent with a ___________ negative Standard Reduction Potential, it immediately accepts the electrons from FMN.

reduced......oxidizing agent......less

An RNA molecule that can catalyze chemical reactions is called a_____.

ribozyme

The enzyme amylase can break glycosidic linkages between glucose monomers only if the monomers are the α form. Which of the following could amylase break down?

starch

Transcription of structural genes in an inducible operon _____.

starts when the pathway's substrate is present