MIBO 3500 - Exam 3

Causes of mutations (3)

1. Errors in process (Replication/recombination) (biggest cause of mutations) 2. Environmental inputs (mutagens/carcinogens) 3. Human manipulation (molecular biology)

Bases

Adenine, Thymine, Cytosine, Guanine, Uracil (RNA)

Bioinformatics includes... (5 things)

Computational approaches Universal predictions Annotating the genomes (patterns) Mining the genomes Evolutionary relatedness

Translation

Convert information that is chemically encoded in nucleic acids to a function product (amino acids) (completely different from the source of information)

The Central Dogma

DNA -> mRNA -> Protein the process that governs all life, happens in every cell

Genotype

DNA sequence of an organism

An enzyme complex called RNA polymerase, also known as ____ -dependent _____ polymerase, carries out transcription.

DNA; RNA

________ are most likely to eliminate function of a gene.

Frameshifts

Wobble rule

In the codon/anticodon interaction a G-U pair is tolerated in the third position

Wildtype

Strain to which all are compared (arbitrary, but critical - convenience and convention, the strain studied first)

How are codons and anticodons related?

They are complementary RNA sequences

Managing DNA

Tightly packed genome DNA helix is supercoiled (twisted like a rubber band) Histone-like proteins help to manage

The primer in replication is

an RNA sequence with a free 3' -OH group

Nuceloside

base + sugar

Orthologs

homologous genes separated by a speciation event (appear to have same function but are found in different species)

Base pairing

hydrogen bonds in DNA form between adenine and thymine and between guanine and cytosine

Operons

inducible or repressible clusters of genes transcribed as a single mRNAs (bacterial and archaeal mRNAs can encode multiple genes)

Unstable RNA

mRNA (temporary messages)

Transition

purine => purine OR pyrimidine => pyrimidine A to G OR G to A; C to T OR T to C

Other RNA molecules

ribozymes, riboswitches, sRNA

Missense base subsitution

swapped one amino acid for another

Stem loops

the most thermodynamically stable form of RNA base pairing gives strength to these structures

Overview of translation

1. Initiation - Ribosome binding site and start codon - mRNA binds 30S - fmettRNA enters with 50S ribosome subunit 2. Elongation - Random insertion in the A site - GTP hydrolyzed per AA added 3. Termination - Assisted by release factors, ribosome falls off at stop codons

Steps in transcription

1. Recognition - binding to promoter Required to start transcription, need to recognize promoter to transcribe correct genes 2. Formation of the open complex 3. Elongation - Polymerase moves down DNA and copies template strand with compliment 4. Termination - release from terminator (promoter and terminator different from other processes)

Overview of DNA replication - E. coli

1. Recognition of oriC by DnaA:ATP complex 2. DnaB (helicase) unwinds the DNA 3. DnaG (primase) adds RNA priming strand (10-12 bp) 4. DNA polymerse is put onto both strands and adds bases onto the 3' end (bidirectional replication)

Promoter recongition

1. Sigma subunit recognizes special sequence 2. Promoter bound by RNA polymerase 3. Transitions to open complex - (12 bp open loop) - Once initiation is done, the sigma subunit leaves, the rest of the core enzyme is what travels down the DNA

Eukaryotic DNA replication differences

10-100 times slower in eukaryotes Origin of replication every 50-100 kb Cell cycle dependent (No competition with transcription) One replication event at each origin

Mutation

A heritable change (from defined control - a parental sequence) in the DNA sequence (whether or not it has an effect downstream) - passed onto the daughter cell, has to come from a stable DNA duplex

Polar mutation

A mutation that disrupts transcription of all genes downsteam in an operon (transposons or insertion mutations do this most) (remember: microbes couple transcription and translation)

Understanding the central dogma provides options:

Allows predictions from sequence Does it "look" like anything we know about (comparisons) Can it be confirmed experimentally? (a lot of this work depends on predictions)

The key to translation

Aminoacyl-tRNA synthetases recognize tRNA and charge with correct amino acid Quality control is critical

Mutant

An organism (or strain) with a mutation

Bacterial vs. eukaryotic and archaeal promoters

Bacteria just need promoters Promoters of Archaea and Eukarya: RNA polymerase recognizes TATA, Proteins important for guiding polymerase to site.

Phenotype

Behavior or appearance of an organism

Challenges to DNA replication

Cellular functions do not stop during replication. RNA polymerase is copying genes - The replication complex must run into slower moving complexes of RNA polymerase. The replication complex somehow magically passes through such collisions.

Lagging strand

Copied in the direction opposite of the replication fork Repeated priming (every 1-2 kb) by primase and then elongation (discontinuous elongation) DNA polymerase III has 3'-5' exonuclease activity to proofread and RNase H degrades RNA Polymerase I fills in gap with DNA. Breaks in the DNA are fixed by DNA ligase.

Deamination of cytosine

Cytosine to Uracil Converts a C-G pair to T-A

A mutant cell will always have:

Different DNA sequence than the WT

RNA polymerase (bacterial)

Different than the ones in other cells (often targeted by antibiotics) Sigma factor required to initiate transcription (with sigma factor = holoenzyme) Strands are pulled apart to create access to the information so it can be copied by the catalytic mechanism

Silent base subsitution

Does not do anything to protein but did change an amino acid OR Does not do anything to the amino acid but did change the DNA

Interesting exceptions

GUG, UUG can serve as start codons Ribosome binding site (Shine Dalgarno sequence) not always necessary Two different starts, (two proteins, one gene). Some translation read-through occurs at stop codons.

Transcription in eukaryotes

Generally similar to bacteria Have to deal with histones Elongation affected by modification of histones Transcripts typically only one gene Gene splicing Addition of 5'-cap and 3'poly A tail

The mRNA sequence below includes the beginning, but not the end, of the coding sequence for a gene. Write the first 4 amino acids of the gene product. UAAUGUAUUGAUAAUGAAUCGCCUA

Met, Asn, Arg, Leu

The DNA double strand provides (2 things)

Protection from chemical attack Redundancy of information

Eukaryotic DNA replication similarities

Protein complex opens the DNA Bidirectional RNA primase involved

A functional protein product might require... (3 things)

Protein folding, cofactor insertion, multimer formation

_________ are bicyclic bases and __________ are monocyclic bases.

Purines, pyrimidine

Termination of transcription

Simple termination (Rho-independent) (majority of genes): - G-C rich stem loop causes polymerase to fall off Rho-dependent: - Rho binds to the message and causes transcription to stop

Players in transcription

Template DNA (DNA-dependent), RNA polymerase (bunch of subunits), Ribonucleoside triphosphates (UTP, GTP, CTP, ATP)

Transcription elongation

The sigma subunit dissociates after about 20 nucleotides and RNA polymerase synthezises RNA from the template DNA strand by adding complimentary nucleotides

Point mutation

a change in one base causes a change to an amino acid

Nonsense point mutation

a change in one base changes an amino acid to a stop codon

RNA polymerase does not require...

a primer (this is different from replication)

An operon is...

a single promoter/terminator region (for each operon there is a start and stop codon)

A base subsitution mutation in a coding sequence of a gene can:

alter the function of the gene product, elminate function of a gene product, have no effect on the function of the gene product, or result in a truncated protein product

DNA strands are...

antiparallel (if there's no designation assume 5' to 3' is left to right)

Nucleotide

base + sugar + phosphate

Mutations that can eliminate function

base subsitution, deletion, insertion, frameshift, etc.

Mutations that can change (gain) function

base substitution

Information is in the ______ of DNA.

center (must have a way to unwind DNA and access it)

Nonsense base subsitution

changed a codon into a stop codon (results in a truncated protein)

DNA is...

chemically stable and flexible (allows for easier storage)

Homologs

closely related genes

The genetic code

collection of codons of mRNA, each of which directs the incorporation of a particular amino acid into a protein during protein synthesis (tRNA carries anticodon which tells the cell to put a specific amino acid into the polypeptide chain)

Leading strand

copied in the direction of the replication fork, adding onto the 3' end continuously (polymerase requires a 3' -OH)

Transcription and translation are...

coupled in bacteria and archaea

The genetic code is...

degenerate (multiple codons give you the same amino acid)

Deletion frameshift

delete base pairs and cause a framshift, everything downstream changes

RNA can be...

double or single stranded but not redundant in total

A frameshift mutation in the middle of a coding sequence is most likely to:

eliminate function of a gene product

DNA replication is...

fast and accurate (one mistake every million base pairs)

Inversion

flipped orientation of multiple nucleotides

If you delete the terminator of a gene, its protein product will:

function almost normally

The _______ is the blueprint for cellular function.

genome

Paralogs

homologous genes in the same species (derived from the same protein but diverged)

The more related things are the easier it is to predict...

if they are behaving similarly

Insertion/deletion

insertion or removal of one or more nucleotides

Insertion frameshift

introduce base pairs and cause a frameshift, everything downstream changes

Termination of replication

involves a terminator which is a region of the chromosome that cannot be duplicated

What is the significance of the ribosome binding site (Shrine-Delgarndo sequence)?

it is the site where ribosomes bind to begin translation

Depurination

loss of a purine base resulting in a hole in DNA (caused by water availability)

Players in translation

mRNA; copy of relevant piece of DNA (comes from transcription) Amino acids; substrates of translation Ribosomes; machine where translation occurs

A graduate student is trying to make a mutation in RNA polymerase by deleting the beta subunit. After looking through 10,000 potential mutants none are found in RNA polymerase. This is because:

mutants without RNA polymerase are not viable

Mutations that can change levels

mutations in regulatory region

Frameshifts

mutations that shift the "reading" frame of the genetic message by inserting or deleting nucleotides in a non-3x fashion Only relevant in a coding sequence - does not describe what happens to the DNA, describe a consequence that happens to the protein

The _________ along the outside of DNA molecules generates a _________ charge.

phosphate; negative

Transversion

purine => pyrimidine A to C or T; T to G or A, etc.

Stable RNA

rRNA (enzyme components), tRNA (translator)

DNA molecules are ________ meaning information is the same on both strands.

redundant

Sugars

ribose in RNA and deoxyribose in DNA (-OH vs. -H in 2' position differentiates RNA from DNA)

Consequences of coupling transcription and translation

ribosomes start and stop for each open reading frame

Base substitution

single nucleotide change

Two strands: coding and template

template is complement of the message, coding strand is identical to transcript

tRNA

the acceptor end is where the amino acid is tethered the anticodon loop contains the three nucleotide base sequence which pairs with the mRNA codon during translation

Whether tRNA matches the codon in the A site is determined by...

the concentration of tRNAs in the cell (strictly stochastic event (random))

Which ribosomal subunit is used for phylogenetic studies and why?

the small subunit; it is highly conserved

Most of the degeneracy is in the ________ position.

third

The codons for arginine are: CGU, CGC, CGA, CGG, AGA, AGG. How many tRNAs must the cell have for arginine?

three (encode the fewest number of tRNAs possible for an amino acid - remember the wobble rule)

Promoter is ________ of where transcription starts and is _____ in the transcript

upstream; not (terminator is though)

Bioinformatics

use of computer databases to organize and analyze biological data