MIBO 3500 - Exam 3
Causes of mutations (3)
1. Errors in process (Replication/recombination) (biggest cause of mutations) 2. Environmental inputs (mutagens/carcinogens) 3. Human manipulation (molecular biology)
Bases
Adenine, Thymine, Cytosine, Guanine, Uracil (RNA)
Bioinformatics includes... (5 things)
Computational approaches Universal predictions Annotating the genomes (patterns) Mining the genomes Evolutionary relatedness
Translation
Convert information that is chemically encoded in nucleic acids to a function product (amino acids) (completely different from the source of information)
The Central Dogma
DNA -> mRNA -> Protein the process that governs all life, happens in every cell
Genotype
DNA sequence of an organism
An enzyme complex called RNA polymerase, also known as ____ -dependent _____ polymerase, carries out transcription.
DNA; RNA
________ are most likely to eliminate function of a gene.
Frameshifts
Wobble rule
In the codon/anticodon interaction a G-U pair is tolerated in the third position
Wildtype
Strain to which all are compared (arbitrary, but critical - convenience and convention, the strain studied first)
How are codons and anticodons related?
They are complementary RNA sequences
Managing DNA
Tightly packed genome DNA helix is supercoiled (twisted like a rubber band) Histone-like proteins help to manage
The primer in replication is
an RNA sequence with a free 3' -OH group
Nuceloside
base + sugar
Orthologs
homologous genes separated by a speciation event (appear to have same function but are found in different species)
Base pairing
hydrogen bonds in DNA form between adenine and thymine and between guanine and cytosine
Operons
inducible or repressible clusters of genes transcribed as a single mRNAs (bacterial and archaeal mRNAs can encode multiple genes)
Unstable RNA
mRNA (temporary messages)
Transition
purine => purine OR pyrimidine => pyrimidine A to G OR G to A; C to T OR T to C
Other RNA molecules
ribozymes, riboswitches, sRNA
Missense base subsitution
swapped one amino acid for another
Stem loops
the most thermodynamically stable form of RNA base pairing gives strength to these structures
Overview of translation
1. Initiation - Ribosome binding site and start codon - mRNA binds 30S - fmettRNA enters with 50S ribosome subunit 2. Elongation - Random insertion in the A site - GTP hydrolyzed per AA added 3. Termination - Assisted by release factors, ribosome falls off at stop codons
Steps in transcription
1. Recognition - binding to promoter Required to start transcription, need to recognize promoter to transcribe correct genes 2. Formation of the open complex 3. Elongation - Polymerase moves down DNA and copies template strand with compliment 4. Termination - release from terminator (promoter and terminator different from other processes)
Overview of DNA replication - E. coli
1. Recognition of oriC by DnaA:ATP complex 2. DnaB (helicase) unwinds the DNA 3. DnaG (primase) adds RNA priming strand (10-12 bp) 4. DNA polymerse is put onto both strands and adds bases onto the 3' end (bidirectional replication)
Promoter recongition
1. Sigma subunit recognizes special sequence 2. Promoter bound by RNA polymerase 3. Transitions to open complex - (12 bp open loop) - Once initiation is done, the sigma subunit leaves, the rest of the core enzyme is what travels down the DNA
Eukaryotic DNA replication differences
10-100 times slower in eukaryotes Origin of replication every 50-100 kb Cell cycle dependent (No competition with transcription) One replication event at each origin
Mutation
A heritable change (from defined control - a parental sequence) in the DNA sequence (whether or not it has an effect downstream) - passed onto the daughter cell, has to come from a stable DNA duplex
Polar mutation
A mutation that disrupts transcription of all genes downsteam in an operon (transposons or insertion mutations do this most) (remember: microbes couple transcription and translation)
Understanding the central dogma provides options:
Allows predictions from sequence Does it "look" like anything we know about (comparisons) Can it be confirmed experimentally? (a lot of this work depends on predictions)
The key to translation
Aminoacyl-tRNA synthetases recognize tRNA and charge with correct amino acid Quality control is critical
Mutant
An organism (or strain) with a mutation
Bacterial vs. eukaryotic and archaeal promoters
Bacteria just need promoters Promoters of Archaea and Eukarya: RNA polymerase recognizes TATA, Proteins important for guiding polymerase to site.
Phenotype
Behavior or appearance of an organism
Challenges to DNA replication
Cellular functions do not stop during replication. RNA polymerase is copying genes - The replication complex must run into slower moving complexes of RNA polymerase. The replication complex somehow magically passes through such collisions.
Lagging strand
Copied in the direction opposite of the replication fork Repeated priming (every 1-2 kb) by primase and then elongation (discontinuous elongation) DNA polymerase III has 3'-5' exonuclease activity to proofread and RNase H degrades RNA Polymerase I fills in gap with DNA. Breaks in the DNA are fixed by DNA ligase.
Deamination of cytosine
Cytosine to Uracil Converts a C-G pair to T-A
A mutant cell will always have:
Different DNA sequence than the WT
RNA polymerase (bacterial)
Different than the ones in other cells (often targeted by antibiotics) Sigma factor required to initiate transcription (with sigma factor = holoenzyme) Strands are pulled apart to create access to the information so it can be copied by the catalytic mechanism
Silent base subsitution
Does not do anything to protein but did change an amino acid OR Does not do anything to the amino acid but did change the DNA
Interesting exceptions
GUG, UUG can serve as start codons Ribosome binding site (Shine Dalgarno sequence) not always necessary Two different starts, (two proteins, one gene). Some translation read-through occurs at stop codons.
Transcription in eukaryotes
Generally similar to bacteria Have to deal with histones Elongation affected by modification of histones Transcripts typically only one gene Gene splicing Addition of 5'-cap and 3'poly A tail
The mRNA sequence below includes the beginning, but not the end, of the coding sequence for a gene. Write the first 4 amino acids of the gene product. UAAUGUAUUGAUAAUGAAUCGCCUA
Met, Asn, Arg, Leu
The DNA double strand provides (2 things)
Protection from chemical attack Redundancy of information
Eukaryotic DNA replication similarities
Protein complex opens the DNA Bidirectional RNA primase involved
A functional protein product might require... (3 things)
Protein folding, cofactor insertion, multimer formation
_________ are bicyclic bases and __________ are monocyclic bases.
Purines, pyrimidine
Termination of transcription
Simple termination (Rho-independent) (majority of genes): - G-C rich stem loop causes polymerase to fall off Rho-dependent: - Rho binds to the message and causes transcription to stop
Players in transcription
Template DNA (DNA-dependent), RNA polymerase (bunch of subunits), Ribonucleoside triphosphates (UTP, GTP, CTP, ATP)
Transcription elongation
The sigma subunit dissociates after about 20 nucleotides and RNA polymerase synthezises RNA from the template DNA strand by adding complimentary nucleotides
Point mutation
a change in one base causes a change to an amino acid
Nonsense point mutation
a change in one base changes an amino acid to a stop codon
RNA polymerase does not require...
a primer (this is different from replication)
An operon is...
a single promoter/terminator region (for each operon there is a start and stop codon)
A base subsitution mutation in a coding sequence of a gene can:
alter the function of the gene product, elminate function of a gene product, have no effect on the function of the gene product, or result in a truncated protein product
DNA strands are...
antiparallel (if there's no designation assume 5' to 3' is left to right)
Nucleotide
base + sugar + phosphate
Mutations that can eliminate function
base subsitution, deletion, insertion, frameshift, etc.
Mutations that can change (gain) function
base substitution
Information is in the ______ of DNA.
center (must have a way to unwind DNA and access it)
Nonsense base subsitution
changed a codon into a stop codon (results in a truncated protein)
DNA is...
chemically stable and flexible (allows for easier storage)
Homologs
closely related genes
The genetic code
collection of codons of mRNA, each of which directs the incorporation of a particular amino acid into a protein during protein synthesis (tRNA carries anticodon which tells the cell to put a specific amino acid into the polypeptide chain)
Leading strand
copied in the direction of the replication fork, adding onto the 3' end continuously (polymerase requires a 3' -OH)
Transcription and translation are...
coupled in bacteria and archaea
The genetic code is...
degenerate (multiple codons give you the same amino acid)
Deletion frameshift
delete base pairs and cause a framshift, everything downstream changes
RNA can be...
double or single stranded but not redundant in total
A frameshift mutation in the middle of a coding sequence is most likely to:
eliminate function of a gene product
DNA replication is...
fast and accurate (one mistake every million base pairs)
Inversion
flipped orientation of multiple nucleotides
If you delete the terminator of a gene, its protein product will:
function almost normally
The _______ is the blueprint for cellular function.
genome
Paralogs
homologous genes in the same species (derived from the same protein but diverged)
The more related things are the easier it is to predict...
if they are behaving similarly
Insertion/deletion
insertion or removal of one or more nucleotides
Insertion frameshift
introduce base pairs and cause a frameshift, everything downstream changes
Termination of replication
involves a terminator which is a region of the chromosome that cannot be duplicated
What is the significance of the ribosome binding site (Shrine-Delgarndo sequence)?
it is the site where ribosomes bind to begin translation
Depurination
loss of a purine base resulting in a hole in DNA (caused by water availability)
Players in translation
mRNA; copy of relevant piece of DNA (comes from transcription) Amino acids; substrates of translation Ribosomes; machine where translation occurs
A graduate student is trying to make a mutation in RNA polymerase by deleting the beta subunit. After looking through 10,000 potential mutants none are found in RNA polymerase. This is because:
mutants without RNA polymerase are not viable
Mutations that can change levels
mutations in regulatory region
Frameshifts
mutations that shift the "reading" frame of the genetic message by inserting or deleting nucleotides in a non-3x fashion Only relevant in a coding sequence - does not describe what happens to the DNA, describe a consequence that happens to the protein
The _________ along the outside of DNA molecules generates a _________ charge.
phosphate; negative
Transversion
purine => pyrimidine A to C or T; T to G or A, etc.
Stable RNA
rRNA (enzyme components), tRNA (translator)
DNA molecules are ________ meaning information is the same on both strands.
redundant
Sugars
ribose in RNA and deoxyribose in DNA (-OH vs. -H in 2' position differentiates RNA from DNA)
Consequences of coupling transcription and translation
ribosomes start and stop for each open reading frame
Base substitution
single nucleotide change
Two strands: coding and template
template is complement of the message, coding strand is identical to transcript
tRNA
the acceptor end is where the amino acid is tethered the anticodon loop contains the three nucleotide base sequence which pairs with the mRNA codon during translation
Whether tRNA matches the codon in the A site is determined by...
the concentration of tRNAs in the cell (strictly stochastic event (random))
Which ribosomal subunit is used for phylogenetic studies and why?
the small subunit; it is highly conserved
Most of the degeneracy is in the ________ position.
third
The codons for arginine are: CGU, CGC, CGA, CGG, AGA, AGG. How many tRNAs must the cell have for arginine?
three (encode the fewest number of tRNAs possible for an amino acid - remember the wobble rule)
Promoter is ________ of where transcription starts and is _____ in the transcript
upstream; not (terminator is though)
Bioinformatics
use of computer databases to organize and analyze biological data
