Unit 4 - Chapter 19, Chapter 20
Which of the following are base analogs?
2-aminopurine 5-bromouracil
In recombination, what is the process that synthesizes small stretches of DNA to replace those removed by strand degradation?
DNA gap repair synthesis
Which model for recombination involves production of single-strand breaks in each of the non-sister chromatids after which the strands invade the opposite helices?
Holliday model
Which of the following are examples of ionizing radiation?
X-rays and gamma rays
What is a cloning vector?
a molecule that carries the DNA to be cloned
Homologous recombination is a process in which
a new combination of DNA sequences is formed through breakage and rejoining of similar or identical DNA segments
In gene cloning, what is the vector?
a small DNA molecule that can replicate independently within a host cell
The covalent bond between deoxyribose and a purine base is rather unstable and can undergo a spontaneous reaction with water. The breaking of the bond releases the base, and leaves a(n) ____ site in the DNA
apurinic
Replica plating is a technique in which ______.
bacterial colonies are transferred from one plate to another with a sterile piece of velvet cloth
Some errors affect individual nucleotides and do not distort the DNA double helix. These errors are removed primarily by a DNA repair system called BER, which stands for ____ ____ repair.
base excision
Base analogs induce mutations by ______.
being incorporated instead of normal bases during DNA replication
Physical mutagens include ______.
both X-rays and UV light
The region where two chromosome pieces break and re-attach to other chromosome pieces is called a chromosomal
breakpoint
Which of the following are examples of base pair mismatches?
cytosine on parent strand and adenine on daughter strand adenine on parent strand and cytosine on daughter strand cytosine on parent strand and thymine on daughter strand
The removal of an amino group from a base is called
deamination
Which of the following are forms of tautomers?
enol imino keto amino
Which of these are examples of alkylating agents?
ethyl methanesulfonate nitrogen mustard
True or false: During homologous recombination repair, the two broken ends of DNA are pieced back together.
false
Acridine dyes cause ______ mutations.
frameshift
The Ames test assays whether an agent causes ______.
gene mutations
A mutant allele is best defined as an allele that ______.
has a different DNA sequence from the wild-type
The process by which chromosomes exchange similar or identical DNA segments during meiosis is called ______.
homologous recombination
Double-strand breaks are typically repaired by which of the following?
homologous recombination repair nonhomologous end joining
The two main mechanisms used to repair DNA double-strand breaks are ____ recombination repair and ____ end joining.
homologous; nonhomologous
What is the term that describes a cell that contains a DNA cloning vector?
host cell
In this figure, two panels are shown. Panel I shows protein A. A first mutation inhibits the function of protein A. In Panel II a second mutation alters protein B to carry out the function of protein A. What is this an example of?
intergenic suppression
Gamma rays and X-rays are examples of a type of radiation called ____ radiation
ionizing
Alkylating agents covalently attach ____ or ____ groups to DNA bases, and this disrupt their normal base pairing properties
methyl or ethyl
Gene conversion occurs by the action of ______.
mismatch repair DNA gap repair synthesis
A mutation in a gene that causes an amino acid change in the encoded protein is called a ______ mutation.
missense
A base substitution in DNA that ultimately leads to a change in the encoded amino acid is called a(n) ____ mutation
missensed
The term ____ refers to an inherited change in the sequence of the genetic material
mutation
The probability that a gene will be altered by a new mutation is referred to as the
mutation rate
Which of these are examples of mutagens?
nitrous acid nitrogen mustard 2-aminopurine 5-bromouracil
This figure shows the first steps of the mechanism of DNA repair called ______.
nonhomologous end joining
Some errors create bulky distortions of the double helix. These errors are removed primarily by a DNA repair system called NER, which stands for ____ ___ repair.
nucleotide excision
Changes to DNA structure caused by reactive oxygen species (ROS) are termed
oxidative DNA damage
The process by which thymine dimers are directly repaired with the help of light is called
photoreactivation
In addition to the DNA strands of the chromosomes involved in homologous recombination, the multiple steps in the pathway require the action of
protein catalysts
The multiple steps of homologous recombination, including strand breakage and rejoining, require the action of ______.
protein catalysts
Oxidative DNA damage refers to changes in DNA structure that are caused by ______.
reactive oxygen species
____ DNA technology uses in vitro molecular techniques that combine DNA fragments to produce novel arrangements.
recombinant
DNA N-glycosylases participate in the base excision repair (BER) system. These enzymes ______.
remove an abnormal base
If a heteroduplex includes a region with an allelic difference, the cell will ______.
repair the mismatch to either the dominant or recessive allele
A mutation that does not change the amino acid sequence of a polypeptide is known as a(n) ____ mutation
silent
Bases which exist in keto and enol or amino and imino forms are best described as ______.
tautomers
Which of these tests is used to evaluate the mutagenicity of an agent?
the Ames test
Which of the following statements about promoter mutations is true?
up promoter mutations cause the promoter sequence to be more like the consensus sequence down promoter mutations decrease the affinity of transcription factors to the promoter
Mutations that occur in a promoter sequence can be divided into two types: ____ promoter mutations increase the transcription rate, while ____ promoter mutations decrease it.
up; down
The mutation nitrous acid changes cytosine to ____ and adenine to _____
uracil; hypoxanthine
A breakpoint refers to the region ______.
where two chromosome pieces break and rejoin with other chromosome pieces
Translesion DNA polymerases incorporate wrong nucleotides with a frequency of approximately _____, which is ______ than the error rate for replicative DNA polymerases.
10 -2; higher
A mutagen is a(n) ______.
agent that causes mutations
DNA N-glycosylases are enzymes involved in ______.
base excision repair
Nucleotide excision repair (NER) is the main system used in the repair of ______.
bulky, helix distorting lesions
True or false: Chromosomal DNA is a common source of cloned DNA.
true
Acridine dyes induce mutations by ______.
inserting themselves between adjacent bases and thus distorting DNA structure
A change of one base for another is described as a base ____ mutation
substitution
This figure best illustrates what type of mutation?
base substitution
Nitrous acid is a mutagen that acts via the process of ______.
deamination
What is recombinant DNA technology?
the production of new arrangements of DNA
The term germ line is used to describe the ______.
cells that produce sperm and eggs
What is the purpose of gene cloning?
to produce many copies of a DNA molecule of interest
You would ____ a gene to make many copies of that gene
clone
An allele that has a DNA sequence different from that of the wild-type is called a(n) ____ allele
mutant
A heritable change in the genetic material is called a(n) ______.
mutation
Ionizing radiation is characterized by ______.
short wavelength and high energy
Mutations can be caused in two main ways: (1) ____ mutations are the result of natural biological or chemical processes; and (2) ____ mutations are produced by environmental agents.
spontaneous; induced
How does ionizing radiation cause mutations?
it forms free radicals that can introduce breaks into the DNA molecule
This figure shows an example of a(n) ____ ____ mutation Illustration shows single panel. When there is no mutation then transport can occur. After first mutation, the functioning of proteins gets disrupted and a suppressor mutation affects the same protein restores function. In this example, the second mutation restores the function and hence, gtransport occurs. this is an example of intragenic suppressor.
intragenic suppressor
A silent mutation is a mutation that results in no ______.
change to the amino acid sequence of the polypeptide
A particular gene to be cloned is often isolated from ______.
chromosomal DNA
Trinucleotide repeat expansions are repeated sequences of three nucleotide bases which ______.
increase generation after generation
The first proposal for a set of steps at the molecular level that lead to homologous recombination is called the ____ model.
Holliday
The phenomenon in which a repeated sequence of three nucleotide bases increases in number generation after generation is called
trinucleotide repeat expanion
During the normal course of DNA replication, the addition of a nucleotide that does not obey the AT/GC rule of base pairing creates a ______.
base pair mismatch
The removal of a purine from DNA is called
depurination
Mutations that remove an adenine or guanine from the DNA are known as ______.
depurinations
An agent that can change DNA structure and cause mutations is known as a(n)
mutagen
A small circular DNA molecule that is often used as a vector in gene cloning is called a(n)
plasmid
Alkylating agents include nitrogen ____ and ethyl _____
mustard; methanesulfonate
This figure shows a technique known as First, individual bacteria cells were plated onto growth media. The cells were allowed to divide during an overnight incubation, during which time random mutations may occur. During the overnight incubation, bacterial colonies formed. This plate is called the master plate. Some colonies on the master plate do not have mutations. Other colonies contain some cells which have a random mutation that gives resistance to T1. A velvet cloth wrapped around a clyinder was pressed onto the master plate, and gently lifted to obtain a replica of each bacterial colony. The replica was presssed onto 2 secondary plates that contain T1 phage. The plates were incubated overnight to allow growth of mutant cells. Nonmutant cells were lysed and killed on the T1 plates.
replica plating
Base excision repair (BER) is the main system used in the repair of ______.
abnormal bases
Translesion DNA polymerases are ______ accurate and ______ sensitive to geometric distortions in DNA than replicative DNA polymerases.
less; less
Errors in DNA replication are examples of ______ mutations, while mutations caused by ultraviolet light are ______ mutations.
spontaneous; induced
Select the sequences that would be recognized by a restriction enzyme. (Check all that apply.)
3'-TAGCTA-5' 5'-GAATTC-3' 5'-GAGCTC-3'
You wish to introduce a specific missense mutation into a specific cell type in live adult mice. What is the best way to achieve this goal?
CRISPR-Cas technology with donor DNA
Antibodies can be used as a probe for which technique?
Western blotting
Mutation rate is the likelihood that a gene will
be altered
Antibodies bind to three-dimensional structures found within a protein that are called ______.
epitopes
A situation in which one allele is changed to the allele found on the homologous chromosome is called ______.
gene conversion
____-____ PCR allows one to assess the amount of DNA produced during a PCR amplification as it is happening
real-time
In PCR, the DNA to be amplified is called the ____ DNA
template
During mismatch repair, the template strand must be distinguished from the newly synthesized strand. In prokaryotes the template strand is ____.
the methylated strand of a hemimethylated duplex
A small DNA molecule that can replicate independently within a host cell and thus make many copies of an inserted gene is called a
vector
In cloning a specific fragment from a mixture of different fragments of DNA, three classes of plasmids can be produced: vector containing the desired fragment (gene of interest), vector containing other fragments, and re-ligated vector containing no inserted DNA. What class of vector would you expect to find at the highest frequency?
vector with no insert
Many species of bacterial cells make restriction enzymes to protect themselves from invasion by
viruses
Order the steps in one cycle of a PCR reaction, putting the first step at the top. 1) denaturation 2) primer annealing 3) primer extension
1 2 3
Match the phase of real-time PCR with the accumulation of products. 1) Exponential 2) Linear 3) Plateau
1) the amount of product nearly doubles with each cycle but may be difficult to detect as the amounts are small 2) accumulation of the products shows a directly proportional relationship to cycle number 3) accumulation of the product levels off as one or more reagents are used up
A person will typically have ____ new mutations not found in either parent
100-200
Order the following steps in cloning a gene, putting the first step at the top. 1) the digested chromosomal DNA and plasmid DNA are incubated together 2) ligation by DNA ligase 3) chromosomal DNA is isolated and cut with a restriction enzyme; the plasmid DNA is cut with the same enzyme
3 1 2
Place the steps in a real-time PCR experiment in order from first to last, putting the first step at the top. 1) more and more TaqMan probes are digested and the level of fluorescence increases 2) The reporter can emit unquenched fluorescence that can be measured 3) a primer and the TaqMan probe both anneal to template DNA 4) Taq polymerase cleaves the oligonucleotides in TaqMan
3 4 2 1
consider the following DNA sequence, which codes the first portion of a long protein beginning at the ATG (AUG in mRNA) start codon. 5' ATG CCC CGC AGG GGG TGG AGA 3' Which of the mutated sequences listed is most likely to be a deleterious mutation?
5' ATG CCC CGC AGT AGG GGG TGA AGA 3'
Consider the following DNA sequence, which codes the first portion of a long protein beginning at the ATG (AUG in mRNA) start codon. 5' ATG CCC CGC AGT AGG GGG TGG AGA 3' Which of the mutated sequences listed is most likely to be a deleterious mutation?
5' ATG CCC CGC AGT AGG GGG TGA AGA 3', introduces premature stop codon in 7th amino acid
What activity of Taq polymerase separates the reporter from the quencher in the TaqMan molecule?
5' to 3' exonuclease
Which of the following is an example of a palindromic DNA sequence?
5'-CTGCAG-3' 3'-GACCTC-5'
An example of a base analog would be
5BU
There is a spectrum of syndromes in humans known as Xeroderma pigmentosum. The individuals that have XD most commonly have mutations in their nucleotide excision DNA repair mechanisms that make them particularly susceptible to environmental mutagens such as UV light. Individuals have to be careful with how much sunlight they are exposed to since they have an extremely elevated chance for developing skin cancer. There have been several cell lines that have been established from XD patients that can be studied in tissue culture. In an experiment several different cell lines of unknown origin were tested for their ability to undergo unscheduled DNA synthesis (UDS), an assay for DNA repair. In this assay the amount of radioactive nucleotides that are incorporated into DNA after the cell sustains a mutagenic event are measured. The amount of radioactivity incorporated is measured by the number of counts per minute (CPM). Below is a table from such an experiment. Which cell line is most likely from XD patient(s)? (D)
A
Prior to the discover of Taq polymerase, PCR could be carred out in a more laborious manner by adding non-thermostable polymerase to teach round of the reaction. In order for this reaction to work, when should the non-thermostable polymerase be added?
After primer annealing
You are sequencing the following DNA molecule 3'- GACTACCGAAATTAT -5'. Assume the annealing primer binds immediately prior to this sequence. What nucleotide will be found closest to the bottom of the sequencing gel?
C
Most TNRE repeats involve expansion of which codon?
CAG
Which component in the CRISPR-Cas9 system makes a double-strand break in DNA?
Cas9
Place the labels in the correct column. Some labels may be used more than once.
Chemical mutagens -nitrous acid -proflavin -alter structure of DNA -can function as base analog -can intercalate into DNA Physical mutagens -x-rays -UV light -alter structure of DNA -can cause thymine dimers -can cause DNA strand breaks
In PCR, the two primers bind to specific sites in the ____ and flank the gene to be amplified
DNA
A researcher may use restriction enzymes to digest the DNA of an organism. The fragments of DNA are then ligated individually into many vectors. This collection of recombinant vectors is called a
DNA library
Which of the following may account for the process of gene conversion?
DNA mismatch repair
DNA sequencing enables researchers to determine the order of ______ ______ in a gene.
DNA nucleotides
Dideoxy sequencing was formulated based on scientists' knowledge of what process?
DNA replication
Dideoxy nucleotides are used in which technique?
DNA sequencing
This technique enables researchers to determine the DNA bases in genes and other chromosomal regions.
DNA sequencing
In a DNase I footprinting experiment, why does the experimental design only allow DNase I to make a single cut in the DNA fragments?
DNase I cuts the DNA fragment to generate fragments of various sizes
Which of the following techniques is used to study protein-DNA interactions?
DNase I footprinting
Which scientist developed the polymerase chain reaction?
Kary Mullis
You are performing a mobility shift assay with a protein complex that is composed of proteins A, B, C, & D, each of which can bind to the DNA of interest. You run the gel with the lanes as follows: Lane 1: Protein A + DNA Lane 2: Proteins A + B + DNA Lane 3: Proteins A + B + C + DNA Lane 4: Proteins A + B + C + D + DNA In which lane will the DNA run closest to the top of the gel?
Lane 4
Which scientist(s) developed an early method of DNA sequencing that involved base-specific chemical cleavage of DNA?
Maxam and Gilbert
A culture of a bacterium that is His- (cannot grow on plates that lack the amino acid histidine) is grown in a liquid culture that contains a mutagen. A separate culture of a bacterium that is also His- is grown in a liquid culture that does not contain a mutagen as a control group. At different time points, samples are removed and one million bacteria are plated onto media that lacks His. The following results are obtained: (C) What is the average mutation frequency for the control and mutagen groups?
Mutation frequency of control group = 1 x 10^-6 Mutation frequency of experimental group = 16 x 10^-6
This technique is used to identify a specific RNA molecule within a mixture of RNA molecules.
Northern blotting
What is one technique that is used to identify a specific RNA sequence of a sample from a library?
Northern blotting
Select all descriptions of translesion synthesis. (Check all that apply.)
Occurs when DNA replication machinery encounters a distortion due to DNA damage Error-prone replication Necessary when a lesion has escaped other repair mechanisms
Consider the following DNA sequence, which codes for the first portion of a long protein beginning at the ATG (AUG in mRNA) start codon. 5' ATG CCC CGC AGT AGG GGG TGG AGA3' A mutation occurs changing this sequence to: 5' ATG CCG CGC AGT AGG GGG TGG AGA3' What type of mutation is this? (Check all that apply.)
Point mutation (changing 1 nucleotide) Transversion (pyrimidine to purine) Silent mutation (change in last nucleotide does not change amino acid)
Binds to single stranded DNA and promotes strand invasion
RecA
In E. coli, a mutation in the genes encoding which of the following proteins would disable the ability of the cell to recognize double-stranded breaks and conduct recombination during meiosis?
RecBCD
Recognizes double stranded breaks and unwinds DNA
RecBCD
Promotes branch migration
RuvAB
Is an endonuclease
RuvC
Which types of mutations are least likely to be subjected to natural selection?
Silent
Place the labels in the correct column. Labels may be used more than once.
Silent -codon CCA changed to CCG -no change in protein primary structure -change in single nucleotide -no change in amino acid Missense -change in amino acid codon CCA changed to CGA -protein tertiary structure might change -change in single nucleotide
Place the labels in the correct category. Some labels may be used more than once.
Somatic mutation -phenotype only seen in one or a few tissues -none of the gametes carry mutation -can be point mutation -can be deletion mutation -can be inversion mutation Germ-line mutation -mutation can be vertically transmitted -half of the gametes could carry mutation -can be point mutation -can be deletion mutation -can be inversion mutation
Tautomeric shifts can result in _____ base pairing
TG/CA
Anticipation is associated with which type of mutation?
TNRE mutations
The ____ probe is an oligonucleotide that can be used to follow real-time PCR. It has a reporter molecule at one end and a quencher molecule at the other end.
TaqMan
How are the results of an electrophoretic mobility shift assay detected?
The protein:DNA complex is visualized by staining the DNA
Given the DNA strand GAGGAUGGCCAGUGCAUUGA classify the various mutations. Note that this is the very 5' end of an mRNA, which contains the start codon. The types of mutations refer to what the change was in the template DNA strand.
Transversion silent -GAGGAUGGCAAGUGCAUUGA Transversion missense -GAGGAUGGCCAUUGCAUUGA Transition silent -GAGGAUGGCCAGUGCGUUGA Transition missense GAGGAUGGCCAGUGCAUCGA Deletion frameshift -GAGGAUGCCAGUGCAUUGA Deletion no frameshift -GAGGAUGGCCGCAUGA
What technique is used to identify a particular protein in a mixture of proteins?
Western blotting
You wish to determine if a protein is made at a particular stage of development. What technique would you use?
Western blotting
In PCR, each cycle uses the products of the previous cycle as templates. What do you call this?
a chain reaction
What is a DNA library?
a collection of recombinant vectors
What is a DNA library?
a collection of vectors, each containing a fragment of the original genome
What is a plasmid?
a small circular DNA molecule often used as a vector in gene cloning
A temporary change in the conformation of a nitrogenous base is called __________.
a tautomeric shift
What type of apparatus does one need to quantify the DNA produced during real-time PCR?
a thermocycler that can detect fluorescence
CRISPR-Cas technology has been used to mutate genes in ______.
adult mice roundworms human cell lines mouse embryos plant cells
Base analogs include 2-____ and 5-____.
aminopurine; bromouracil
A mutagen is __________.
an agent that can alter the structure of DNA and cause mutations
In which of these experiments would reverse transcriptase PCR be useful? (Check all that apply.)
an experiment to determine if a specific gene was transcribed in a cell an experiment to determine if several mRNAs of different sizes were present in a starting sample
What are the necessary components of a plasmid used in cloning? (Check all that apply.)
an origin of replication a selectable marker unique restriction sites
Certain compounds have a structure similar to normal DNA bases and so can be incorporated into daughter strands during DNA replication. These compounds are called base
analogues
The red arrow in this figure points to a(n) Illustration shows two strands of DNA one with 5'-3' end and other with 3'-5' end. Nitrogenous bases are complementary to each other. The arrow shows apurinic site in which a purine is removed by the process of depurination.
apurinic site
Mutations rate ____ the same for every species
are not
How is the TaqMan probe used to monitor real-time PCR?
as amplification increases, fluorescence increases
Site-directed mutagenesis allow a researcher to make a mutation ______.
at a specific sequence of DNA
Which DNA repair mechanism uses DNA N-glycosylases?
base excision repair
The mechanism for reactive oxygen species to cause mutation is __________.
bases are oxidized to a variety of different products which might pair with a different base than the original base could have
How is the amount of DNA produced during real-time PCR measured?
by measuring the fluorescence emitted by the probe added to the PCR mixture
If a gene is amplified by PCR so that there are many copies, it can be said to be ______.
cloned
A DNA molecule that acts as a carrier of DNA that is to be cloned is called a(n) ______.
cloning vector
Cells that can take up DNA from the medium are considered ____ cells.
competent
Transformation occurs when ______.
competent cells take up DNA from the medium
In PCR, primer extension refers to the synthesis of ______ starting at the primers.
complementary DNA
Mutations that change the configuration of a protein at a specific temperature are called __________ mutations.
conditional
Tautomeric shifts are when a nucleotide can change
conformation
A recombinant vector ______.
contains a piece of chromosomal DNA
The presence of a specific plasmid in a bacterial cell may be determined if the plasmid __________.
contains a selectable marker
A vector requires an origin of replication so that it can be ______.
copied many times by the host cell
Restriction endonucleases are used in gene cloning to ______.
cut the DNA backbone prior to inserting the DNA to be cloned
The conversion of cytosine to uracil in DNA is an example of
deamination
The removal of an amine group is known as
deamination
This figure highlights the process of ______. Illustration shows a carbon ringed structure attached to methyl group, oxygen and amino group. Nitrogen is attached to sugar. this is 5-methylcytosine which is deaminated by removal of amino group on addition of water. the amino group is replaced by oxygen and forms uracil. This process is known as deamination.
deamination
The complete loss of either a guanine or adenine from DNA is an example of ____
depurination
The most common type of spontaneous mutation in a cell is
depurination
The most common type of spontaneous mutation in a cell is __________.
depurination
The removal of an adenine or a guanine is known as
depurination
Spontaneous mutations include
depurination, deamination, and errors in DNA replication
Reverse transcriptase PCR can be used to ______.
detect and quantify the amount of specific RNA
Which of these represents the correct order of steps during a typical DNA repair system?
detection -> removal -> replication
The DNA sequencing method developed by Frederick Sanger that became a commonly used method of DNA sequencing is called _____ sequencing
dideoxy
Photolyase in yeast is an example of what kind of DNA repair mechanism?
direct repair
photolyase in yeast is an example of what kind of DNA repair mechanism
direct repair
Photoreactivation is a repair mechanism that can ______ a thymine dimer in the ______ of light.
directly split; presence
Alkylating agents cause mutations by ______.
disrupting the normal pairing between nucleotides within the DNA
You are using CRISPR-Cas technology to introduce a single nucleotide change in a gene of interest in living cells. You are designing your experiment. In which component of the reaction will you engineer the single nucleotide change?
donor DNA
Ataxia telangiectasia is a neurodegenerative autosomal recessive disease that results in severe disability. It is caused by mutations in the ATM gene. The ATM protein has been shown to play a role in both NHEJ and homologous recombination. What types of DNA lesions do you expect to be present in patients with ataxia telangiectasia?
double stranded breaks
Which of the following most likely accounts for the majority of the recombination events during both DNA repair and meiosis?
double-stranded breaks in DNA
The gel retardation assay is also known as the ______.
electrophoretic mobility shift assay
What technique is useful for studying protein-DNA interactions?
electrophoretic mobility shift assay
An antigen has one or more three dimensional structures called ______ to which a(n) ______ will bind.
epitopes; antibody
During the initial phase of a real-time PCR experiment, called the ____ phase, the amount of PCR products is small and reagents are not limiting, so the amount of product nearly doubles with each cycle.
exponential
A mutation in a promoter region that causes the promoter sequence to more closely resemble the consensus sequence is called an up promoter mutation and results in a decrease in transcription
false
A mutation in a promoter region that causes the promoter sequence to more closely resemble the consensus sequence is called an up promoter mutation and results in a decrease in transcription.
false
All suppressor mutations are also considered reversion mutations
false
An individual that is a genetic mosaic would be the result of a germ cell mutation
false
Gene conversion refers to the changing of the DNA sequence of a gene by mutations
false
Gene conversion refers to the changing of the DNA sequence of a gene by mutations.
false
Molecular biologists use restriction enzymes to amplify a specific section of DNA within the genome.
false
Mutations generated during site-directed mutagenesis occur randomly in the genome.
false
Mutations only have an effect when they affect protein coding regions
false
Sister chromatid exchange only occurs during meiosis
false
TNRE repeats frequently result in the addition of extra histidine amino acids to the protein
false
TNRE repeats frequently result in the addition of extra histidine amino acids to the protein.
false
The DNA Pol III enzyme can use mRNA to make a cDNA strand.
false
Translocations never change gen expression, just where a gene is located
false
When using PCR to amplify DNA, short oligonucleotides called primers ______.
flank the region of DNA to be amplified
Knowing the sequence of the DNA ______ the gene of interest allows scientists to design appropriate primers.
flanking
In automated sequencing, each dideoxyribonucleotide is labeled with a different colored ______.
fluorescent dye
Ionizing radiation produces chemically reactive molecules known as ____ ____. These are mutagenic because they alter the structure of DNA.
free radicals
An unexpected observation of the outcome of meiosis in the fungus Neurospora, in which the ratio of orange to white products was 6:2 instead of 4:4, demonstrated which process?
gene conversion
The mutation rate is commonly expressed as the number of new mutations in a given ______.
gene per cell generation
an individual that has somatic regions that are genotypically different from each other
genetic mosaic
Cells that give rise to the gametes such as eggs and sperm are called
germ line
Cells that give rise to the gametes
germ line cells
mutation that can be passed onto offspring
germ line mutation
A cell that harbors a vector is called a
host cell
Treatment of an organism with a mutagen will ____ the mutation rate
increase
The mutation rate ____ a constant for any organism
is not
A cDNA library differs from a genomic DNA library in which way?
it contains only coding sequences, not introns
What does the enzyme DNA ligase do?
it covalently links the sugar-phosphate backbone of DNA
What is the purpose of RNaseH in the making of cDNA?
it generates short RNAs that are used as primers
The wild-type eye color of Drosophila is red. A single-base mutation can occur that produces a white eye color. What statement is correct regarding this mutation?
it is an example of a mutation that likely alters protein function
In gene cloning, how is a suitable vector chosen?
it must replicate in the appropriate cell type
Why would you use a poly-dT primer when making cDNA?
it would be complementary to the poly-A tail at the 3' end of the mRNA
Primers are chosen for PCR based on ______.
knowing the DNA sequence flanking the gene of interest
When cloning a gene into a vector, the sugar-phosphate backbone of each DNA molecule is covalently linked by the enzyme DNA
ligase
A recircularized vector is one that has ______.
ligated with itself
A major advantage of CRISPR-Cas technology over site-directed mutagenesis is that it can be used directly on ____ cells
living
In PCR, the temperature must be ______ from the denaturation temperature in order for primers to anneal.
lowered
cDNA is made using what as the starting material?
mRNA
Select the reagents needed to make cDNA.
mRNA poly-dT primer reverse transcriptase dNTPs
In gene cloning, cells are treated with agents that ______, creating competent cells.
make them permeable to DNA
Which repair mechanism utilizes MutL, MutH, and MutS proteins in E. coli?
mismatch repair
A vector must contain the ____ ____ ____ that is recognized by the species of the host cell and allows the host cell to make lots of copies of the vector
origin of replication
What do you call the DNA sequence in a vector that allows the replication enzymes of the cell to make lots of copies of the vector?
origin of replication
(A) What is occurring to guanine in the image below? Breaking of the C-N double bond and movement of the C-H bond to become N-H while adding C-O double bond
oxidation
Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called __________.
plasmids
Consider the following DNA sequence, which codes for the first portion of a long protein beginning at the ATG (AUG in mRNA) start codon. 5' ATG CCC CGC AGT AGG GGG TGG AGA3' A mutation occurs changing this sequence to: 5' ATG CCC CGC AGT AGG GGG TGA AGA3' What type of mutation is this? (Check all that apply.)
point mutation transition nonsense mutation
Human diseases caused by what type of mutations can be modeled using site-directed mutagenesis?
point mutations
In 1985, Kary Mullis developed a way to copy DNA without vectors or host cells. This technique is called
polymerase chain reaction
During PCR, the process of ____ ____ results when the Taq polymerase catalyzes the synthesis of complementary DNA, starting at the primers
primer extension
During PCR, the process of ____ ____ results when the Taq polymerase catalyzes the synthesis of complementary DNA, starting at the primers.
primer extension
Short oligonucleotides that flank the region of DNA to be amplified by PCR are called
primers
How can PCR amplify one segment of DNA from a complex mixture of potential template molecules?
primers can be designed to flank a specific segment of DNA
Which of the following best describes the function of the RecA protein in E. coli recombination?
promotes strand invasion and formation of the D loop
The DNase I footprinting technique is used to study ____-____ interactions
protein-DNA
A researcher has a DNA sample that was generated from the mRNA extracted from a cell line. The researcher wants to determine specifically how much of gene A was expressed in that cell line. What is one experiment that could be done to quantitively measure the expression of gene A?
real-time PCR
What is the technique that allows one to determine the amount of template DNA present when the PCR cycles began?
real-time PCR
If the two ends of a vector cut with a restriction enzyme ligate back together without an insert, a ____ vector has been created
recircularized
A vector that contains a piece of chromosomal DNA is referred to as a ____ vector
recombinant
The Holliday model is used to determine which of the following
recombination between homologous chromosomes
The Holliday model is used to explain which of the following?
recombination between homologous chromosomes
A translocation that moves a gene from an area of euchromatin to heterochromatin would typically cause a/an __________ in the expression of the gene.
reduction
DNA gap repair synthesis
restores the stretches of DNA removed by strand degradation at the initiation of recomination
Enzymes that bind to a specific DNA sequence and cut the DNA backbone are called
restriction enzymes
The enzyme ____ ____ is used when PCR is employed to detect and quantify the amount of a specific RNA
reverse transcriptase
The enzyme that uses RNA as a template to make a complementary strand of DNA is called
reverse transcriptase
You have a piece of RNA, and you want to synthesize a complementary strand of DNA. What enzyme would you use?
reverse transcriptase
A scientist does not have an antibody to detect the protein of interest, but wants to know if the gene is expressed at low levels. What technique could the researcher use to detect, but not quantify the expression of the gene of interest?
reverse transcriptase PCR
A resistance gene that allows a host cell containing a vector to grow on a toxic substance is called a(n)
selectable marker
The use of dideoxyribonucleotides with different colored fluorescent dyes allows the detection of the ______.
sequence of DNA
Primer annealing occurs when ______.
short oligonucleotides bind to complementary DNA flanking the gene of interest
Which of the following terms is associated with ionizing energy?
short wavelength high energy gamma rays
A plasmid that contains separate origins of replication for two different species is called a/an __________.
shuttle vector
When X-rays and UV light are used to induce mutations, mutations are induced throughout the genome. What is one way researchers can generate mutations in one specifically targeted gene?
site-directed mutagenesis
____-____ ____ allows a researcher to produce a mutation at a specific sequence.
site-directed mutagenesis
all cells of the body excluding the gametes or cells that can give rise to the gametes
somatic cells
a mutation that cannot be passed onto the offspring
somatic mutation
The Maxam and Gilbert method of DNA sequencing used chemicals that cleaved the DNA at ______.
specific bases
In PCR, the template DNA is ______.
the DNA to be amplified
A cloned gene fragment contains a response element that is recognized by a regulatory transcription factor. Previous experiments have shown that the presence of a hormone results in transcriptional activation by this transcription factor. The gel shows a electrophoretic mobility shift assay using the hormone, transcription factor and gene fragment. Explain the action of the hormone.
the hormone binds to the transcription factor and allows it to bind to the gene fragment causing a gel shift
The difference between the polymerases used in translesion synthesis repair and general DNA replication is
the polymerase used in translesion synthesis has a pocket that can accommodate the lesions while DNA pol III's pocket cannot
Which of the following is a step in a PCR?
the primers anneal to the complementary sequences on the template DNA
What occurs during the annealing stage of a PCR reaction?
the primers bind to complementary sequences of the template DNA
You are performing a gel mobility shift assay. In lane 1 you run DNA alone as a control. In lane 2 you run DNA that has been incubated with your protein of interest. After you run the gel, you are surprised to see that the DNA fragments migrated the same distances on the gel in both lanes. What are some possible reasons for this? Select all that apply.
the protein doesn't bind to the DNA You ran a denaturing gel
A researcher is interested in whether or not a transcription factor binds to a specific site on a strand of DNA. However, the sample accidentally contain SDS. What will the electrophoretic mobility shift assay results show?
the protein will not bind to the DNA and the movement of the DNA through the gel will not be affected
A researcher is interested in whether or not a transcription factor binds to a specific site on a strand of DNA. However, the samples accidentally contain SDS. What will the electrophoretic mobility shift assay results show?
the protein will not bind to the DNA and the movement of the DNA through the gel will not be affected
What is the purpose of DNA ligase in a cloning experiment?
the purpose is to reestablish the stable sugar-phosphate backbone of the DNA molecule
When cloning a gene, why must the chromosomal DNA and the plasmid DNA be cut with the same restriction enzyme?
the sticky ends of the plasmid DNA will be complementary to the sticky ends of the chromosomal DNA
In a cloning experiment, you use a vector that contains a lacZ gene near the unique restriction site. If the competent cells are grown on X-Gal and IPTG, which colonies would contain chromosomal DNA?
the white colonies
To perform PCR, a machine called a ____ automates the timing of each cycle
thermocycler
To perform many cycles of PCR, you need a machine that can change temperatures at exact times. What do you call this machine?
thermocycler
What is the origin of restriction endonucleases?
they are a defense mechanism against viruses in bacteria
In PCR, why do the primers bind to specific sites in the DNA on either side of the gene of interest?
they are complementary to the flanking sequences
Which of the following is true about Holliday junctions?
they can be resolved to result in recombinant or non-recombinant chromosomes
Deamination of 5-methyl cytosine results in
thymine
What is the purpose of Northern blotting?
to identify a specific RNA molecule within a mixture of RNA molecules
Why would one use a vector with a selectable marker?
to identify cells containing the vector
How does a bacterial cell use restriction enzymes?
to protect the cell against invasion by bacteriophages
The natural function of the CRISPR-Cas system in bacteria is to ______.
to provide defense against bacteriophages
The process by which competent cells take up DNA from the extracellular medium is called
transformation
How does position effect influence gene expression?
translocations may result in a promoter that is normally used for one gene now controlling an entirely different gene
In the following sequence of DNA, the italicized base has been mutated. What type of mutation is this?5' - G A T C T C C G A A T T - 3' original strand5' - G A T C T C C C A A T T - 3' mutated strand
transversion (G to C)
A heritable change in the genetic material is called a mutation
true
A heteroduplex is a DNA double helix that contains mismatches.
true
A mutation in one gene that compensates for a mutation in another gene to result in the wild-type phenotype is called an intergenic suppressor mutation
true
A vector is a small segment of DNA that a gene of interest is inserted into for cloning.
true
Breakpoints in chromosomes can lead to mutant phenotypes when they occur in the middle of a gene
true
Cloned genes may be mutated outside of a cell by a process called site-directed mutagenesis.
true
HRR usually uses a sister chromatid.
true
R factors typically contain genes for antibiotic resistance.
true
Restriction endonucleases recognize specific sequences in the DNA.
true
Silent mutations are possible due to the degenerate nature of the genetic code
true
Sister chromatid exchange does not result in new allele configurations
true
Somatic mutations will not be passed onto an organism's progeny
true
Some mutations can make a promoter more efficient
true
The Ames test may be used to determine if an agent is a mutagen.
true
The isolation and copying of a gene, usually in large quantities is called gene cloning.
true
The mutation frequency for a gene is the ratio of the number of mutant genes to the total number of copies of that gene in a given population
true
The polymerase used in PCR reactions is derived from the thermophile organism Thermus aquaticus.
true
True or false: Amplifying a gene by PCR results in many copies, just like cloning using a vector and host cell.
true
True or false: Most DNA repair systems involve three major steps: detection of the error, removal of the abnormality, and its replacement with normal DNA.
true
True or false: PCR can amplify one segment of DNA from a mixture.
true
cDNA is made from mRNA therefore, it lacks introns and contains only the coding sequence for the functional protein.
true
You are performing PCR for the first time and you inadvertently leave out dCTP. What will be the results of your PCR?
your PCR will begin, but synthesis of the new DNA fragment will be stopped the first time the polymerase encounters a G in the template (where a C should be inserted)
