AP Bio Exam

Ace your homework & exams now with Quizwiz!

D

27. The observation that the rabbit mRNA was successfully translated in the frog tissues supports which of the following conclusions? (A) Frog cells are able to replace their own hemoglobin with rabbit hemoglobin. (B) Undeveloped frog eggs can be induced to form genetically identical copies of a rabbit. (C) Rabbit hemoglobin can induce an immune response in frogs. (D) Rabbits and frogs share a common genetic code for expressing heritable information.

B

28. The electrophoresis results best support which of the following conclusions? (A) Cell specialization during development results in some cells losing the ability to synthesize proteins. (B) Cells from different tissues share a common ability to use genetic material from a foreign source to produce protein. (C) In comparison with other cells, nerve cells have a superior ability to produce cytoskeletal proteins. (D) Muscle cells produce more b-hemoglobin than do cells from the other tissues in a tadpole.

D

29. Which of the following is the best justification for why the rabbit hemoglobin proteins were found throughout the tadpole? (A) Rabbit mRNA is composed of nucleotides that are more stable than those in frog mRNA. (B) Rabbit hemoglobin is synthesized more efficiently than frog hemoglobin in frog cells. (C) After differentiation, the rabbit hemoglobin proteins move through the circulatory system of the tadpole to every cell. (D) The mRNA injected into the newly fertilized frog eggs is distributed in the cytoplasm of every daughter cell during cell division.

C

30. Which of the following conclusions is most consistent with the results of the experiment? (A) Rabbit mRNA is composed of nucleotides that are absent from frog mRNA. (B) A larger volume of blood circulates through a rabbit than through a frog. (C) The subunits of hemoglobin differ in size, shape, or charge. (D) Synthesis of b-hemoglobin occurs at a faster rate in muscle cells than in other body cells.

A

31. Given that equal amounts of the different mRNAs were injected into fertilized frog eggs, which of the following conclusions is most consistent with the electrophoresis results? (A) b-hemoglobin mRNA is translated more efficiently than is a-hemoglobin mRNA. (B) a-hemoglobin is present only in cells where b-hemoglobin is absent. (C) a-hemoglobin mRNA is more stable than b-hemoglobin mRNA. (D) Tubulin inhibits translation of hemoglobin mRNA

D

33. A student in a biology class crossed a male Drosophila melanogaster having a gray body and long wings with a female D. melanogaster having a black body and apterous wings. The following distribution of traits was observed in the offspring. Phenotype Number of Offspring Gray body, long wings 42 Black body, apterous wings 41 Gray body, apterous wings 9 Black body, long wings 8 Which of the following is supported by the data? (A) The alleles for gray body and long wings are dominant. (B) The alleles for gray body and long wings are recessive. (C) Genes for the two traits are located on two different chromosomes, and independent assortment occurred. (D) Genes for the two traits are located close together on the same chromosome, and crossing over occurred between the two gene loci.

C

35. If chemical signals in the cytoplasm control the progression of a cell to the M phase of the cell cycle, then fusion of a cell in G1 with a cell in early M phase would most likely result in the (A) replication of chromosomes only in the G1 cell (B) exiting of both cells from the cell cycle and into the G0 phase (C) condensation of chromatin in preparation of nuclear division in both cells (D) transfer of organelles from the G1 cell to the cell in the M phase

C

37. In the Arctic Ocean, the predominant primary producers are phytoplankton. Phytoplankton are consumed by zooplankton, which in turn are eaten by codfish. In years when there is more open water (less ice coverage), there are more zooplankton and fish than in years with less open water (more ice coverage). Based on the graph above, the difference is most likely because (A) when there is less open water, light is blocked from the zooplankton, so they cannot produce as much food for the fish (B) when there is more open water, the temperature is warmer, so the zooplankton and fish populations increase in size (C) the ice blocks the light, so in years with more ice coverage, there is less photosynthesis by the phytoplankton (D) the ice increases the light available for photosynthesis, so primary production increases and zooplankton populations increase in size

C

38. The figure above depicts the DNA-protein complex that is assembled at the transcriptional start site of gene X when the expression of gene X is activated in liver cells. Previous studies have shown that gene X is never expressed in nerve cells. Based on the diagram, which of the following most likely contributes to the specific expression pattern of gene X ? (A) Expression of gene X produces large amounts of tRNA but undetectable amounts of mRNA. (B) The general transcription factors inhibit the activation of gene X in liver cells by blocking the activator from binding to RNA polymerase II. (C) The activator is a sequence-specific DNA-binding protein that is present in some tissues but not in other tissues. (D) The enhancer is a unique DNA segment that is added to the nuclear DNA of some cells of an organism during the process of mitotic cell division but not other cells.

B

41. Which of the following provides the best indication that light is required for the activation of electron transfer reactions in chloroplasts? (A) Calculating the rate of change of the absorbance for sample 1 (B) Comparing the observed results for sample 2 and sample 3 (C) Repeating the entire experimental procedure at night (D) Including multiple trials for all the samples

D

42. Which of the following can be reasonably concluded from the experimental results? (A) Chloroplasts must be suspended in a buffer solution to function properly. (B) The optimal temperature for activation of electron transfer is 25°C. (C) DCPIP inhibits biochemical reactions in suspended chloroplasts. (D) Light from a lamp can substitute for sunlight in stimulating chloroplast processes.

C

43. If an additional sample containing the chloroplast/DCPIP solution was placed at a distance of 90 cm from the lamp, which of the following predictions would be most consistent with the experimental results? (A) The concentration of DCPIP in the solution will increase exponentially. (B) The absorbance at 60 minutes will be roughly equal to 1.4. (C) The change in absorbance over time in the solution will be less than that of the other samples. (D) The temperature of the solution will exceed 75°C.

A

44. Which of the following descriptions of photosynthesis best explains the results of the experiment? (A) Availability of electrons for transfer to DCPIP depends on light energy. (B) Movement of DCPIP across chloroplast membranes occurs in less than 60 minutes. (C) Chlorophyll molecules degrade rapidly in the presence of DCPIP. (D) DCPIP can only be used to measure photosynthetic activity at low light levels.

B

45. Which of the following scientific questions could be investigated using a similar experimental setup? (A) How much carbon dioxide is required by a plant cell to produce one molecule of glucose? (B) What wavelength of light best activates electron transfer reactions in chloroplasts? (C) Which molecule in chloroplasts accepts activated electrons from DCPIP during photosynthesis? (D) Are the same genes that are expressed in chloroplasts also expressed in mitochondria?

D

46. The figure above shows a model of a ligand precursor being cleaved to produce an active ligand that binds to a specific receptor. Which of the following is most likely to reduce the binding of the active ligand to its receptor? (A) A change in the cytoskeletal attachment of transmembrane proteins (B) The presence of a large amount of the precursor form of the ligand (C) An increase in the ratio of the number of unsaturated to the number of saturated fatty acid tails of the membrane lipids (D) A mutation in the receptor gene that causes a substitution of a charged amino acid for a nonpolar amino acid in the ligand binding site of the receptor

B

47. Students in a class measured the mass of various living organisms. They then kept the organisms in the dark for 24 hours before remeasuring them. None of the organisms were provided with nutrients during the 24-hour period. The data are as follows. Organism Starting Mass (g) Final Mass (g) Elodea (submerged aquatic plant) 15.10 14.01 Goldfish 10.10 9.84 Sea anemone 25.60 24.98 Which of the following is the best explanation for the pattern of change in mass of the organisms over time? (A) Water loss due to evaporation (B) Cellular respiration (C) The law of conservation of matter (D) Growth and reproduction

B

48. Based on the data shown in Figure 1, which of the following best describes the genotypes of individual family members in the pedigree? (A) All affected individuals possess at least one dominant allele of the hemoglobin beta gene. (B) Healthy individuals may possess one mutant allele (HbS) of the hemoglobin beta gene. (C) Individuals IV and V must be heterozygous for the HbS (mutant) allele. (D) Individuals II and VI possess two copies of the HbA (wild-type) allele.

D

49. The HbS allele, which causes sickle-cell disease, results from a mutation in the DNA sequence shown in Figure 2 that produces a valine (val) in the place of a glutamic acid (glu) residue in the hemoglobin protein. Which of the following mRNA sequences is derived from the HbS allele? (A) 5′ GAC TGA GGA CTC CTC TTC AGA 3′ (B) 5′UCUGAAGAGGAAUCCUCAGUC3′ (C) 5′AGACTTCTCCTCAGGAGTCAG3′ (D) 5′CUGACUCCUGUGGAGAAGUCU3′

A

50. The restriction endonuclease Mst II recognizes the sequence 5′ CCT(N)AG (where N = any nucleotide) and cuts DNA at that site, producing separate fragments. Which of the following best explains the banding patterns exhibited in Figure 4 ? (A) The HbA DNA contains a recognition site for the Mst II restriction enzyme. (B) The HbA/HbS DNA contains three recognition sites for the Mst II restriction endonuclease. (C) Individual I has only one copy of the hemoglobin gene; therefore there is only one band on the gel. (D) The HbS/HbA DNA contains three different alleles for sickle-cell disease.

B

51. Possessing a single copy of the HbS allele has been shown to provide some resistance to infection by Plasmodium falciparum, the parasite that causes malaria. Which of the following individuals represented in the pedigree would have the greatest selective advantage in an area where malaria is common? (A) I (B) II (C) III (D) V

D

53. Ellis-van Creveld syndrome is a recessive genetic disorder that includes the characteristics of short stature and extra fingers or toes. In the general population, this syndrome occurs in approximately 1 in 150,000 live births. In a particular isolated population, however, the incidence of this syndrome among live births is 1 in 500. Assume that both the isolated population and the general population are in Hardy-Weinberg equilibrium with respect to this syndrome. Which of the following best describes the difference between the frequency of the allele that causes the syndrome in the general population and the frequency of the allele in the isolated population? (A) The frequency of the Ellis-van Creveld allele is 0.002 in the isolated population and 0.0000066 in the general population, which suggests that selection for this trait is occurring in both populations. (B) The frequency of the Ellis-van Creveld allele is 0.0447 in the isolated population and 0.0026 in the general population, showing that the rate of genetic mutation is highest among individuals in the isolated population. (C) The frequency of the Ellis-van Creveld allele is 0.002 in the isolated population and 0.0000066 in the general population, which demonstrates gametic incompatibility between the populations. (D) The frequency of the Ellis-van Creveld allele is 0.0447 in the isolated population and 0.0026 in the general population, which suggests that genetic drift has occurred in the isolated population.

A

A common laboratory investigation involves putting a solution of starch and glucose into a dialysis bag and suspending the bag in a beaker of water, as shown in the figure below. The investigation is aimed at understanding how molecular size affects movement through a membrane. Which of the following best represents the amount of starch, water, and glucose in the dialysis bag over the course of the investigation?

B

A group of mice was released into a large field to which no other mice had access. Immediately after the release, a representative sample of the mice was captured, and the fur color of each individual in the sample was observed and recorded. The mice were then returned to the field. After twenty years, another representative sample of the mice was captured, and the fur color of each individual in the sample was again recorded. Which of the following best explains the change in the frequency distribution of fur color phenotypes in the mouse population, as shown in the figures above? (A) The allele for gray fur color is unstable, and over twenty years most of those alleles mutated to become alleles for black fur. (B) The field was composed primarily of light-colored soil and little vegetation, affording gray mice protection from predators. (C) Sexual selection led to increased mating frequency of black and brown versus gray and brown. (D) The gray mice were hardest to capture and so were underrepresented in the twenty-year sample.

A

A new mutation that arose in one copy of gene X in a somatic cell resulted in the formation of a tumor. Which of the following pieces of evidence best describes how the new mutation directly caused the tumor? (A) Protein X normally stimulates cell division, and the mutation created an overactive version of protein X. (B) Protein X normally activates a growth hormone receptor, and the mutation decreased the stability of protein X. (C) Protein X normally prevents passage through the cell cycle, and the mutation created an overactive version of protein X. (D) Protein X normally regulates gene expression, and the mutation created an underactive version of protein X that blocked the cell cycle.

D

A researcher is investigating the relationship between the existing species diversity in a community and the ability of an introduced nonnative species to destabilize the community. Which of the following graphs is most consistent with the claim that communities with high diversity are more resistant to change than are communities with low diversity?

B

Beaked whales feed at various depths, but they defecate at the ocean's surface. Nitrogen-rich whale feces deposited in surface waters supply nutrients for algae that are eaten by surface- dwelling fish. Which of the following best predicts what would happen if the whale population decreased? (A) There would be a reduction in surface nitrogen concentration, which would cause an algal bloom. (B) The surface fish populations would decline due to reduced populations of algae. (C) The remaining whales would accumulate mutations at a faster rate. (D) The remaining whales would be forced to forage in the deepest parts of the ocean.

B

Cystic fibrosis is a recessively inherited disorder that results from a mutation in the gene encoding CFTR chloride ion channels located on the surface of many epithelial cells. As shown in the figure, the mutation prevents the normal movement of chloride ions from the cytosol of the cell to the extracellular fluid. As a consequence of the mutation, the mucus layer that is normally present on the surface of the cells becomes exceptionally dehydrated and viscous. An answer to which of the following questions would provide the most information about the association between the CFTR mutation and the viscous mucus? (A) Is the mucus also secreted from the cells through the CFTR proteins? (B) How does the disrupted chloride movement affect the movement of sodium ions and water by the cell? (C) How does the mutation alter the structure of the CFTR proteins? (D) What is the change in nucleotide sequence that results in the CFTR mutation?

D

H+➕HCO3- ↔️ ̈H2O➕CO2 The equation above shows one of the reversible reactions that occur in blood. After exercise, an athlete's blood pH has dropped below the normal level. How will normal blood pH be restored? (A) An increase in O2 concentration in the plasma willleadtoanincreaseinH+ concentration. (B) An increase in temperature will lead to an increaseinH+ concentration. (C) An increase in sweating will lead to a decrease in OH- and H+ concentration. (D) An increase in breathing rate will lead to a decrease in blood CO2 and H+ concentration.

C

If ATP breakdown (hydrolysis) is inhibited, which of the following types of movement across cell membranes is also inhibited? (A) Movement of oxygen into a cell (B) Movement of water through aquaporins (C) Passage of a solute against its concentration gradient (D) Facilitated diffusion of a permeable substance

B

If the experiment was continued for an additional 500 days, the population density of T. castaneum with the parasite would most likely stabilize at a value closest to which of the following? (A) 5 beetles/culture dish (B) 10 beetles/culture dish (C) 20 beetles/culture dish (D) 25 beetles/culture dish

A

In 1944 Avery, MacLeod, and McCarty performed transformation experiments using live, harmless bacteria and extracts from virulent bacteria treated with various enzymes. Which of the following enzymes were used and why? (A) Proteases and RNases to rule out protein and RNA as the transforming factors (B) Lipase (an enzyme that facilitates the breakdown of lipids) to rule out lipoproteins as the transforming factor (C) Kinase (an enzyme that facilitates transfer of a phosphate group from ATP to a substrate molecule) to show that transformation is phosphorylation dependent (D) ATPase to show that transformation is not dependent on ATP

D

In Figure I, the difference between the two curves can best be attributed to which of the following? (A) The difference between controlled laboratory conditions and the natural environment (B) The effect of the host on its parasite (C) The influence of competition for limited resources (D) The natural variation among populations

B

Initially, which of the following isolating mechanisms is likely to have been the most important in preventing gene flow between the two populations of Rhagoletis? (A) Gamete incompatibility (B) Temporal isolation (C) Mechanical isolation (D) Reduced hybrid viability

C

Matings between individuals from the two populations of Rhagoletis produce hybrid flies that appear to be healthy and have normal life spans. The eggs laid by these hybrid flies, however, hatch less often than those of flies from either of the two populations. What isolating mechanism seems to be important in this hybrid population? (A) Prezygotic isolation (B) Mechanical isolation (C) Reduced hybrid fertility (D) Habitat isolation

D

Rosalind Franklin's x-ray diffraction images taken in the 1950s most directly support which of the following claims about DNA? (A) The ratios of base pairs are constant. (B) The nucleotide sequence determines genetic information. (C) The two strands of DNA are antiparallel. (D) The basic molecular structure is a helix.

D

Scientists have found that the existing populations of a certain species of amphibian are small in number, lacking in genetic diversity, and separated from each other by wide areas of dry land. Which of the following human actions is most likely to improve the long-term survival of the amphibians? (A) Cloning the largest individuals to counteract the effects of aggressive predation (B) Reducing the population size by one-fifth to decrease competition for limited resources (C) Constructing a dam and irrigation system to control flooding (D) Building ponds in the areas of dry land to promote interbreeding between the separated populations

B

The data over the duration of the experiment provide the strongest support for which of the following conclusions regarding the effect of the parasite on Tribolium populations? (A) T. confusum is adversely affected by the parasite, while T. castaneum is not. (B) T. castaneum is adversely affected by the parasite, while T. confusum is not. (C) Both T. confusum and T. castaneum are adversely affected by the parasite. (D) Both T. confusum and T. castaneum show increased fitness in the presence of the parasite.

A

The divergence between the two populations of Rhagoletis must have occurred very rapidly because (A) the apple tree was imported into North America with European settlement approximately 200 years ago (B) flies were imported into North America with European settlement approximately 200 years ago (C) long-distance rail transport of fruit increased only after the American Civil War (1861-1865) (D) heavy use of gunpowder during the American Civil War (1861-1865) led to increased mutation rates in many natural populations of plants and animals

B

The processes illustrated in the models depicted above all result in which of the following? (A) Transcription (B) An increase in genetic variation (C) An increase in the chromosome number (D) Horizontal gene transfer

B

The vertebrate forelimb initially develops in the embryo as a solid mass of tissue. As development progresses, the solid mass near the end of the forelimb is remodeled into individual digits. Which of the following best explains the role of apoptosis in remodeling of the forelimb? (A) Apoptosis replaces old cells with new ones that are less likely to contain mutations. (B) Apoptosis involves the regulated activation of proteins in specific cells of the developing forelimb that leads to the death of those cells. (C) Apoptosis involves the destruction of extra cells in the developing forelimb, which provides nutrients for phagocytic cells. (D) Apoptosis in the developing forelimb triggers the differentiation of cells whose fate was not already determined.

C

Thrips are insects that feed on rose pollen. Scientists noted that the thrips population increased in the spring and decreased dramatically during the summer. The researchers hypothesized that food abundance was the limiting factor for the population. Which of the following types of data would be most useful for the scientists to collect at regular intervals on a designated test plot of rose plants? (A) Amount of sunlight (hours/day) (B) Mean temperature (∞C) (C) Density of rose pollen produced (g/m2) (D) Amount of pollen produced by each flower (g/flower)

C

Under which of the following conditions is the observed number of beetles per culture dish the greatest? (A) T. confusum with parasite at 500 days (B) T. confusum without parasite at 300 days (C) T. castaneum with parasite at 100 days (D) T. castaneum with parasite at 600 days

B

Undersea landslides can disrupt marine habitats by burying organisms that live on the ocean floor. The graph above shows the size of a population of a certain organism that lives on the ocean floor. The population was affected by a recent landslide at the time indicated on the graph. Which of the following best predicts how the population will be affected by the landslide? (A) The surviving organisms will evolve into a new species. (B) The reduced population will likely have allelic frequencies that are different from the initial population. (C) The population will adapt to deeper waters to avoid future landslides. (D) The reduced population will have a greater number of different genes than the initial population.

D

What most likely causes the trends in oxygen concentration shown in the graph above? (A) The water becomes colder at night and thus holds more oxygen. (B) Respiration in most organisms increases at night. (C) More organisms are respiring at night than during the day. (D) Photosynthesis produces more oxygen than is consumed by respiration during the day.

B

Which of the following questions is most relevant to understanding the Calvin cycle? (A) How does chlorophyll capture light? (B) How is ATP used in the formation of 3-carbon carbohydrates? (C) How is NADP+ reduced to NADPH? (D) How is ATP produced in chemiosmosis?


Related study sets

Mastering Biology: Chapter 5 (9/2/17)

View Set

Final Exam: Black Board Quiz Questions + Other Q's

View Set

Series 6: Retirement Accounts (Individual Retirement Accounts)

View Set

CLEP Exam - Principles of Management

View Set