bio lab final
An herbal supplement study is conducted with a research population of 1000 men. Should a woman be skeptical when using the drug?
- women should be skeptical. there are known differences between women and men that may cause a drug to react differently in each
When we compare the alignment of 2 sequences, we often analyze:
--the nucleotide similarity between the input sequence and matched sequences from the database --the length of the input sequence and the matched sequence from the database --the likelihood the matched sequence is a random match to the input sequence ***all of the above
According to the CDC, which of the ticks below are the most common ticks that transmit Rickettsia?
-american dog tick -rocky mountain wood tick
Mathematical models are often used in science because they:
-can be used to help describe things too small or too large for experimentation -provide a low-cost alternative to lab experimentation -allow scientists to alter parameters and determine the effect of those parameters
Mathematical models must be evaluated carefully because they:
-include assumptions that may not accurately reflect real-world events -have a finite number of variables
Mathematical models make assumptions in order to control for one or more variable that may be unknown. Which of the following are assumptions that were made in our mosquito model in lab
-infected humans remained in the population and have the potential to be bitten repeatedly -one bite is sufficient to transmit disease
We used pre-made gel cassettes in the laboratory this week, what advantage do researchers gain by using pre-made gels?
-reduced run time -easier loading
Electrophoresis is used to:
-seperate and visualize DNA fragments
Why do we include a positive control?
-so we know what a positive hit band looks like on the gel - so we know if the PCR reaction didn't work
A student ran their same sample out on 3 different gels. The gels all showed different banding patterns, what could be one reason for this?
-the gels were different % agarose - a different voltage and time was used for running the gels
When analyzing Sanger sequencing results, what does the chromatogram show you?
-the sequence of the DNA -how well the computer was able to match or call which nucleotide was being incorporated - different colors for different nucleotides ***all of the above
Which of the following factors should cause you to think twice about the data presented?
-the study was only performed on one race -the study did not consider the age of the participants -the study did not include a control group *****all of the above
A student ran 12S tick DNA out on a gel on got the following image. The student was concerned that they did not get a band around 218 bp in lanes 5 and 6 like they did in lanes 1-4. What reasons could there be that the there was no DNA visible around 218 bp in lanes 5 & 6?
-those samples were the negative control -the DNA sequence was not amplified. there were likely problems with the PCR reaction
Why do we put data into graphs rather than just listing it in a table
-to investigate trends -to illustrate your data visually
You made a 10% agarose gel and a 1% agarose gel, which gel would DNA migrate faster through?
1%, because the gel is more porous and the DNA can move through the open space easier
What is the standard deviation values 6, 8, 2, 4?
2.2
Using the image below, answer the following question: A student was looking for a mutant strain of tick DNA. If the tick was a mutant than it would not get DNA in the lane at 540 bp. You are given the following information. Lane 1 is the DNA ladder, Lane 2 is the negative control, and lanes 3-17 have tick sample DNA in them. Based on this information which lanes have mutant ticks.
3, 4, 6
If each lab had 5 ticks and there are 6 labs total. What is the total sample size of ticks for all labs?
30
What is the mean of the following values: 6, 8, 2, 4
5
A zoonotic disease is:
A disease that originates in animals and passes to humans.
DNA possesses:
A negative charge.
In the orignal style Sanger Sequencing Gel,x-ray film was used to determine the sequence of a segment of DNA. Which the following is a possible DNA sequence of the DNA fragement?
AGAAGACCCTCCGCCGTACGG
A spectrophotometer makes use of which law to determine concentrations
Beer's Law
Which of the following statements is TRUE regarding climate change?
Climate change is a result of an increase in greenhouse gas build-up that results in reduced solar radiation emission into space
If a student only added Forward primer to the PCR reaction tube and not the Reverse Primer, what do you think the outcome of the reaction would be?
DNA would be amplified, but you would not amplify your region of interest in the tick genome.
According to the World Health Organization Scientific Working Group, which vector-borne disease is the most rapidly spreading vector-borne disease?
Dengue
What information does the E-value from a BLAST search provide?
How likely the match occurs by chance
What does the Percent Identity statistic tell you?
How many nucleotides in the input DNA sequence are identical to the matched sequence in the database
When looking a scientific study, which of the following is/are important to consider? I. Who collected the data. II. Where the article was published. III. How famous the author is. IV. The funding of the study.
I, II and IV only
Any model has limitations based on the assumptions used to develop the model. For example, in our vector-borne disease model developed in class, we assumed that an infected individual will remain available in the population to be bitten by a second mosquito. In reality, an individual may die from the disease or other causes and they are no longer available. Think about the behavior of mosquitoes and people. Which of the following scenarios has the potential to alter transmission dynamics such that a model that is developed may not accurately reflect actual vector-borne disease transmission in the environment? I. Some individuals in the population are vaccinated against the disease and are 'resistant' to active infection. II. The disease agent being transmitted suddenly mutates and can be transmitted by more than one type of vector. III. Individuals with weakened immune systems are found to quickly succumb to the infection and die. IV. A researcher discovers that only female species of the transmitting vector are able to actively transmit the disease
I, II, III and IV
Climate change can impact both vector-borne and zoonotic disease transmission because: I. increased rainfall will create more mosquito breeding grounds II. the life cycle of the animal hosts can be affected III. with increased temperatures, there may be an increase in the reproductive rate of the parasite IV. humans will be more likely to move from cities to rural, forested areas
I, II, and III only
Why do scientists load DNA of known sizes into the agarose gel?
It makes it easier to determine sizes of unknowns using comparison techniques.
Who discovered Polymerase Chain Reaction (PCR)?
Kary Mullis
Clark was not careful when setting up his PCR reaction and does not heat up his reaction mixture to 95°C in the beginning of the PCR reaction. What will be the outcome of his PCR reaction?
No DNA will be amplified because the DNA is not available as a template. The hydrogen bonds have not been broken on the double-stranded DNA
If a study was published many years ago, does that make it invalid?
No, but depending upon the technology used, caution should be taken when evaluating the results.
Should a drug study be ignored if it was performed on animals instead of humans?
No, but it should cause us to think about the results.
Sam is hastily completing the PCR reaction and accidentally leaves out the PCR Master Mix which contains the Taq polymerase and nucleotides. Do you think Sam's PCR reaction would still work?
No, those are key ingredients for the extension step of the PCR reaction.
Which states account for the majority of Rocky Mountain Spotted Fever?
North Carolina, Oklahoma, Arkansas, Tennessee, Missouri
If I had an E-value =1; how confident should I be in the match?
Not confident, you cannot tell if the hit was due to chance.
Which of the following would be the appropriate negative control for the PCR experiment conducted in lab?
PCR-grade water
Cameron was working in the lab and wanted to check the purity of a sample of DNA extracted from a Lone Star tick. Cameron got the following readout: A260 = 0.400 A280= 0.200 The A260/280 ratio is: ___________ and the DNA is considered ______________
Ratio=2, DNA=pure
Using the image below, and what you learned in lab, which of the tick related diseases are you more likely to contract in Alabama?
Rocky mountain spotted fever
What living organism do we get agarose from?
Seaweed
Sam is working in the Tick lab and isolates DNA from a virus. Sam is interested to know whether the virus is a DNA virus or an RNA virus. Sam receives back the following sequence information from the company, Operon, in Huntsville, AL. Which sequence represents a DNA sequence? Based on the information learned in lab this past week, what could Sam use to help determine confirm
Sequence I and using spectrophometer to examine optical density at wavelength 260/280nm
The rate at which DNA migrates through the gel is determined by:
Size of the DNA and the agarose gel concentration.
Which ingredient is important for DNA synthesis during the extension step?
Taq polymerase
If you got no bands in any of the lanes of your Rickettsia gel (except the DNA ladder), it probably that means:
That your PCR reaction did not work
If you accidentally forgot to turn off your gel after 15 minutes and let it run longer, you would expect to see:
The DNA bands would have greater separation between them
How may Sanger sequencing be useful when trying to determine the cause of a blood disorder?
The DNA sequence would allow a researcher to determine if there was a mutation in a blood protein gene.
What does the "N" in the DNA sequence that we received back from sequencing mean?
The data was too noisy to "call" which nucleotide (A, T, G, C) it was.
What would make you most skeptical about a study?
The funding sources show a conflict of interest
Another important consideration when examining a study is sample size. Sample size is:
The number of subjects/animals used in the study
E-cigarettes have increasingly gained in popularity over the past 5 years and many former cigarette smokers have turned to e-cigarettes as a tobacco alternative. There are growing concerns that e-cigarettes are equally as dangerous as cigarettes, but have less restricted marketing and sales regulations. Recently, the Centers for Disease Control and Prevention released data showing money spent on e-cigarette advertising and e-cigarette youth among youth. Using information learned in the graph, if you were to model e-cigarette use among youth from 2016-2020 with strict advertising regulations that prevent advertisements targeting individuals <30 years of age and an increased tax on e-cigarettes, what would the graph of e-cigarette use among youth look like?
The red line will progressively decline from 2015 - 2020 as the number of youth using e-cigarettes slowly declines
As our global climate changes, it is predicted vector ranges will expand. What impact will these changes have on outbreaks of water-, mosquito-, and rodent-borne diseases?
There will likely be a change in the range of vector-borne diseases. Once can presume vector-borne diseases will expand into higher latitudes.
How do RNA molecules differ from DNA molecules?
They have a different set of nucleotides
Why do we include a negative control?
To control for handling and accidental contamination with DNA
Why do we include a negative control?
To control for handling and accidental contamination with tick DNA
Why are we running our PCR product on a gel?
To determine if we amplified our region of interest
One goal of our laboratory project is to determine the percentage of ticks in Alabama that carry the bacterial pathogen, Rickettsia spp. How do you think we could use PCR to answer this question?
Use primers for Rickettsia spp. on the already extracted tick DNA to run a PCR reaction, examine the products on a gel and compare to the positive control amplification. Once we know how many ticks are positive for Rickettsia spp., we can calculate what percent are infected.
What does BLAST do?
Uses a computer algorithm to compare the input sequence to all sequences in the database
Which of the following may provide more accurate data for determining the genus and species of an organism? Be sure to read each answer choice and select the best response.
Using a taxonomic key and DNA evidence because features are not always easy to distinguish and DNA evidence may be more precise.
Known examples of vector-borne diseases include:
West Nile Virus and Lyme Disease
When is one instance when it might be okay to not have a control group in a study?
When there is an ethical reason, such as harm
Which of the following are nucleotides used for PCR:
adenine, guanine, cytosine, and thymine
We extracted our tick DNA using
ammonium hydroxide and boiling
PCR is a method used to:
amplify the copies of a gene using a defined chemical reaction
The genomic revolution can best be described as:
an increase in the number of genomes sequenced that coincided with a decrease in the cost of sequencing.
Which graph type might you see being displayed either horizontal or vertical, depending upon the message that is being conveyed
bar chart
The three key steps in PCR include:
denaturing, annealing, and extension
DNA can be extracted from cells using which of the following:
detergent, protease, and ethanol
In each round of PCR, the number of copies of each gene increases:
exponentially
In a PCR reaction, the primers are responsible for:
flanking the area of DNA that you would like to copy
DNA can be quantified using which of the following techniques:
gel analysis or spectrophotometer analysis at 280nm
What does the variance tell you about your sample?
how far each value in the data set is from the mean
Which graph could you use to investigate rate of change, or the slope?
line graph
DNA consists of:
nucleotides (A, T, C, G)
Which of the following correctly lists ingredients needed for PCR?
nucleotides, polymerase, template DNA, primers
What type of graph/chart does the data add up to 100%?
pie chart
A vector-borne disease:
results when a pathogen is transmitted from its animal host to humans or from humans to humans via an intermediate (e.g. mosquito, tick, flea).
Which chart type allows you to see relationships between quantitative data best?
scatter plot
The average or mean can be described as?
the sum of your observation divided by the sample size
Which piece of equipment is used for PCR?
thermal cycler
To bisect a specimen means:
to cut it in half
All living things have DNA which codes for the production of protein molecules that maintain cell function.
true
The decrease in sequencing cost has led to such a large volume of sequencing data that lack of available computing power is now a major limitation in analyzing the data.
true
What is one thing that a bar chart can show that a pie chart cannot?
variation
