BIO Test 3

Ace your homework & exams now with Quizwiz!

How do Chromatin remodelers reorganize nucleosomes? What do Chromatin modifiers add?

by sliding, moving, or modding their protein composition. acetyl or methyl groups to histones to activate or repress gene activity, respectively

What occurs when CpG islands are unmethylated?

chromatin in promoter region open, allowing access by TF and RNA pol.

Sequences rich in CpG ("CpG islands") are targeted for methylation. What does this cause?

chromatin to condense and represses transcription

Which regulatory sequences act only on one copy of the chromosome?

cis-acting regulatory sequences

What are Insulator sequences? What do they do?

cis-acting, protein-binding sequences; prevent enhancers from turning on the wrong genes at the wrong time.

Methylated histones ___ chromatin, while unmethylated histones tends to ___ chromatin.

close, open

In yeast, if you want to prevent the Gal4 regulatory protein from binding near each of the GAL genes, which sequence element would you target? homeodomain motif enhancer sequence core promoter proximal elements upstream activator sequence

upstream activator sequence.

promoter sequence is likely to be:

upstream of the gene it controls

enhancer sequence is likely to be located where? Is its function depended on its orientation?

upstream of the gene it controls. no

Which of the following may be located tens of kilobases away from the transcriptional start site?

Enhancer sequences

Which of the following covalently connects segments of DNA? helicase DNA polymerase III DNA polymerase I primase ligase

ligase

What are the products of semiconservative replication for a double-stranded DNA molecule?

Two double-stranded DNA molecules, each consisting of one parental strand and one daughter strand.

What did Watson and Crick discover about the double helix?

Watson and Crick made models to try and understand DNA's shape. To help them construct their model they used Franklins "photo 51" along with her analysis. They realized that the nitrogenous bases complemented/attracted each other. The strands are antiparallel meaning the 2 strands of DNA run on opposite sides of each other making the nitrogenous bases on both strands come to contact near the center. Each strand carries a sequence of nucleotides arranged like a ladder. Hydrogen bonds are what keep the nitrogenous bases together.

Which of the sequences can fully base-pair with itself?

5'-AAGCGCTT-3'

Where is DNA found in prokaryotes and eukaryotes?

Prokaryotes: cytoplasm Eukaryotes: nucleus

What is the function of RNA polymerase in the process of transcription?

RNA polymerase are enzymes which transcribes DNA into RNA

The process of converting DNA to RNA is called

Transcription

In the GAL gene system, ________ are cis-acting regulatory elements.

UAS

Which amino acid in histone tails is the most frequent target for acetylation?

lysine

What is the function of DNA polymerase III?

to add nucleotides to the end of a growing DNA strand

Stages in which the lagging strand is synthesized:

1. DNA polymerase begins synthesizing the lagging strand by adding nucleotides to a short segment of RNA. 2. After each strand of the lagging strand is complete, it is released from the DNA polymerase. 3. A different DNA polymerase replaces the RNA segments with DNA. 4. DNA ligase seals the gaps between the pieces, and eventually forms a continuous strand.

An Okazaki fragment has which of the following arrangements? 3' RNA nucleotides, DNA nucleotides 5' DNA polymerase I, DNA polymerase III primase, polymerase, ligase 5' DNA to 3' 5' RNA nucleotide, DNA nucleotide 3'

5' RNA nucleotide, DNA nucleotide 3'

The zygote of an organism has 10 pairs of homologous chromosomes. The total number of chromosomes in the germ cell of the organism is _____________. (enter numeric answer below)

Given below is the DNA sequence of a short protein: AUGACGCUAGCCGCAGCGAGCCACCUAGGAGGAUGA How many amino acids will the protein translated from this sequence have?

11- the last codon is a stop codon and isn't translated into anything. It just stops translation.

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?

12%

The molecular weight of NaCl is about 60 g/mol. How much NaCl is needed to make 0.5 L of a 500 mM solution? _______ g

The A+T/G+C ratio of the DNA of Bacillus quizzencis is 1.5. Therefore the % of C residues in the DNA is _______?

20%

Cytosine makes up 24% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine?

24%

Suppose you feed radioactive dTTP to bacteria for 2 generations. Then you isolate the DNA from the bacterium. If you denature the double stranded DNA and measure the radioactivity in the single strands, the fraction of single strands containing radioactivity will be ____

3/4

A carbon-13 atom has 6 protons and 7 neutrons. How many valence electrons does a carbon-13 atom have? (give a numerical answer below)

A plant homozygous for the unlinked dominant alleles A, B and G is crossed with another plant that is homozygous for the recessive alleles a, b and g. How many different genotypes in the F2 population will give rise to the ABg phenotype?

Which of the following sequences is complementary to the DNA strand with sequence: 5'-TCCGAGCTA- 3'?

5' -TAGCTCGGA- 3'

A DNA strand with the sequence 3' GTGAACTGC 5' is complementary to the sequence

5' GCACTTCAC 3'

Below is a piece of double stranded DNA. If RNA polymerase is moving from left to right , what is the product? 3'-GGACT-5' 5'-CCTGA-3'

5'-CCUGA-3'

When 15 g of NaCl is dissolved in water to a final volume of 500 mL the concentration of the solution is 500 mM. What is the molecular weight of NaCl? ______ g/mol

How many different types of gametes can be produced by a plant with genotype AaBbCcDdEeFf?

Drosophila melanogaster, the common fruit fly, has 4 chromosomes in each of its gametes. How many chromosomes are in each somatic cell?

If the percentage of guanine in E.coli is 26%, then the percentage of other nitrogenous bases would be:

Adenine=24%, Thymine=24%, Cytosine=26%

Which binding site on the ribosome does the recruited tRNA bind to first? - A - P - E

In an analysis of the nucleotide composition of DNA, which of the following will be found? G + C = T + A A = G and C = T A = C A + C = G + T

A + C = G + T

In DNA replication, which nucleotides would pair up with the following nucleotides? A C G

A ---- T C ---- G G ---- C

Which researcher used radioactivity markers in experiments to show that DNA was the genetic material in cells?

Alfred Hershey and Martha Chase

What was the significance of Frederick Griffith's experiments with Streptococcus pneumoniae?

He showed that the DNA from strain S cells could transform strain R cells.

Which sequences is complementary to a DNA strand with sequence: 5' -TCCGAGCTACGTT- 3'? Express your answer with letters only, but be sure to write it in the 5' to 3' direction.

AACGTAGCTCGGA

What are the possible ways that a mutation may affect an organism?

A mutation in an organism causes the wrong protein to be produced or the cycle to be stopped. This can result in a silent mutation, where the letter is changed but the amino acid remains the same, a missense mutation where the amino acid specified is changed, or even worse, a nonsense mutation, where the cycle is stopped when it is not supposed to causing the protein to be unfinished.

Which of the following best describes the addition of nucleotides to a growing DNA chain? A nucleoside diphosphate is added to the 3' end of the DNA, releasing a molecule of phosphate. A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside monophosphate is added to the 5' end of the DNA. A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of phosphate.

A nucleoside diphosphate is added to the 3' end of the DNA, releasing a molecule of phosphate.

What process changes one type of bacteria into another?

A signal in DNA that indicates to an enzyme where to bind to make RNA, transcription.

The anticodon of a particular tRNA molecule is A. complementary to the corresponding mRNA codon. B. complementary to the corresponding triplet in rRNA. C. the part of tRNA that bonds to a specific amino acid. D. catalytic, making the tRNA a ribozyme.

A. complementary to the corresponding mRNA codon.

Histone acetylation ________ transcription; whereas DNA methylation _________ transcription. A. promotes; reduces B. None of the options C. slows down; speeds up D. reduces; promotes

A. promotes; reduces

The higher order structure of DNA shows symmetry, whereas the higher order structures of most proteins do not. Why isn't protein shape more regular like DNA? DNA has one main function in cells whereas proteins have many. The many different amino acid R groups on proteins confer many different shapes. Some S amino acids cause proteins to bend; others cause protein to flatten. All of the above

All of the above.

Proteins are polymers of what type of molecule? - Carbohydrates - Nucleic acids - Sugars - Amino acids

Amino Acids

Which of the following is true of DNA replication? The preexisting strand is read in the 5' _ 3' direction. The new strand is made in the 3' _ 5' direction. An RNA primer is needed to begin DNA synthesis. All of the above are true of DNA replication. More than one, but not all, are true of DNA replication.

An RNA primer is needed to being DNA synthesis.

What did the X shaped pattern in the center reveal about the structure of DNA?

An X-shaped pattern was discovered - showed that the strands in DNA are twisted around each other like the coils of a spring. other clues suggested that the nitrogenous bases are near the center of the DNA molecule.

What are the discoveries that led to the modeling of DNA?

Chargaff discovered base pairing rules. Franklin took X-ray photographs that revealed that DNA has a spiral structure. This finding helped Watson and Crick create a model of DNA and discover the double-helix.

Why is DNA replication essential for a cell?

An organism must copy its DNA to pass genetic information to its offspring.

______________________ is the overall direction of two ____________________ strands of DNA relative to one another so that the _________________ run opposite of each other.

Antiparallel; complementary; 5' to 3' orientations

How is the Gal4 protein inactivated? By binding to the Gal80 protein By binding to glucose-1-phosphate By binding to galactose By binding to the UASG

By binding to the Gal80 protein

Which of these could lead to conversion of a proto-oncogene into an oncogene? A. Amplification of a proto-oncogene through gene duplication. B. Translocation of proto-oncogenes near an active promoter. C. All of these D. A point mutation in proto-oncogene or its regulatory elements

C. All of these

What is meant by the term chromatin remodeling?

Chromatin remodeling includes altering chromatin structure by altering the composition of histones within nucleosomes. Chromatin remodeling includes altering chromatin structure by altering the positioning of nucleosomes with respect to specific DNA sequences.

A mutation occurs in a cell that affects the replication process. The result is that after a DNA strand replicates, it is paired with numerous DNA segments that are each a few hundred nucleotides long. The mutation is in a gene encoding

DNA ligase

A pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following? A. The RNA polymerase enzyme breaks off and re-attaches to the DNA strand at intervals. B. There is redundancy in the genetic code. C. Several stretches of termination sequences occur within pre-mRNA. D. Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing. E. Ribosomes repeatedly pause and reinitiate translation after skipping several nucleotides.

D. Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.

Describe the ways mutations can affect DNA and chromosomes.

DNA - substitution: switching a letter in the mRNA sequence - deletion: deleting a letter in the mRNA sequence - insertion: inserting the wrong codon to match the mRNA Chromosomes - Deletion: the loss of one or all of the chromosome - Duplication: produces an extra copy of all or part of a chromosome - Inversion: reverses the direction of parts of the chromosome - Translocation: when part of the chromosome breaks off and attaches to another

Which enzyme breaks the hydrogen bonds during replication? Replication fork Stabilizing proteins DNA helicase ATP

DNA Helicase

Which enzyme catalyzes the elongation of a DNA strand in the 5' →♦ 3' direction? DNA ligase DNA polymerase III topoisomerase primase helicase

DNA Polymerase III

Suppose you are provided with an actively dividing culture of E. coli bacteria to which radioactive thymine has been added. What would happen if a cell replicates once in the presence of this radioactive base?

DNA in both daughter cells would be radioactive.

What are the key roles of DNA?

DNA is a deoxyribonucleic acid that holds the code on how to make proteins. DNA, or deoxyribonucleic acid, is a long chain molecule that plays a central role in life on earth. The information encoded in strands of DNA controls the genetic makeup of organisms. The DNA molecule has a backbone of sugars and phosphate groups off of which hang simpler units called nucleotide bases. DNA contains only four bases, called A, T, C and G. The sequence of the nucleotides along the backbone encodes genetic information. The four roles DNA plays are replication, encoding information, mutation/recombination and gene expression.

What characteristic of DNA allows two connected DNA polymerases to synthesize both the leading and lagging strands? DNA is flexible. DNA is double-stranded. DNA has a helical shape. DNA is antiparallel.

DNA is flexible

The molecule that seals the gaps between the pieces of DNA in the lagging strand is RNA. the leading strand. DNA ligase. DNA polymerase. the replication fork.

DNA ligase

Which statement about DNA replication is FALSE? DNA ligase adds nucleotides to the lagging strand. The two strands of parental DNA are separated during DNA replication. DNA polymerase builds a new strand by adding DNA nucleotides one at a time. Because the two strands of parental DNA run in opposite directions, the new strands must be made in different ways. The lagging strand is made of a series of pieces that must be joined together to make a continuous strand.

DNA ligase adds nucleotides to the lagging strand.

Which of the following build(s) new strands of DNA? The origins of replication DNA polymerases The lagging strand The leading strand Parental DNA

DNA polymerase Correct; DNA polymerases build new strands of DNA by adding DNA nucleotides one at a time.

Which of the following removes the RNA nucleotides from the primer and adds equivalent DNA nucleotides to the 3' end of Okazaki fragments? ligase DNA polymerase I primase DNA polymerase III helicase

DNA polymerase I

A new DNA strand elongates only in the 5' to 3' direction because

DNA polymerase can only add nucleotides to the free 3' end.

When a DNA molecule is replicated, how do the new molecules compare with the original molecule?

DNA replication begins with the "unzipping" of the parent molecule as the hydrogen bonds between the base pairs are broken. Once exposed, the sequence of bases on each of the separated strands serves as a template to guide the insertion of a complementary set of bases on the strand being synthesized. The two strands are identical

Silencer

DNA sequence that binds regulatory proteins that inhibit transcription

Enhancer

DNA sequence that binds regulatory proteins that interact with promoter-bound proteins to activate transcription

Promoter

DNA sequence where RNA polymerase binds and begins the process of transcription

The overall conclusion of the Hershey-Chase experiment was that DNA was responsible for heredity proteins and DNA were responsible for heredity the ratio of Adenine to thymine was always the same phage DNA was similar to bacterial DNA

DNA was responsible for heredity

What did Avery conclude caused transformation?

DNA was the transforming factor; meaning it stores and transmits genetic information form one generation to another.

What is Closed chromatin?

DNA-histone interactions are strong and regulatory sequences are not accessible; transcription is silent.

What causes open chromatin?

DNA-histone interactions are weak and regulatory sequences are accessible; transcription proceeds.

Molecular biologists can determine experimentally whether a region of DNA contains closed chromatin or open chromatin by assessing the sensitivity of the region to ___

DNAse

Which enzyme cuts double-stranded RNAi precursors to 21-25 base-pair segments?

Dicer

Which enzyme cuts double-stranded RNAi precursors to 21-25 base-pair segments? RISC Argonaute Dicer Drosha

Dicer

Different types of cells in your body look and function differently. The basis for these differences is Different types of DNA in each cell Different amounts of DNA in each cell Different numbers of chromosomes Different patterns of gene expression

Different patterns of gene expression

DNA replication is semiconservative in nature because

Each new double-stranded DNA helix contains one completely old strand and one completely new strand.

What are the components and structure of a DNA nucleotide?

Each nucleotide has three parts:5-carbon sugar called deoxyribose, a phosphate group, and a nitrogenous base. Explain how Chargaff's rules helped Watson and Crick model DNA. That adenine bonds only to thymine and cytosine bonds only to guanine.

What are the chemical compounds of DNA?

Each strand of a DNA molecule is composed of a long chain of monomer nucleotides. The nucleotides of DNA consist of a deoxyribose sugar molecule to which is attached a phosphate group and one of four nitrogenous bases: two purines (adenine and guanine) and two pyrimidines (cytosine and thymine).

A primary function of DNA in somatic cells is - Converting glucose to pyruvate - Encoding mRNAs and subsequently proteins - DNA has no function in somatic cells - Synthesizing membrane phospholipids

Encoding mRNAs and subsequently proteins

Which of the following may be located tens of kilobases away from the transcriptional start site? Enhancer sequence. TATA box. Proximal promoter elements. The core promoter.

Enhancer sequence

What may be located tens of kilobases away from the transcriptional start site?

Enhancer sequence.

Bacteria typically contain multiple chromosomes. True False

False

How does crystallography work?

Franklin stretched DNA fibers in a thin glass tube so the strands were parallel. She aimed a powerful X-Ray beam at the concentrated DNA & recorded the scattering pattern of X-Ray's on film. This is a form of diffraction.

Explain Rosalind Franklin's experiment.

Franklin used crystallography to study DNA. She revealed that the X shape of DNA is twisted around each other, which is called a helix. It also shows that the nitrogenous bases are stacked at regular intervals near the center of the molecule.

In the GAL gene system, the ________ protein is a trans-acting regulatory protein.

Gal4

Galactose is absent, but you find active transcription of the GAL genes. Which protein is likely mutated or absent to allow for constitutive transcription of the GAL genes? Gal10 Gal80 Gal2 Gal4 Mig1

Gal80

what type of experiments of Griffith and Avery show about genetic information?

Griffith and Avery studied bacteria and mice. Their S and R experiment revealed that DNA stores and transmits genetic information from one generation of bacteria to another. Chromosomes consist of protein and DNA, but mainly DNA.

What were the steps to Griffiths experiment of transforming bacteria?

Griffith studied bacteria that can cause long cancer. 1. He had S bacteria which was deadly and smooth edged. Then he had R bacteria which was harmless and rough edged. 2. He made the S bacteria harmless by heating it up. 3. He then mixed the harmless heat killed S bacteria with the harmless R bacteria. 4. The mixed bacteria killed the mouse even though it was "harmless." This revealed that genetic information from the S was transferred to the R bacteria. This happened because of transformation, the harmless was changed into harmful through the inherited gene from the offspring. Information from the S to R changed the harmless bacteria to deadly.

The +1 nucleosome has a modified what? What does this mod allow?

H-2A. to be easily removed; loosen the DNA-histone interactions, allowing transcription to proceed.

Which of the following separates the DNA strands during replication? helicase primase DNA polymerase I DNA polymerase III ligase

Helicase

How did the results of the Hershey-Chase experiment strengthen Avery's conclusions?

Hershey and Chase studied bacteriophages which are viruses that attack bacteria. In their experiment Hershey and Chase labeled the bacteriophages with radioactive isotopes to see where the virus attacks. They use phosphorus 32 and sulfur 35 because proteins contain almost no phosphors and DNA contains almost no sulfur. Nearly all of the radioactivity was found in phosphorus, meaning DNA holds genetic information, not protein.

Why did Hershey and Chase label the viral DNA with radioactive phosphorus and not radioactive sulfur?

Hershey and Chase studied bacteriophages which are viruses that attack bacteria. They labeled the bacteriophage with radioactive isotopes to see where it goes when a virus attacks. They used phosphorus-32 and sulfur-35 because proteins contain no phosphorus (only found in protein) and DNA contains no sulfur (only found in DNA.) They discovered that nearly all the radioactivity was found in phosphorus, confirming that DNA contains genetic material, not protein.

What general role does acetylation of histone protein amino acids play in the transcription of eukaryotic genes?

Histone acetylation events are most often associated with transcription activation.

Which pattern of chromatin mod would activate transcription to the greatest extent?

Increased acetylation and decreased methylation of histones

DNA Binding Domain

Is an independent folding protein domain that contains at least one motif that recognizes single or double-stranded DNA.

Which of the following statements best describes the effect a nonsense mutation would have on a gene? - It renders the gene completely useless/ineffective. - It introduces a premature stop codon into the mRNA. - It alters the reading frame of the mRNA. - It changes an amino acid in the encoded protein. - It has no effect on the amino acid sequence of the encoded protein.

It introduces a premature stop codon into the mRNA

Which of the following characteristics of a chromosome would identify it as a prokaryotic chromosome rather than a eukaryotic chromosome? It is a circular molecule. It contains double-stranded DNA. It contains histones. It contains A, C, G, and T.

It is a circular molecule.

In which direction does the replication fork move?

It moves ahead of the newly synthesized DNA.

What is the function of the parental DNA in replication?

It serves as the template for DNA replication.

Which of the following are terms associated with Okazaki fragments? Discontinuous DNA ligase Lagging strand Lagging strand, DNA ligase, and discontinuous

Lagging strand, DNA ligase, and discontinuous

Which DNA strand is synthesized continuously? Lagging strand Neither the leading nor the lagging strand is synthesized continuously. The leading and lagging strands are both synthesized continuously. Leading strand

Leading strand.

You briefly expose bacteria undergoing DNA replication to radioactively labeled nucleotides. When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). These two classes of DNA probably represent

Leading strands and Okazaki fragments

Which amino acid in histone tails is the most frequent target for acetylation?

Lysine

What normally removes epigenetic modifications? What is an exception to this removal?

Meiosis, sex-specific processes in primordial germ cells that re-establishes the methylation patterns for genomic imprinting

In E. coli, there is a mutation in a gene called dnaB that alters the helicase that normally acts at the origin. Which of the following would you expect as a result of this mutation? No proofreading will occur. Replication will require a DNA template from another source. The DNA will supercoil. Replication will occur via RNA polymerase alone. No replication fork will be formed.

No replication fork will be formed.

Which is the largest among the followings? Nucleotide Nitrogenous base Phosphate Carbon

Nucleotide

What is RNAi?

RNA interference; injecting double stranded RNA into a cell turns off expression of a gene with the same sequence as the RNA

What is the appearance of DNA in a typical prokaryotic cell?

Prokaryotes are unicellular organisms that lack organelles or other internal membrane-bound structures. Therefore, they do not have a nucleus, but, instead, generally have a single chromosome: a piece of circular, double-stranded DNA located in an area of the cell called the nucleoid.

Replication in prokaryotes differs from replication in eukaryotes for which of these reasons? The prokaryotic chromosome has histones, whereas eukaryotic chromosomes do not. Prokaryotes have telomeres, and eukaryotes do not. Prokaryotes produce Okazaki fragments during DNA replication, but eukaryotes do not. Prokaryotic chromosomes have a single origin of replication, whereas eukaryotic chromosomes have many. The rate of elongation during DNA replication is slower in prokaryotes than in eukaryotes.

Prokaryotic chromosomes have a single origin or replication, whereas eukaryotic chromosomes have many.

Where are CpG islands clustered in mammalian genomes? Centromere Promoters Introns Heterochromatin

Promoters

For a couple of decades, biologists knew the nucleus contained DNA and proteins. The prevailing opinion was that the genetic material was proteins, and not DNA. The reason for this belief was that proteins are more complex than DNA. What was the basis of this thinking?

Proteins have a greater variety of three-dimensional forms than does DNA.

what are transcription factors?

Proteins that bind to promoters and are functional in transcription.

How are RNA and DNA similar and different?

RNA: single strand, sugar phosphate backbone of Ribose, a-u c-g, three types of RNA DNA: double stranded, sugar phosphate backbone with deoxyribose, a-t c-g

Many types of cancer are known to overexpress the receptor protein tyrosine kinase. Which molecular technique can be used to reduce expression of an oncogene in vitro? Southern blotting PCR western blotting RNAi DNAse sensitivity assay

RNAi

What causes variegated forms of petunia?

RNAi

What is the function of topoisomerase?

Relieving strain in the DNA ahead of the replication fork.

DNA is synthesized through a process known as _____.

Semiconservative replication

Which of the following help to hold the DNA strands apart while they are being replicated? single-strand binding proteins primase exonuclease ligase DNA polymerase

Single-stranded binding proteins

Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply. Some forms of chromatin modification can be passed on to future generations of cells. Deacetylation of histone tails in chromatin loosens the association between nucleosomes and DNA. Acetylation of histone tails is a reversible process. DNA is not transcribed when chromatin is packaged tightly in a condensed form. Methylation of histone tails in chromatin can promote condensation of the chromatin. Acetylation of histone tails in chromatin allows access to DNA for transcription.

Some forms of chromatin modification can be passed on to future generations of cells. Acetylation of histone tails is a reversible process. DNA is not transcribed when chromatin is packaged tightly in a condensed form. Methylation of histone tails in chromatin can promote condensation of the chromatin. Acetylation of histone tails in chromatin allows access to DNA for transcription. One of the mechanisms by which eukaryotes regulate gene expression is through modifications to chromatin structure. When chromatin is condensed, DNA is not accessible for transcription. Acetylation of histone tails reduces the attraction between neighboring nucleosomes, causing chromatin to assume a looser structure and allowing access to the DNA for transcription. If the histone tails undergo deacetylation, chromatin can recondense, once again making DNA inaccessible for transcription. Recent evidence suggests that methylation of histone tails can promote either the condensation or the decondensation of chromatin, depending on where the methyl groups are located on the histones. Thus, methylation can either inactivate or activate transcription, and demethylation can reverse the effect of methylation. Changes in chromatin structure may be passed on to future generations of cells in a type of inheritance called epigenetic inheritance.

What ensures that the single strands of DNA do not come back together? ATP DNA helicase Stabilizing proteins The replication fork

Stabilizing proteins

During DNA replication, which nucleotide will bind to an A nucleotide in the parental DNA? T A C G U

What is meant by the description "antiparallel" regarding the strands that make up DNA?

The 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand.

In a healthy cell, the rate of DNA repair is equal to the rate of DNA mutation. When the rate of repair lags behind the rate of mutation, what is a possible fate of the cell?

The cell can be transformed into a cancerous cell

Which of the following is characteristic of open promoters? They tend to contain a TATA box. Their expression is regulated by transcription factors and transcription is blocked until nucleosomes are removed. They are constitutively expressed. They are relatively insensitive to DNase I cleavage.

They are constitutively expressed

Which statement about DNA replication is CORRECT? DNA ligase helps assemble the leading strand. The lagging strand is one of the strands of parental DNA. The leading strand is one of the strands of parental DNA. The lagging strand is built continuously. The leading strand is built continuously, and the lagging strand is built in pieces.

The leading strand is build continuously, and the lagging strand is built in pieces.

What is the role of DNA polymerase in the process of DNA replication?

The main function of DNA polymerase is to make DNA from nucleotides, the building blocks of DNA. There are several forms of DNA polymerase that play a role in DNA replication and they usually work in pairs to copy one molecule of double-stranded DNA into two new double stranded DNA molecules.

What determines the nucleotide sequence of the newly synthesized strand during DNA replication?

The nucleotide sequence of the template strand.

Why is the DNA synthesis of the lagging strand considered discontinuous?

The synthesis is moving in the opposite direction from the replication fork.

Describe the importance of the chromatin remodeling process to transcription.

These alterations can be used to activate transcription of a gene by opening its promoter sequences. These alterations can be used to repress transcription of a gene by hiding its promoter sequences. These alterations can be used to repress transcription of a gene by hiding its enhancer sequences. These alterations can be used to activate transcription of a gene by opening its enhancer sequences.

Which of the following is characteristic of open promoters?

They are constitutively expressed/transcribed, they do not generally contain a TATA box and instead use a poly A/T tract located near the NDR near the transcription site.

How do stabilizing proteins work on the DNA? They bind to the single-stranded DNA. They bind to the double-stranded DNA. They form the replication fork. They use ATP to break the hydrogen bonds

They bind to single-stranded DNA.

What role do insulator sequences play in the regulation of eukaryotic transcription?

They block communication between enhancers and nontargeted promoters.

What role do insulator sequences play in the regulation of eukaryotic transcription? They block binding of transcription repressors to cis-acting promoter elements. They block binding of transcription factors to enhancers. They block communication between enhancers and nontargeted promoters. They block binding of transcription factors to cis-acting promoter elements.

They block communication between enhancers and nontargeted promoters.

Why can certain types of viruses promote cancer in humans especially? - The medicine used to treat the virus is what causes most cancers. - The virus can mutate an oncogene into a proto-oncogene. - The body overcompensates for damaged organs and mass produces cells. - The viruses cause silent mutations in the host's genome. - They insert their DNA into the host genome and can cause massive damage.

They insert their DNA into the host genome and can cause massive damage.

What is the function of connector proteins?

They link the leading strand DNA polymerase and the lagging strand DNA polymerase together.

Why is it significant that the two strands of DNA are antiparallel?

This means that the two strands describe Chargaff's rule. The 2 strands of DNA run on opposite sides of each other, making the nitrogenous bases on both strands come to contact near the center.

The structure of DNA explains both its ability to encode genetic information and the way in which it is copied during cell reproduction. True False

True

What facts about DNA does the Watson-Crick model explain?

Watson and Crick made models to try and understand DNA shapes. They realized that nitrogen bases complemented/attracted each other and that the two strands are anti parallel, making the nitrogenous bases on both strands come to contact near the center. Each strand carries a sequence of nucleotides arranged like a latter. They discovered that hydrogen bonds form between nitrogenous bases proving enough forces to hold the stands together.

Which of the following catalyzes the linkage between ribonucleotides to form RNA during gene expression? (eText Concept 14.2) RNA polymerase RNA ligase a ribozyme reverse transcriptase tRNA

The function of tRNA during protein synthesis is to _____. (eText Concept 14.4) deliver amino acids to their proper site during protein synthesis guide ribosome subunits out of the nucleus through nuclear pores attach mRNA to the small subunit of the ribosome process mRNA transcribe mRNA

A virus infects a cell and randomly inserts many short segments of DNA containing a stop codon throughout an organism's chromosomes. This will probably cause _____. (eText Concept 14.5) manufactured proteins to be short and defective the DNA to break up into thousands of short segments incorrect pairing between mRNA codons and amino acids no bad effects, as long as the stop codons are not also inserted into tRNA All of the listed responses are correct

Bacteria can transcribe and translate human genes to produce functional human proteins because _____. (eText Concept 14.1) the genetic code is nearly universal bacterial ribosomes and eukaryotic ribosomes are identical eukaryotes do not really need a nucleus RNA has catalytic properties bacterial and eukaryotic RNA polymerases are identical

In eukaryotes, which of the following mechanisms of gene regulation operates after transcription, but before translation of mRNA into protein? (eText Concept 14.3) RNA splicing DNA packaging into nucleosomes action of repressors and activators protein degradation All of the listed responses are correct.

Which of the following is a post-translational modification of a polypeptide? (eText Concept 14.4) cleavage of a polypeptide into two or more chains removal of introns and splicing of exons formation of a polysome that allows simultaneous formation of many polypeptides from one mRNA transcript The growing polypeptide signals the ribosome to attach to the ER. complementary base pairing of mRNA and tRNA in the ribosome

Which of the following statements correctly describes mRNA processing? (eText Concept 14.3) Introns are cut out of the primary transcript, and the resulting exons are spliced together. Exons are cut out of the primary transcript, and the introns are spliced together. Introns are cut out of the primary transcript and spliced together at the end of the transcript. Exons are cut out of the primary transcript and transported to the endoplasmic reticulum. Introns are cut out of the primary transcript and transported to the ribosomes.

Which of the following statements is false?(eText Concept 14.2) In bacteria, proteins called transcription factors enhance the affinity of RNA polymerase to the promoter sites of genes. In bacteria, transcription of a gene is initiated when the RNA polymerase by itself recognizes and binds to the promoter of the gene. The initiation of gene transcription in eukaryotes requires the binding of proteins called transcription factors to the TATA box in the promoter region of a gene. A relaxation of chromatin packing in eukaryotic cells can facilitate the binding of transcription factors to a promoter of a gene. All of the listed responses are correct.

Nucleosome-depleted Region (NDR)

a 150-100 bp region containing few nucleosomes that lies immediately upstream of the start of transcription.

Which of the following is found at the 5 end of a DNA strand? a hydrogen bond a hydroxyl group histones a phosphate group a methyl group

a phosphate group

What are bacteriophages?

a virus that parasitizes a bacterium by infecting it and reproducing inside it.

If the percentage of guanine in E.coli is 26%, then the percentage of other nitrogenous bases would be: a) Adenine=24%, Thymine=24%, Cytosine=26% b) Adenine=26%, Thymine=24%, Cytosine=26% c) Adenine=48%, Thymine=48%, Cytosine=26% d) Adenine=26%, Thymine=24%, Cytosine=24%

a) Adenine=24%, Thymine=24%, Cytosine=26%

Arrange the following molecules according to increasing rate of diffusion across a lipid bilayer without the aid of any membrane protein (least to greatest): a) Ca2+ < glucose < H2O < N2 b) glucose < Ca2+ < N2 < H2O c) H2O < N2 < Ca2+ < glucose d) N2 < H2O < glucose < Ca2+

a) Ca2+ < glucose < H2O < N2

Translation of all mRNAs is initiated in which cellular compartment? a) Cytoplasm b) Golgi apparatus c) Nucleus d) Endoplasmic reticulum

a) Cytoplasm

In Drosophila red-eye color is dominant to white-eye color. In a genetic cross between a true breeding female with red eyes and a male with white eyes half of the male progeny in the F2 generation have red eyes. Which of the following is true about the male parent? a) It has an X-linked white allele. b) It is homozygous for the white allele. c) It is heterozygous for the red allele. d) It is heterozygous for the white allele.

a) It has an X-linked white allele.

Which of the following is FALSE regarding the DNA double helix? a) The two strands are parallel. b) The two strands exhibit complementary base pairing. c) The four nitrogenous bases found in it are A, T, C and G. d) The two strands are stabilized by hydrogen bonds and base stacking interactions.

a) The two strands are parallel.

Most of the organic material in plants comes from: a) air b) sunlight c) water d) soil/dirt

a) air

Arrange the events taking place during transcription in order: i) The pre-RNA undergoes processing ii) RNA polymerase moves downstream, unwinding the DNA iii) RNA polymerase binds to the promoter iv) RNA transcript is released and polymerase detaches from the DNA v) Polymerase initiates RNA synthesis at the start point on the template strand a) iii, v, ii, iv, i b) i, iii, v, ii, iv c) iv, iii, ii, i, v d) v, ii, i, iii, iv

a) iii, v, ii, iv, i

In the lac operon, lactose is a/an __________ and in trp operon tryptophan is a/an __________. a) inducer; co-repressor b) co-repressor; inducer c) product; substrate d) repressor; activator

a) inducer; co-repressor

Given below is a list of events taking place during translation. Arrange these in proper sequence. i) The anticodon of tRNA base pairs with the mRNA codon at the A site ii) Peptide bond formation between amino group of amino acid in A site and the carboxyl end of the polypeptide in the P site iii) Translocation of tRNA from the A site to the P site iv) A small ribosomal subunit binds with mRNA a) iv, i, ii, iii b) ii, i, iv, iii c) i, ii, iv, iii d) iv, i, iii, ii

a) iv, i, ii, iii

The genetic code is said to be redundant because a) one amino acid can be encoded by more than one triplet codon. b) one triplet codon specifies more than one amino acid. c) many amino acids are encoded by one single triplet codon. d) only one triplet codon encodes one amino acid.

a) one amino acid can be encoded by more than one triplet codon.

During respiration, the energy released as electrons are passed through the electron transport chain is .... a) used to actively pump H+ ions across a membrane to form a proton gradient. b) used to directly phosphorylate ADP to generate ATP. c) lost as heat. d) used to hydolyze ATP to ADP.

a) used to actively pump H+ ions across a membrane to form a proton gradient.

What is the original source of electrons for PSII? a) water b) sunlight c) carbon dioxide (CO2) d) molecular oxygen (O2)

a) water

The following figure shows a replication bubble. The correct labeling for this figure is:

a- origin of replication; b- leading strand; c- lagging strand; d- Okazaki fragment; e- RNA primer

If a mouse inherits a deletion in the SHH enhancer, what effect would you expect to see?

abnormal limb development

Open chromatin is ___ to regulatory proteins, but DNA tightly bound to nucleosomes is _____.

accessible, inaccessible

What do Histone methyltransferases do? What do histone demethylases do?

add methyl groups to lysines at the N terminus of histones. remove methyl groups.

The enzyme telomerase solves the problem of replication at the ends of linear chromosomes by which method?

adding numerous short DNA sequences such as TTAGGG, which form a hairpin turn

Which of the following is an example of post- transcriptional control of gene expression? - alternative splicing of exons - mRNA degradation - protein processing and degradation - all of the options

all of the options

What does nucleotide not contain?

an amino acid

enhancesomes

are protein complexes that assemble at enhancers to facilitate transcription.

A base-pair substitution mutation in a germ cell line is likely to have no effect on phenotype if the substitution _____. (eText Concept 14.5) forms a new stop codon occurs in an intron changes a stop codon to a codon specifying an amino acid changes the structure of an enzyme prevents the initiation of transcription of the DNA sequence that codes for ATP synthase

A point mutation in which a single base pair is inserted or deleted from DNA is called a(n) _____. (eText Concept 14.5) nonsense mutation frame-shift mutation inversion mutation translocation mutation missense mutation

Cells are able to distinguish proteins destined for secretion or for segregation to specific intracellular compartments from those that will remain in the cytoplasm because _____. (eText Concept 14.4) there are two types of ribosomes: one group that synthesizes cytoplasmic proteins only, and another type that synthesizes secreted or compartment-specific proteins only some proteins, as they begin to be synthesized, contain a signal region that causes the ribosome with its growing polypeptide to attach to the ER and translocate the polypeptide into the lumen (space) of the ER proteins destined for secretion or for a specific compartment are all synthesized in the nucleus, whereas cytoplasmic proteins are all synthesized in the cytoplasm each compartment in the cell (the nucleus, lysosome, and so forth) has its own set of ribosomes that synthesize proteins unique to that compartment ribosomes contain two types of subunits

Generally speaking, how many genetic codes are there? (eText Concept 14.1) 20 one four one for each organism three

The P site of a ribosome does which of the following? (eText Concept 14.4) It holds the tRNA that is carrying the next amino acid to be added to the growing polypeptide chain. It holds the tRNA carrying the growing polypeptide chain. It helps "unzip" DNA during transcription. It catalyzes the addition of amino acids to the tRNAs. It recognizes the promoter during transcription initiation.

The codons AAA, CCC, GGG, and UUU specify the amino acids lysine, proline, glycine, and phenylalanine, respectively. What peptide sequence would be encoded by the sequence 5'-CCCAAATTTGGG-3', if present in the coding strand of the DNA? (eText Concept 14.1) lys-pro-gly-phe pro-lys-phe-gly gly-phe-lys-pro phe-gly-pro-lys gly-phe-pro-lys

What is the proper order of the following events in the expression of a eukaryotic gene? 1. translation 2. RNA processing 3. transcription 4. modification of protein (eText Concept 14.4) 1, 2, 3, 4 3, 2, 1, 4 4, 2, 3, 1 2, 3, 4, 1 1, 2, 4, 3

What mRNA codon would be made from the DNA triplet CGT? (eText Concept 14.1) ATU GCA TCU CTA UCG

Which of the following is NOT true of a codon? It may code for the same amino acid as another codon. It extends from one end of a tRNA molecule. It is the basic unit of the genetic code. It consists of three nucleotides. It never codes for more than one amino acid.

Which of the following mutations would be most likely to have a harmful effect on an organism? a single nucleotide deletion near the end of the coding sequence a single nucleotide insertion downstream of, and close to, the start of the coding sequence a nucleotide-pair substitution a single nucleotide deletion in the middle of an intron a deletion of three nucleotides near the middle of a gene

Which of the following statements regarding the structure and function of tRNA is false? (eText Concept 14.4) Each type of tRNA molecule translates a particular mRNA codon into a particular amino acid. Although each tRNA consists of a relatively short, single RNA strand, this single strand can achieve a three-dimensional structure by folding back upon itself and forming covalent bonds between complementary bases. The nucleotide sequence at both the amino acid attachment and the anticodon ends of each tRNA is instrumental in specifying which amino acid is attached to the tRNA by aminoacyl-tRNA synthetase. Although there are 61 codons that code for amino acids, there are only 45 different tRNA molecules. The second and third listed responses are false.

Who formulated the one gene-one enzyme hypothesis? (eText Concept 14.1) Watson and Crick Beadle and Tatum Hershey and Chase Franklin None of the listed responses is correct.

A sulfur atom has 16 protons and 16 neutrons. What is the weight of one mole of sulfur? a) 32 daltons b) 32 g c) Insufficient information has been given to answer this question. d) 16 g e) 16 daltons

b) 32 g

A protein, which is composed of amino acids, can have a catalytic activity, but amino acids do not. This catalytic activity is an example of a) Systems biology b) An emergent property c) None of these d) The unit of life e) Deductive reasoning f) Reductionism

b) An emergent property

Which of the following could be concluded from the experiment conducted by Frederick Griffith in 1928? a) All of them b) Genetic traits can be transferred between different bacterial strains through an unknown heritable substance. c) Pathogenic bacterial strains are transformed by non-pathogenic strains. d) Some bacterial strains can maintain pathogenicity after heat inactivation.

b) Genetic traits can be transferred between different bacterial strains through an unknown heritable substance.

A new, lethal genetic disorder has been discovered. The disease allele is dominant, yet it persists in the population. The simplest reason to explain this disease allele is: a) The allele is influenced by epistasis. b) The allele is dominant, but affects individuals beyond the reproductive age. c) The allele exhibits co-dominance. d) The allele is dominant, but not completely.

b) The allele is dominant, but affects individuals beyond the reproductive age.

A patient experienced great blood loss. In an attempt to quickly replenish body fluids, a volume of distilled water equal to the blood lost was introduced directly into a blood vein. What is the most likely result of this treatment? a) The red blood cells should be fine because they were subjected to an isotonic environment. b) The red blood cells are in danger of bursting because they were subjected to a hypotonic environment. c) The red blood cells are in danger of shrinking because they were subjected to a hypertonic environment. d) The red blood cells are unaffected because distilled water shares the same pH with the intracellular region of red blood cells.

b) The red blood cells are in danger of bursting because they were subjected to a hypotonic environment.

Which of the following is an example of the reductionist approach to scientific inquiry? a) To understand how memory works it is necessary to study many individuals of a single species. b) To understand how memory works it is necessary to understand the roles of individual brain cells. c)To understand how memory works it is necessary to have a control group for experiments. d) To understand how memory works it is necessary to study a model organism. e) To understand how memory works it is necessary to collect data based on careful measurements.

b) To understand how memory works it is necessary to understand the roles of individual brain cells.

The role of NAD+ in cellular respiration is to: a) reduce glucose to CO2. b) accept electrons and pass them to the electron transport chain. c) oxidize glucose to CO2. d) donate electrons and accept them from the electron transport chain.

b) accept electrons and pass them to the electron transport chain.

On the basis of energy requirement, which does NOT belong to the group? a) osmosis b) active transport c) passive transport d) facilitated diffusion

b) active transport

When water is split during the light reaction, the protons released are located in the _______. a) mitochondrial matrix b) thylakoid space c) cytosol d) chloroplast stroma e) chloroplast intermembrane space f) thylakoid membrane

b) thylakoid space

The Ames test involves exposure of a histidine requiring strain of Salmonella typhimurium. After the test, mutants grow on a medium that is histidine-free. These mutants are an example of pyrimidine dimer formation point mutation site-direct mutagenesis back mutation

back mutation

How is base pairing involved in DNA replication?

base pairs are involved with hydrogen bonds forming between only certain pairs

What does the RNA-induced silencing complex (RISC) do?

binds these small RNA molecules and denatures them. One strand becomes degraded (the passenger strand) while one becomes the guide strand to silence gene expression by one of three ways.

What role do insulator sequences play in the regulation of eukaryotic transcription?

block communication between enhancers and nontargeted promoters.

A cell biologist found that two different proteins with largely different structures were translated from two different mRNAs. These mRNAs, however, were transcribed from the same template within the cell nucleus. Which mechanism below could best account for this? (eText Concept 14.3) Different systems of DNA unpacking could result in two different mRNAs. A point mutation might have altered the gene. Exons from the same gene could be spliced in different ways to make different mRNAs. Different transcription factors were involved in the transcription of the two mRNAs. The two proteins have different functions in the cell.

At one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred _____. (eText Concept 14.2) in a double-stranded DNA molecule during translation during transcription when an mRNA codon paired with a tRNA anticodon It is impossible to say, given this information.

During the transcription of a given portion of a DNA molecule _____. (eText Concept 14.2) mRNA is synthesized on both chains of the DNA molecule at once mRNA is synthesized on both chains of the DNA molecule, but first on one side and then the other mRNA is synthesized on only one of the chains half of the mRNA is synthesized on half of one chain; then the other half of the mRNA is made on the other half of the DNA Any of the listed patterns may be found.

During translation in a eukaryotic cell _____. (eText Concept 14.4) ribosomes move into the nucleus tRNA carries amino acid molecules to the nucleus, where they are added to a growing polypeptide chain polypeptides are synthesized at ribosomes, according to instructions carried by mRNA mRNA is synthesized by the bonding of free nucleotides to the bases on the template strand of DNA ribosomes move out of the nucleus

Genetic information of eukaryotic cells is transferred from the nucleus to the cytoplasm in the form of _____. (eText Concept 14.1) proteins lipids RNA carbohydrates DNA

Polysomes may be defined as _____. (eText Concept 14.4) microfilaments and microtubules groups of lysosomes groups of ribosomes groups of chromosomes groups of peroxisomes

The anticodon of a particular tRNA molecule is __________. changeable, depending on the amino acid that attaches to the tRNA complementary to the corresponding triplet in rRNA complementary to the corresponding mRNA codon catalytic, making the tRNA a ribozyme the part of tRNA that bonds to a specific amino acid

The first amino acid inserted into a new polypeptide chain in eukaryotic cells is usually _____. (eText Concept 14.4) glycine serine methionine adenosine monophosphate alanine

Ultraviolet (UV) radiation is damaging to cells because it _____. (eText Concept 14.5) pokes holes in the nuclear envelope blocks all translation causes mutations in the DNA deactivates the enzymes needed for DNA replication shreds the cytoskeleton and leads to free radicals

What is a key difference in gene expression between eukaryotic and prokaryotic cells? () In prokaryotes, proteins are assembled directly from DNA. RNA polymerases are involved only in initiation in eukaryotes. In prokaryotic cells, the mRNA transcript is immediately available as mRNA without processing. In eukaryotic cells, transcribed RNA sequences function as termination signals. Prokaryotes do not contain ribosomes.

When RNA is being made, the RNA base _____ always pairs with the base _____ in DNA. (eText Concept 14.1) U ... T T ... G U ... A A ... U T ... A

Which component is NOT directly involved in translation? tRNA GTP DNA mRNA ribosomes

Which of the following accurately describes the usual process of transcription for eukaryotic genes? (eText Concept 14.3) Exons are not transcribed. Introns are not transcribed. Exons are transcribed, but the RNA transcribed from introns does not leave the nucleus. Both introns and exons are transcribed, but the RNA transcribed from them does not leave the nucleus. Exons and introns are transcribed, and the RNA transcribed from them leaves the nucleus.

Which of the following best describes the arrangement of genetic information in a DNA molecule? (eText Concept 14.1) A gene is composed of overlapping, three-nucleotide words on a template strand of DNA. The three-nucleotide words of a gene are serially arranged on both strands of DNA at a specific locus. The three-nucleotide words of a gene are arranged in a nonoverlapping series on the DNA template strand. By overlapping the three-nucleotide words of a gene, the amount of information a DNA molecule can hold is maximized. By analyzing the linear order of amino acids in a polypeptide, the exact order of the three-nucleotide words of a gene arranged on the template strand of DNA can be determined.

Which biochemical reaction proceeds spontaneously? a) S → T + U ΔG= +40 KJ/mol b) E + F → G + H ΔG= +0.2 KJ/mol c) A + B → C ΔG= -30.5 KJ/mol d) X + Y → Z ΔG= +61.9 KJ/mol

c) A + B → C ΔG= -30.5 KJ/mol

What is the source of energy during the energy investment phase of glycolysis? a) glucose b) NADH c) ATP d) NAD+ e) light f) heat

c) ATP

Humans contain about 20,000 genes but can make 75,000- 100,000 different proteins. The most likely explanation for this is: a) All of them contribute b) Exon shuffling c) Alternative splicing of exons d) Redundancy of the genetic code

c) Alternative splicing of exons

If the graph represents the change in β-galactoside production (Y-axis) in E.coli cells over time (X-axis), which of the following is true? I- The amount of allolactose is highest at B and E II- The amount of allolactose is highest at D and G III- The amount of active repressor is highest at D and G IV- The amount of active repressor if highest at B and E a) II and IV b) Only IV c) I and III d) Only I

c) I and III

Which of the following is NOT true of natural selection? a) It involves differential reproductive success b) It involves genetic variation and differential reproductive success c) It always results in the strongest individuals d) It results in descent with modification e) It requires genetic variation f) None of these

c) It always results in the strongest individuals

Which of the following does NOT describe a biological membrane? a) Carbohydrate portion of its glycoproteins are positioned on the extracellular face. b) Its components get transported through vesicles, whose outside face becomes continuous with the membrane cytoplasmic face. c) Its protein and lipid components are symmetrically distributed. d) It is a collage of proteins, embedded in the fluid matrix of the lipid bilayer.

c) Its protein and lipid components are symmetrically distributed.

Why do most signaling receptors bind their ligand (chemical signal) via an extracellular ligand-binding domain? a) Most ligands are hydrophobic and cannot cross the plasma membrane. b) Most ligands are non-polar and cannot cross the plasma membrane. c) Most ligands are polar and cannot cross the plasma membrane. d) Most ligands would be toxic if they were to enter the cell.

c) Most ligands are polar and cannot cross the plasma membrane.

Refer to the plot showing the rate of an enzyme-catalyzed reaction as a function of substrate concentration. Why is the curve starting to level off? a) Most of the cells start to die as substrate concentration increases. b) Too much substrate distorts the structure of the enzyme, making the enzyme inactive. c) Most of the active sites of the enzyme are occupied by the substrate. d) Reaction product competes with the substrate for enzyme interaction.

c) Most of the active sites of the enzyme are occupied by the substrate.

At the end of glycolysis, the potential/chemical energy released from glucose is now stored in: a) CO2 and H2O b) Pyruvate c) NADH and ATP d) ADP and NAD+

c) NADH and ATP

Two species of organisms A and B inhabit a particular geographic location. Organism A reproduces asexually while Organism B undergoes sexual reproduction. Due to natural calamities, there have been major changes in the biogeography of the habitat. Which of the following is true? a) Species A and B do not become extinct, as they were original inhabitants of the region. b) Species A and B have equal chances of becoming extinct. c) Species A has more chances to become extinct. d) Species B has more chances of becoming extinct.

c) Species A has more chances to become extinct.

Two pea plants were crossed and 93 of 200 progeny were short and the rest were tall. Tall is dominant. The most likely genotypes of the parents are: a) Tt and Tt b) TT and tt c) Tt and tt d) TT and Tt

c) Tt and tt

Which of the following is an example of post- transcriptional control of gene expression? a) protein processing and degradation b) alternative splicing of exons c) All of the options d) alternative splicing of exons and protein processing and degradation e) mRNA degradation

c) all of the options

Which of the following is NOT a function of the RNAi pathway? a) to defend against viral infection b) to degrade target mRNA c) All of the options are potential functions of the RNAi pathway. d) to block translation

c) all of the options are potential functions of the RNAi pathway

In a DNA double helix, the 2 strands run in a(n) __________ direction and are ___________ to each other. a) parallel, non-complementary b) same, complementary c) antiparallel, complementary d) opposite, non-complementary

c) antiparallel, complementary

Phosphorylation may change the activity of a protein in all ways EXCEPT: a) altering the catalytic activity of an enzyme b) changing where it localizes in the cell c) changing its primary structure d) changing its ability to interact with other proteins

c) changing its primary structure

Cells in a plant root are non-photosynthetic, but they still depend on the light energy harvested during photosynthesis in leaves. In what form is the light energy transferred to the root cells? a) chemical energy stored in newly synthesized ATP b) electrons from the oxidation of CO2 c) chemical energy stored in newly synthesized sugars d) electrons from the oxidation of water

c) chemical energy stored in newly synthesized sugars

Which of the following could NOT be converted into an oncogene by mutation? a) gene encoding a cyclin that promotes passage through the restriction point or START b) gene encoding a part of a signal transduction cascade c) gene encoding a DNA damage repair enzyme d) gene encoding a signaling receptor that normally responds to mitogens

c) gene encoding a DNA damage repair enzyme

Consider the reaction profile for three enzymes, A, B and C. A solution with enzyme B and its substrate is kept at pH 4. If a weak base is gradually added to it, the activity of enzyme B will most likely: a) decrease continuously as base is added. b) increase continuously as base is added. c) increase, then eventually decrease as base continues to be added. d) decrease, then increase as base continues to be added.

c) increase, then eventually decrease as base continues to be added.

When an enzyme speeds up metabolic reactions, a) it increases the ΔG of the overall reaction. b) it is consumed by the reaction and cannot be reused for other processes. c) it lowers the activation energy necessary to break the bonds of the reactants. d)it lowers the ΔG of the overall reaction.

c) it lowers the activation energy necessary to break the bonds of the reactants.

Which of the following basic molecular building blocks would be found in chromosomes? a) nucleotides only b) nucleotides and lipids c) nucleotides and amino acids d) nucleotides and carbohydrates

c) nucleotides and amino acids

How far do the signaling molecules travel from their point of release until they bind to a receptor on the target cell? Choose the answer below showing the shortest to greatest distance traveled. a) paracrine signal; synaptic signal; endocrine signal b)endocrine signal; paracrine signal; synaptic signal c) synaptic signal; paracrine signal; endocrine signal d) synaptic signal; endocrine signal; paracrine signal e) paracrine signal; endocrine signal; synaptic signal

c) synaptic signal; paracrine signal; endocrine signal

Before DNA could definitely be shown to be the genetic material in cells, what did scientists had to show that it could do?

carry and make copies of information

What are structural motif? What do these structures allow?

common structures in reg proteins. amino acid/nucleotides interactions in major and minor grooves

What does competition among acetyltransferases and methyltransferases cause?

complex chromatin states beyond the simple "open" and "closed.

Are Open promoters active or inactive? Where are they located?

constitutively active; in nucleosomedepleted regions. which can bind transcription activators (ACT)

Name a major characteristic of open promoters.

constitutively expressed.

What do dicer do?

cuts the dsRNA into smaller molecules.

During translation, amino acid chain elongation occurs until _____. (eText Concept 14.4) no further amino acids are needed by the cell all tRNAs are empty the polypeptide is long enough the ribosome encounters a "stop" codon the ribosome runs off the end of the mRNA strand

In eukaryotic cells, transcription cannot begin until __________. the two DNA strands have completely separated and exposed the promoter the 5' caps are removed from the mRNA the DNA introns are removed from the template several transcription factors have bound to the promoter DNA nucleases have isolated the transcription unit

In many cases, more than one codon codes for the same amino acid. Because of this, we say that the code is _____. (eText Concept 14.1) inaccurate incomplete not specific redundant tricky

In transcription, _____. (eText Concept 14.2) the promoter region acts as an initial binding site for RNA polymerase only one of the DNA strands is used as the template the RNA nucleotides used are produced by the cell All of the listed responses are correct. None of the listed responses is correct.

The mRNA codons 5(-CAA-3( or 5(-CAG-3( are translated as the amino acid glutamine by _____. (eText Concept 14.4) the tRNA with an anticodon 5(-GUU-3( and glutamine at its other end by tRNA molecules that have been charged with glutamine by two different aminoacyl-tRNA synthetases separate tRNA molecules with anticodons 3(-GUU-5( and 3(-GUC-5(, respectively the same tRNA with the anticodon 3(-GUU-5( the small and large ribosomal units

The number of nucleotide bases "read" together on the mRNA to designate each amino acid is _____; this unit is called a(n) _____. (eText Concept 14.1) two ... dipeptide three ... triose two ... anticodon three ... codon one ... amino acid

Which of the following summaries of protein synthesis is correct? (eText Concept 14.4) DNA transposons leave the nucleus, are transported to a ribosome, and catalyze the polymerization of amino acids in a protein. DNA exchanges its thymine units with uracil in polymerase. This activates polymerase, and it starts joining amino acids together. Transfer RNAs line up on a ribosome, and amino acids bind to them with hydrogen bonds. Messenger RNA is made on a DNA template, and then amino-acid-bearing transfer RNAs bind to it through codon-anticodon pairing. DNA strands separate in the nucleus to form mRNA. mRNA leaves the nucleus and is transcribed into tRNA on ribosomes.

The following represents trisomy: a) 2n - 1 b) 2n - 3 c) 2n + 3 d) 2n + 1 e) 3n

d) 2n + 1

In a genetic cross between a homozygous tall plant with homozygous purple flowers and a homozygous short plant with heterozygous purple flowers, how many short plants will you expect in the F2 generation if you sample 16 individuals? Both tall and purple are dominant. a) 1 b) 2 c) 8 d) 4

d) 4

What is the function of a signal recognition particle? a) It stops translation b) It recognizes a signal peptide c) It moves ribosomes to SRP receptors on the endoplasmic reticulum d) All of the above

d) All of the above

Genes A, B , C and D are present on the same chromosome. The recombination frequency between the genes is as follows: A and B: 24%, A and D: 16%, B and C: 18%, C and D: 10%. What is the correct order of genes along the chromosome? a) CBAD b) BCDA c) ABCD d) BDCA e) ACBD

d) BDCA

In the following pedigree the shaded shape represents individuals with a particular genetic disorder. The following are true about the genotype of the male parent in generation 'P' and the allele for the genetic disorder, respectively: a) Heterozygous, dominant b) Homozygous, dominant c) Homozygous, recessive d) Heterozygous, recessive

d) Heterozygous, recessive

A point mutation that changes a codon for an amino acid to a stop codon is called: a) Missense mutation b) Stop mutation c) Frameshift mutation d) Nonsense mutation

d) Nonsense mutation

G-protein coupled receptors activate trimeric G-proteins by: a) Phosphorylation of the alpha subunit. b) Promoting the association of the alpha subunit with the beta/gamma subunits. c) Increasing the calcium concentration in the cell. d) Promoting the binding of GTP to the alpha subunit.

d) Promoting the binding of GTP to the alpha subunit.

The figure shows a U-shaped glass tube with a selectively permeable membrane separating two sugar solutions with red dye added to side B of the tube. Water and dye molecules can pass through the membrane pores, but sugar molecules (black circles) cannot. Predict what will happen after the system reaches equilibrium. a) The H2O level is still equal on both sides but only side A is red in color. b) The H2O level is still equal on both sides but only side B is red in color. c) The H2O level is higher in side B than side A, and both sides are red in color. d) The H2O level is higher in side A than side B, and both sides are red in color.

d) The H2O level is higher in side A than side B, and both sides are red in color.

Consider the reactions involving the phosphorylation of glucose to form glucose-6-phosphate and ADP: Half-reaction 1: Pi + glucose ↔ glucose-6-phosphate ΔGo' = +13.8 kJ/mol Half-reaction 2: ATP + H2O ↔ ADP + Pi ΔGo' = -30.5 kJ/mol Which of the following is TRUE? a) The overall reaction is exergonic with a ΔGo' of -44.3 kJ/mol. b) The overall reaction is endergonic with a ΔGo' of +16.7 kJ/mol. c) The overall reaction is endergonic with a ΔGo' of +44.3 kJ/mol. d) The overall reaction is exergonic with a ΔGo' of -16.7 kJ/mol.

d) The overall reaction is exergonic with a ΔGo' of -16.7 kJ/mol.

Which of the following is TRUE about the tryptophan operon in E.coli? a) The trp repressor binds to the operator and changes its conformation to prevent RNA polymerase binding. b) Tryptophan interacts with the repressor protein to turn on the operon. c) The trp repressor binds to the operator and changes its conformation to allow RNA polymerase binding. d) Tryptophan interacts with the repressor protein to turn off the operon.

d) Tryptophan interacts with the repressor protein to turn off the operon.

The BRCA-1 genes in humans encode proteins that have role in maintaining DNA stability. Mutation in this gene results in formation of non-functional protein, which is not able to repair damaged DNA, resulting in a significantly increased risk of breast cancer. BRCA-1 is a/an: a) Proto-oncogene b) Homeotic gene c) Oncogene d) Tumor suppressor gene

d) Tumor suppressor gene

Cyclins regulate the progression of the cell cycle by: a) directly carrying out functional activities needed for DNA synthesis or mitosis. b) controlling the activity of cyclin-dependent kinases, which in turn regulate the function of other proteins by degradation. c) acting as substrates for Cdks. d) controlling the activity of cyclin-dependent kinases, which in turn regulate the function of other proteins by phosphorylation.

d) controlling the activity of cyclin-dependent kinases, which in turn regulate the function of other proteins by phosphorylation.

Hydrolysis is involved in each of the following EXCEPT a) conversion of DNA to a mixture of four deoxynucleotides b) conversion of triacylglycerol to a mixture of fatty acids and glycerol c) conversion of glycogen to glucose d) conversion of glucose to starch

d) conversion of glucose to starch

In order for oxidative phosphorylation to occur: a) the pH in the mitochondrial matrix must be the same as the pH in the intermembrane space. b) the pH in the mitochondrial matrix must be lower than the pH in the intermembrane space. c) the pH in the mitochondrial matrix and the pH in the intermembrane space are irrelevant. d) the pH in the mitochondrial matrix must be higher than the pH in the intermembrane space.

d) the pH in the mitochondrial matrix must be higher than the pH in the intermembrane space.

Why are enhancers and silencers important?

determine cell identity

How do different enhancers play a role in cell identity and development?

different enhancers (that bind different regulatory proteins) activate gene expression in different tissues.

Which of the following sets of materials are required by both eukaryotes and prokaryotes for replication? nucleosome loosening, 4 dNTPs, 4 rNTPs topoisomerases, telomerase, polymerases ligase, primers, nucleases double-stranded DNA, 4 kinds of dNTPs, primers, origins G-C rich regions, polymerases, chromosome nicks

double-stranded DNA, 4 kinds of dNTPs, primers, origins

A geneticist found that a particular mutation had no effect on the polypeptide encoded by the gene. This mutation probably involved _____. (eText Concept 14.5) the deletion of one nucleotide a missense mutation the insertion of one nucleotide a nonsense mutation a silent or neutral mutation

How many nucleotides are needed to code for a protein with 450 amino acids? (eText Concept 14.1) at least 150 at least 300 at least 450 at least 900 at least 1,350

In a eukaryotic cell, transcription takes place _____. (eText Concept 14.1) on the cell membrane in the rough endoplasmic reticulum in the cytoplasm on free ribosomes in the nucleus

On the off chance that you might contract an archaeal infection, how might it be treated? () It could be treated with antiviral medications because archaea are similar to viruses. It could be treated with antibiotics such as streptomycin that inactivate bacterial ribosomes because archaea and bacteria have similar ribosomes. It could be treated with drugs that disrupt gene splicing because archaea remove introns in the nucleus before sending mRNA to ribosomes. It could be treated with a vaccine. None of the listed responses is correct.

One strand of a DNA molecule has the following sequence: 3'-AGTACAAACTATCCACCGTC-5'. In order for transcription to occur in that strand, there would have to be a specific recognition sequence, called a(n) _____, to the left of the DNA sequence indicated. (eText Concept 14.2) centromere intron exon AUG codon promoter

The bonds that hold tRNA molecules in the correct three-dimensional shape are _____. (eText Concept 14.4) peptide linkages hydrophobic interactions covalent bonds ionic bonds hydrogen bonds

Transcription factors are found in _____. () archaea bacteria and eukaryotes bacteria and archaea eukaryotes archaea and eukaryotes

When genes are expressed, they produce _____. () enzymes RNA molecules phenotypic traits polypeptides The second and fourth responses are correct.

Which of the following is NOT true of RNA processing? Ribozymes may function in RNA splicing. A primary transcript is often much longer than the final RNA molecule that leaves the nucleus. Nucleotides may be added at both ends of the RNA. RNA splicing can be catalyzed by spliceosomes. Exons are cut out before mRNA leaves the nucleus.

Which of the following statements is true? (eText Concept 14.1) Each DNA base codes for three amino acids. Each gene codes for three proteins. It takes three genes to code for one protein. Each triplet has many different meanings. Each amino acid in a protein is coded for by three bases in the DNA.

In a genetic cross between AaBbCcDdEe and AabbccDdEe what fraction of the offsprings will have all recessive alleles? a) 1/64 b) 4/5 c) 0 d) 1/128 e) 1/256

e) 1/256

Given your knowledge of valence electrons and covalent bonds, which of the following molecules is a hydrocarbon that could exist? a) C6H12O6 b) CO2 c) C3H9 d) C3H12 e) C3H6 f) None of these

e) C3H6

What properties of DNA and protein did Hershey and Chase use to uniquely tag each of them in their experiment to show that DNA is the heredity material of phage? a) DNA has sulfur and protein has phosphorous b) DNA and proteins have both phosphorous and sulfur c) DNA and proteins have sulfur d) DNA and proteins have phosphorous e) DNA has phosphorous and protein has sulfur

e) DNA has phosphorous and protein has sulfur

Which of the following is/are true for enhancer elements? a) They maybe located thousands of nucleotides upstream or downstream of a gene. b) They maybe located thousands of nucleotides upstream or downstream of a gene, and there maybe multiple enhancers for a given gene. c) They maybe located within an intron. d) There maybe multiple enhancers for a given gene. e) all of the options

e) all of the options

You have identified a mutation in a gene which also seems to decrease transcription of another gene 2000 bp away from the mutation site. What regulatory sequence, which may be found within another gene, has likely been mutated in this instance? homeodomain motif proximal elements enhancer sequence core promoter upstream activator sequence

enhancer sequence

Each cell has the same genome, but not necessarily the same ____.

epigenome

You need 1 L of a 250 mM glucose solution for an intravenous (IV) infusion. How do you prepare this solution from a 1 M glucose stock? a) Mix 0.25 L of the 1 M stock with 1000 mL water b) Mix 250 mL of the 1 M stock with 1 L water c) None of these d) Mix 25 mL of the 1 M stock with 975 mL water e) Mix 200 mL of the 1 M stock with 800 mL water f) Mix 250 mL of the 1 M stock with 750 mL water

f) Mix 250 mL of the 1 M stock with 750 mL water

Prader-Willi syndrome is a genetic disorder involving a partial deletion of chromosome 15q on the paternal chromosome. When both copies of a gene (or chromosome) are functional but only one is expressed, this is an example of chromatin modifications. histone acetylation. position effect variegation. genomic imprinting. X inactivation.

genomic imprinting

How do different silencers play a role in cell identity and development?

have different sites for different regulatory proteins for action in different tissues

Define epigenetics.

heritable changes in phenotype or gene expression with no alteration of DNA sequence

A region of chromatin has recently become DNAse I hypersensitive. Which enzyme has been activated to cause this change in chromatin structure?

histone acetylase

What kind of chemical bond is found between paired bases of the DNA double helix? hydrogen covalent phosphate ionic sulfhydryl

hydrogen

What does DNase I hypersensitivity allow?

identification of open and closed chromatin

iii, v, ii, iv, i

What is Sonic hedgehog (SHH)?

important reg in several developmental pathways, including limb development

The first stage of translation and transcription is - initiation - elongation - termination

initiation

The imprinting control region (ICR) involved in genomic imprinting on chromosome 15 is what type of sequence?

insulator

What causes Chromatin packaging?

interactions between DNA and histones, forming nucleosomes.

All of the following are associated with nucleic acid structure EXCEPT uracil. ribose. phosphate. ionic bonds. hydrogen bonds.

ionic bonds

Upstream activator sequence

is an enhancer-like DNA sequence that binds regulatory proteins that interact with promoter-bound proteins to activate transcription

upstream activator sequence

is an enhancer-like DNA sequence that binds regulatory proteins that interact with promoter-bound proteins to activate transcription.

Dicer

is the enzyme complex that is active in RNAi, where it cuts double-stranded regulatory RNAs into 21-bp to 26-bp segments that are subsequently denatured by RISC.

RNA interference

is the posttranscriptional regulation of mRNAs by regulatory RNA molecules.

iv, i, ii, iii

enhancer sequence is likely to be: Check all that apply. located upstream of the gene it controls orientation independent located either nearby or at great distance from the gene it controls located whitin a few dozens nucleotides of the gene it controls located downstream of the gene it controls orientation dependent

located upstream of the gene it controls orientation independent located either nearby or at great distance from the gene it controls located downstream of the gene it controls

promoter sequence is likely to be: Check all that apply. orientation independent located downstream of the gene it controls located within a few dozens nucleotides of the gene it controls located either nearby or at great distance from the gene it controls orientation dependent located upstream of the gene it controls

located within a few dozens nucleotides of the gene it controls orientation dependent located upstream of the gene it controls

If you want to affect chromatin packaging, which amino acid could you mutate to affect both histone acetylation and methylation patterns?

lysine

During RNAi, what do miRNAs target for destruction?

mRNAs

Below is a fully processed mRNA transcript. What will be the amino acid sequence produced by translation of this message? 5'GCCGCAACAUGUCUUCGUUAUCCUAGGGGUAAUAAACCCGUAUAAAAAAAAAAA 3' met-glu-arg-arg-glu-leu met-ser-leu-ser-leu-ser ser-ala-thr-cys-leu-arg-tyr-pro-arg-gly-asn-lys-pro-val met-arg-glu-arg-glu-arg met-ser-ser-leu-ser

met-ser-ser-leu-ser

The Ames test proves that a chemical is carcinogenic in humans. mutagenic in humans. carcinogenic. mutagenic in Salmonella. carcinogenic in Salmonella

mutagenic in Salmonella.

What does "Cis acting" mean?

mutations that only influence transcription on *same chromosome*

A point mutation that changes a codon for an amino acid to a stop codon is called: A. Stop mutation B. Missense mutation C. Nonsense mutation D. Frameshift mutation

nonsense mutation

What is Nucleotide Methylation? Where and where does this occur?

occurs on DNA, not histones; uses DNA methyltransferases. on C at CpG dinucleotides methylation. occurs in genomic imprinting.

What is Genomic Imprinting?

phenomenon in which expression of an allele in offspring depends on whether the allele is inherited from the male or female parent

The sequence of the DNA "backbone is

phosphate-sugar-phosphate-sugar

Which of the following synthesizes short segments of RNA? DNA polymerase III ligase DNA polymerase I primase helicase

primase

Where are CpG islands clustered in mammalian genomes?

promoters

Regulation of gene activity requires interaction between what?

protein and DNA

Enhanceosomes

protein complexes that assemble at enhancers to facilitate transcription

What do cis-regulatory sequences do? Name at least two examples.

regulate genes on the same chromosome. promoter, enhancers

In general, what do enhancers do?

regulate the timing/spatial patterns of gene expression

What do covered promoters characterize?

regulated genes that require the remodeling/movement of nucleosomes to allow transcription activators to bind.

The purpose of a spliceosome is to: - add a 3' cap to mRNA - remove introns and bring together exons in an mRNA molecule - link Okazaki fragments together on the lagging strand - remove mRNA from the nucleus - add a poly A tail to mRNA

remove introns and bring together exons in an mRNA molecule

Silencer sequence

represses transcription by binding proteins that block enhancer mediated transcription

silencer sequence

represses transcription by binding proteins that block enhancer mediated transcription.

It became apparent to Watson and Crick after completion of their model that the DNA molecule could carry a vast amount of hereditary information in which of the following? side groups of nitrogenous bases sequence of bases different five-carbon sugars phosphate-sugar backbones complementary pairing of bases

sequence of bases

insulator sequence

shields genes from enhancer effects by promoting the formation of specific DNA loops that protect particular genes from enhancers.

insulator sequence

shields genes from enhancer effects by promoting the formation of the specific DNA loops that protect particular genes from enhancers

Reduced rate of evolution of enhancers at regions that bind protein is due to which process?

strong purifying selection, which prevents evolutionary change

What do Epigenetic maintainers ensure?

that epigenetic mods are passed on to daughter cells (the exact mechanism that allows this is not entirely clear)

What does a gap indicate? What the continuous banding in other samples indicate?

that some parts of the upstream region were not cut by DNaseI. DNase I hypersensitivity.

Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that

the amount of A is always equivalent to T, and C to G.

Which of the following can be determined directly from X-ray diffraction photographs of crystallized DNA? the rate of replication the frequency of A vs. T nucleotides the bond angles of the subunits the sequence of nucleotides the diameter of the helix

the diameter of the helix

The leading strand and the lagging strand differ in that...

the leading strand is synthesized in the same direction as the movement of the replication fork, and the lagging strand is synthesized in the opposite direction.

post-translational polypeptide processing forms

the mature protein product. An enzyme cleaves the starting amino acid and may replace it with a phosphate. acetate, amide or a methyl group. Although phosphorylation is the most common out of the list of modifications.

The difference between ATP and the nucleoside triphosphates used during DNA synthesis is that

the nucleoside triphosphates have the sugar deoxyribose; ATP has the sugar ribose.

RNA interference

the post-transcriptional regulation of mRNAs by regulatory RNA molecules

RISC

the protein complex that is part of the RNA interference (RNAi) mechnaism. It denatures short double-stranded RNAs to single strands that carry out RNAi.

What is the primary function of the SWI/SNF complex?

to open chromatin structure by displacing or ejecting nucleosomes.

What happens to microRNA (miRNA)?

transcribed with RNA Pol II but folds on itself to form double-stranded RNA (dsRNA)

What does the binding of transcription activators (ACT) allow?

transcription of a gene occurring immediately upstream of the NDR (+1 nucleosome).

(true or false) Alternative splicing is an example of gene regulation that occurs after the synthesis of mRNA.

true

A muscle enzyme called ME1 is produced by transcription and translation of the ME1 gene in several muscles during mouse development, including heart muscle, in a highly regulated manner. Production of ME1 appears to be turned on and turned off at different times during development. To test the possible role of enhancers and silencers in ME1 transcription, a biologist creates a recombinant genetic system that fuses the ME1 promoter, along with DNA that is upstream of the promoter, to the bacterial lacZ(β-galactosidase) gene. The lacZ gene is chosen for the ease and simplicity of assaying production of the encoded enzyme. The diagram shows the structure of the recombinant, as well as bars that indicate the extent of six deletions the biologist makes to the ME1 promoter and upstream sequences. The table displays the percentage of β-galactosidase activity in each deletion mutant in comparison to the recombinant gene system without any deletions. Part A Does this information indicate the presence of enhancer and/or silencer sequences in the ME1 upstream sequence? yes no

BIO Test 3

Related study sets

business final

Anthro 101 - Final

Citing Sources & 6 Steps to Effective Paraphrasing

Chapter 22 Id's

PCS 4810- ch 1, PSC4810 - CH2, PSC 4810 - Unit 3, PSC4810 Ch 5

guard card

Anatomy Chapter 4

Series 65

First Expert - Unit 2 - Transformations with Pres Perfect Simple or Cont.

GYN MID TERM

legal aspects chapter 13 quiz

Econ 2315 Ch 9

Chapter 31

Chapter 7 Accounting (Long-term assets)

Psyc unit 11

lab 11- (BIO LAB EXAM PART 3)

WPC 300 all quizzes for final

Chemistry Unit 4 Lesson 5

Adam Smith: Father of Economic Science

psych