BIOL 13-15

Which of the following explains the difference between VNTRs and RFLPs?

In VNTRs, we are looking at the number of times a sequence is repeated; in RFLPs we are looking at size differences resulting from different restriction sites being present.

What is the difference between mismatch repair and nucleotide excision repair?

In mismatch repair, one nucleotide is replaced, whereas in nucleotide excision repair several nucleotides are replaced.

SNPs within a gene called FOXO correlate with increased longevity in humans. You are a researcher in a lab and wish to determine if you possess this SNP. Based on this correlation, where must the SNP be located in the genome in relation to the FOXO gene?

It is impossible to tell without further analysis

Only polymorphisms that add or remove restriction sites can be useful in DNA typing.

false

Spontaneous mutations that occur in somatic cells will be transmitted to offspring.

false

The genotype of an organism constitutes its observable characteristics.

false

The use of antibiotics creates mutations in bacteria that make the bacteria resistant to these antibiotics.

false

Transposable elements make up about 75 percent of the DNA in the human genome.

false

True-breeding plants are typically heterozygous for most genes.

false

When a genome is annotated, researchers identify all of the protein-coding genes and assign each protein with a function.

false

In mammals, females have two copies of the X chromosome, whereas males have only one copy. Dosage compensation is accomplished in mammals by:

females possessing a randomly inactivated X chromosome in all cells.

Which of the following are sequence motifs?

open reading frame hairpin structures promoters coding region *All of these choices are correct.

SNPs arise from:

point mutations

The procedure of replica plating demonstrated that mutations are random with respect to:

point mutations or deletions. whether A or G is replaced with T or C the needs of the organism. *All of these choices are correct.

Having more than two sets of chromosomes in the genome called:

polyploidy

DNA supercoils that result from overwinding produce _____ supercoils.

positive

The difference between a single nucleotide polymorphism (SNP) and a point mutation is that:

a point mutation is when a base pair is changed to a different base pair, whereas a SNP is when the base pair differs among individuals in a population.

The C-value paradox is the disconnect between genome size:

and organismal complexity.

Mutation rates (per nucleotide per replication):

are highest in viruses.

The rates of evolutionary change in DNA:

are highly variable among different gene families.

In the eukaryotic DNA sequence below, each highlighted sequence consists of a simple-sequence repeat. How are the highlighted regions organized relative to each other? ATTATCATCATCATCATCATTTACTAATCCTCATCATCATCATCATGGAATCTACATCATCATCATCAT

as dispersed sets

A cell in which viral reproduction occurs is called a:

host cell

Sites in the genome that are more susceptible to mutations than others are called:

hotspots

What type of virus structure does the adenovirus in Figure 13.18c represent? Click to view full size.

icosahedral

Approximately what percentage of the human genome consists of repetitive DNA or transposable elements?

50%

What is the difference between a gene and an allele?

A gene is a segment of DNA that codes for a protein or RNA; alleles are alternate forms of a gene.

Which of the following could explain how some (although not many) people can have Down syndrome and have a normal chromosome number?

An unbalanced translocation carrying most of chromosome number 21.

Which of the following statements is true regarding sequence motifs?

An open reading frame is a type of sequence motif.

A new gene is discovered that dramatically aids in the digestion of fish. You hypothesize that populations with a history of being near the shoreline would have more copies of this gene than populations found farther inland. How would you classify this genetic difference?

CNV

The differences among individuals in the number of copies of a region of a genome are known as:

CNV

Transposable elements are:

DNA sequences that can insert themselves into new positions within the genome.

DNA transposable elements are a class of transposable elements that uses:

DNA as an intermediate

The reverse transcriptase in the HIV genome encodes a protein that makes:`

DNA from RNA

Which of the following enzymes is responsible for initiating certain types of base excision repair?

DNA uracil glycosylase

Imagine that you know two sisters—Rose and Sam—both of whom smoke. Rose has a mutation in the gene for alpha-1 antitrypsin, whereas Sam does not. Which of the following statements is true regarding these sisters?

It is possible that neither Rose nor Sam will develop emphysema; however, the fact that both sisters smoke—added to the mutation that Rose carries—increases their chances of developing this disease.

Which of the following is an advantage of DNA typing?

Only small amounts of DNA are needed

Imagine that a researcher is studying a mouse that carries a mutation in Pax7 —a gene that is involved in muscle development. To his surprise, these Pax7 mutant mice appear relatively normal. What is a possible explanation for this?

Other members of the Pax gene family have redundant functions in muscle development (and can compensate for the Pax7 mutation). The normal copy of Pax7 on the corresponding homologous chromosome is sufficient for mouse survival. These Pax7 mutant mice may have a synonymous mutation. *All of these choices are correct.

A patient is about to receive chemotherapy and the doctor is concerned with dispensing the correct dosage. Certain people cannot metabolize this type of chemical because they have a mutation that changes a codon for valine into one for aspargine. How would such a mutation be classified?

SNP

Until 20 or 30 years ago, people with cystic fibrosis (CF) wouldn't live long enough to reproduce. CF is a homozygous recessive condition, leading researchers to think that over time the incidence of CF would decrease because the allele would be removed from the gene pool. The results actually indicate that the rate of CF is on the rise. Based on what you know about why certain genotypes and phenotypes persist in a population, which of the following could be a likely explanation for why the rate of CF is on the rise?

The heterozygous condition is beneficial, much like what we see with sickle cell trait.

After doing PCR on the same region between two individuals, you notice that each person's DNA yielded pieces of different sizes. Which of the following is the most likely explanation?

This is an example of VNTRs.

Sequence assembly is accomplished by:

aligning the fragments by using a complex computer program.

Why do RNA viruses and retroviruses have such a high rate of mutation?

because viral polymerases lack a proofreading mechanism

CNV stands for:

copy number variation

Genes that modify the expression of other genes show:

epistasis

A newly arisen point mutation always creates a SNP.

false

Which of the following statements about mutations is true? A mutation:

may leave the amino acid sequence of a protein unchanged.

Imagine a gene in which the sequence that is transcribed into a GAG codon, which codes for glutamic acid, is mutated to GUG, which codes for valine. What type of mutation is this?

missense

Sickle-cell anemia results from what type of mutation?

missense

A researcher annotating the rabbit genome would describe:

non-coding DNA. tandem or dispersed repeats. intron/exon boundaries in genes. DNA encoding hairpin RNAs. *All of these choices are correct.

Only 2.5 percent of the human genome actually codes for proteins. The other 97.5 percent includes:

noncoding RNA. repetitive DNA. introns. *All of other answer options are correct.

DNA wraps around histone proteins to form units called _____.

nucleosomes

The size of a genome is measured by:

number of base pairs

Within a nucleoid, the supercoiled DNA loops are held together by:

proteins

If an individual is homozygous for a certain allele, it means that:

the individual received the same allele from each parent.

Repeated sequences make genome sequencing challenging for of all of the following reasons except:

the long repeats often have mutations that are not easily sequenced.

Which of the following is the likely explanation for a flower showing multiple sectors with different coloration?

the result of transposable elements

Which of the following is not a type of sequence identified by gene annotation?

topoisomerase

When comparing DNA sequences of similar genes for proteins in related species, you see that some of the sequences are longer in one species compared to the other. Which of the following would most likely represent the extra number of bases that you would see?

21

You are working in a medical research lab and have to determine if a patient is heterozygous or homozygous for a particular restriction site. You isolate a region of DNA from each chromosome, the middle of which could contain the restriction site, if the patient has it. If you treat the DNA with the restriction enzyme, how many fragments will be produced if the patient is heterozygous for the presence of the restriction site?

3

In the sickle-cell anemia mutation, the 5′-GAG-3′ codon for glutamic acid becomes the 5′-GUG-3′ codon for valine. Assuming a single nucleotide substitution accounts for this mutation, what is the change in the DNA?

3′-CTC-5′/5′-GAG-3′ to 3′-CAC-5′/5′-GTG-3′

For any SNP, what is the maximum number of alleles possible?

4

Which of the following is true regarding RFLPs?

A polymorphism results in one site being recognized by a restriction enzyme, but not in others.

It is always true that the larger the organism, the more genes the organism will have in its genome.

false

Which of the following statements is true regarding a genome?

Genomes are "heritable," or passed from parents to offspring.

Which of the following statements is true regarding a chromosome deletion?

Chromosome deletions do not affect gene dosage. If a deletion eliminates the centromere, the chromosome is still passed on during cell division. Small chromosomal deletions usually have serious and often fatal consequences for an organism. Small chromosomal deletions are easily detected by microscopy. *None of the answer options is correct.

Which of the following enzymes is responsible for initiating the proofreading repair mechanism?

DNA polymerase

Imagine that a researcher is comparing the sequence of several protein-coding genes among mice, rabbits, and humans. She finds that, for most of these genes, the rabbit sequences are more similar to the human sequences than are the mouse sequences. What can she deduce?

More sequences are conserved between rabbits and humans than between humans and mice.

The fact that humans have a relatively large number of mutations per genome per generation when compared to other organisms can be explained by which of the following statements?

Most of a human's DNA is noncoding, so most of the mutations are neutral.

Imagine that you are a detective who has identified a suspect in a homicide. You acquire a small amount of blood from the crime scene and hand it over to your lab. The lab carries out PCR for one polymorphism, and it returns as a match to your suspect. Is this enough to arrest your suspect?

No, your lab should assess additional polymorphisms; a single polymorphism does not constitute a DNA fingerprint.

Which of the following statements is true regarding nondisjunction?

Nondisjunction only occurs during meiosis I or meiosis II, never during mitosis. Nondisjunction occurring during meiosis II results in two gametes that completely lack certain chromosomes. Nondisjunction only contributes to the development of trisomy 21 and not trisomy 13 or 18. Nondisjunction only occurs between autosomes; the sex chromosomes are rarely affected by nondisjunction. *None of the answer options is correct.

The ability to perceive a bitter taste from certain chemicals including PTC has been linked to certain alleles. Which of the following would provide an explanation for the fact that almost all nonhuman primates have the "taster" phenotype, whereas the human population has a significant percentage of "nontaster" phenotypes?

The advantage to being able to taste bitter compounds would keep you from eating poisonous compounds, an advantage not needed in the human population anymore.

Which of the following statements is true concerning the work of the Esther and Joshua Lederberg?

Their work relied on a technique of bacterial culture known as "replica plating," and demonstrated that mutations occur randomly in organisms.

Genetic studies have identified an allele (Δ32) that seems to provide protection against HIV. Which of the following would most likely explain the reason why our population has this mutation?

This mutation likely benefited the human population against some other related pathogen.

Which of the following statements explains why restriction enzymes are not useful for genome-wide studies of genetic variation?

Using restriction enzymes will only tell us differences in sequence variation in restriction sites.

Which of the following statements concerning cancer and mutations is correct?

Usually multiple mutations are required in different genes to cause cancer.

Which one of the following statements about virus classification is not correct?

Viruses are classified based on whether their genetic material is double-stranded DNA or RNA. Viruses are classified based on whether their genetic material is partially double-stranded or partially single-stranded. Viruses are classified based on whether the single-stranded DNA or RNA that serves as their genetic material has a positive or negative sense. *All of these choices are correct.

An arrangement of homologous pairs of chromosomes in order from longest to shortest is called:

a karyotype

A testcross of an organism of unknown genotype is done when the organism is crossed to an organism that is:

a recessive homozygote

Phenotypes

can be subject to environmental conditions.

Genetic risk factors:

can increase the likelihood of diseases. include mutations in the BRCA1 and BRCA2 genes. can work synergistically with environmental risk factors. can be heritable. *All of these choices are correct.

A nonsense mutation:

changes a codon for an amino acid into a codon for chain termination.

The region of DNA sequences before the start of a gene is often called the promoter. One type of promoter is called the TATA box. Many species' promoters are TATA boxes or a variation of the TATA box. DNA sequences that are similar in different organisms are called _____ sequences.

conserved

The concept of reverse transcription was at first very controversial because it:

contradicted the "central dogma" that DNA makes RNA.

A researcher has carried out Giesma staining on a set of human chromosomes, and has arranged these chromosomes into a karyotype. He notices that in a homologous pair, a band is missing from one of the chromosomes. This likely resulted from:

either a deletion or a reciprocal translocation.

A silent mutation is a mutation that only occurs in noncoding regions of DNA.

false

All DNA sequences are transcribed into RNA.

false

Any DNA "damage" is considered to be a mutation, even if it is immediately corrected by the action of DNA polymerase.

false

Any deviation in normal gene dosage is lethal.

false

As a result of the principle of blending inheritance, no gray rabbits actually exist. Over time, gray fur in rabbits has been diluted to white fur.

false

CNVs are chromosomal mutations that are always due to duplications.

false

DNA ligase is responsible for repairing thymine dimers caused by UV light.

false

DNA polymerase is responsible for the process called mismatch repair.

false

Environmental factors are unlikely to affect variable expressivity in individuals.

false

In base excision repair, a whole segment of DNA is removed and resynthesized.

false

In eukaryotes, genome size is a good predictor of gene number and organismal complexity.

false

Which of the following mutations would most likely have the most severe consequence?

frameshift

The number of new mutations in organisms following a round of genome replication:

generally increases with larger genomes

All of the genetic material transferred from a parent to an offspring is known as a:

genome

Homologous chromosomes are a pair of chromosomes that:

have the same genes in the same position. match in appearance. match in size. *All of these choices are correct.

The tobacco mosaic virus has a _____shape, whereas the T4 bacteriophage has a head-and-tail shape.

helical

Which of the following would you expect to have the lowest rate of point mutations per replication?

humans

A transposable element can insert into any position in the genome except:

regions near the telomere. regions near the centromere. regions near sequences coding for ribosomal RNA. inside another transposon. *All of these choices are correct.

Mutations that destroy or create a cleavage site for a restriction enzyme are the source of:

restriction fragment length polymorphisms.

The human chromosome 1 is approximately 250 million nucleotides long. In order to sequence human chromosome 1, the chromosome is broken up into hundreds of small fragments. These short fragments are placed together in the correct order to generate the long, continuous sequence of nucleotides in chromosome 1. Placing these fragments together is referred to as:

sequence assembly

What was the goal of the Human Genome Project?

sequencing every gene in the human cell

In the eukaryotic DNA sequence below, the highlighted repeat is a tandem repeat. It is also what other kind of repeat? CACACACACACACACA CACACACACACACACACACACA

simple sequence repeat

In the eukaryotic DNA sequence below, which type of repeat is highlighted? ATTATTTACTAATCCTCATCATCATCATCATGGAATTCATAATGCTAATGG

simple sequence repeat

A SNP stands for a:

single nucleotide polymorphism

Knowing an individual's DNA sequence may be beneficial because it makes it possible to predict:

susceptibility to disease. response to medications. physical differences. the occurrence of a disease. *All of these choices are correct.

Repeated sequences within eukaryotic genomes may be represented as long repeated sequences next to each other, and are called _____ repeats. Repeated sequences in eukaryotic genomes can also be spread throughout the genome, and are called _____ repeats.

tandem; dispersed

Two major types of transposable elements are those that transpose via a DNA intermediate and those that transpose via an RNA intermediate.

true

A chromosomal segment that breaks off and attaches to another chromosome is what type of mutation?

translocation

Normally, in corn, genes for waxy and virescent kernel appearance are in the same chromosome. In a certain stock, however, it was found that these two genes are in different chromosomes. Which chromosomal aberration would explain this?

translocation

A chromosomal mutation in which a segment is missing is called a deletion.

true

A nucleotide substitution typically has less severe consequences than a nucleotide addition or deletion.

true

Alleles are alternate molecular forms of a gene.

true

Among flowering plants, 30 percent to 80 percent of existing species are polyploidy somewhere within their evolutionary history.

true

Any mutation that has no effect on the organism is considered neutral.

true

Even though the chance of a mutation for one given nucleotide is rare, mutations are rather common when looking at the whole genome.

true

In the human genome, retrotransposons vastly outnumber DNA transposons.

true

Insertion of one nucleotide in a gene will lead to a frameshift mutation.

true

Mutagens increase the amount of damage to DNA.

true

Nondisjunction is when sister chromatids fail to separate during anaphase of cell division.

true

Some alleles in the heterozygous state are beneficial, whereas in the homozygous state the same alleles can be harmful.

true

The biggest difference between CNV and VNTRs is the size of the DNA being studied.

true

The occurrence of nondisjunction during mitosis can result in the development of certain cancers; however, nondisjunction is often thought of in relation to meiosis and the development of certain trisomies

true

There is no correlation between genome size and complexity of an organism.

true

Retrotransposons are a class of transposable elements that:

uses RNA as an intermediate

The number of tandem repeats in an individual will:

vary from chromosome to chromosome