Ch 13 - Gene Mutations and DNA Repair

Which of the statements describes what happens during mismatch repair of DNA? - Enzymes import a copy of the correct DNA sequence from another cell, cut out the segment of DNA that contains the mismatch, and insert the imported sequence. - Enzymes cut out both strands of DNA containing the mismatched sequence, copy the same sequence from the homologous chromosome, and insert the copied sequence. - Enzymes identify the newly synthesized DNA strand, remove a segment surrounding the mismatched nucleotides, and resynthesize the DNA segment correctly. - Enzymes identify the newly copied DNA strand, delete the mismatched nucleotide, pull the gap closed, and join the nucleotides on either side of the gap together.

- Enzymes identify the newly synthesized DNA strand, remove a segment surrounding the mismatched nucleotides, and resynthesize the DNA segment correctly. Mismatch repair takes place soon after a new strand of DNA is synthesized. Mismatch repair corrects mistakes involving mismatched DNA nucleotides and short insertions or deletion of nucleotides. The illustration shows a guanine (G) paired with a thymine (T), which is one such mismatch. After DNA is synthesized, a group of enzymes detects mismatches in the newly synthesized strand. The means of determining which strand is the new strand and which strand is the parent strand varies between organisms, but all organisms have enzymes that can distinguish between the two strands. Enzymes, called exonucleases, cut out a segment of the newly synthesized strand surrounding the mistake. DNA polymerase enzymes then resynthesize the segment using the parent strand of DNA as a template. DNA ligase, the same enzyme used in DNA replication, connects the new segment to the existing DNA upstream and downstream of the repair. The miscopied DNA is not replaced with DNA copied from somewhere else, either from the cell's own DNA or DNA from another cell. DNA cannot move across membranes and the DNA from one chromosome is not used to repair the DNA of another chromosome. Cells cannot simply delete misplaced nucleotides and close the gap. Deleting a mistake in the DNA could have negative consequences for the cell. For example, if the mistake occurs in a protein‑coding gene, the resulting protein would be altered which would likely impact its ability to function properly. In some cases, loss of function of a protein can result in cell death.

DNA damage can occur as a result of exposure to chemicals or ultraviolet radiation. What happens during nucleotide excision repair of damaged DNA? - Enzymes open the DNA strand, remove a segment of DNA from the strand that contains the damage, and resynthesize the correct DNA sequence. - Enzymes delete an incorrect DNA sequence, pull the gap closed, and join the bases on either side of the gap together. - Enzymes cut out the damaged gene, copy the same gene from the homologous chromosome, and insert the copy. - Enzymes detect an incorrect DNA base pairing in a DNA strand, remove the incorrect base, and insert the correct base.

- Enzymes open the DNA strand, remove a segment of DNA from the strand that contains the damage, and resynthesize the correct DNA sequence. Exposure to chemicals, ultraviolet radiation, and other mutagens, such as tobacco smoke, can damage DNA. DNA damage typically occurs on one strand of double‑stranded DNA and can result in bulges or bends in the DNA. Cells can use nucleotide excision repair to remove and replace sections of a damaged DNA strand that alters the shape of the DNA. Nucleotide excision repair often takes place prior to DNA replication, correcting the deformed DNA sequence before the DNA is copied. Nucleotide excision repair can also be performed if the bulge is detected during DNA replication. After a mistake is detected, a nuclease enzyme makes cuts upstream and downstream of the DNA damage on one strand of DNA. The cut DNA segment, which contains the damaged area and several bases on either side, is then removed. The undamaged DNA strand has the correct sequence and is left intact. A second enzyme, DNA polymerase, uses the undamaged DNA strand as a template to synthesize the correct sequence on the damaged DNA strand. The orange DNA in the illustration is the newly synthesized segment. A third enzyme, DNA ligase, joins the new sequence to the existing DNA upstream and downstream of the new sequence. Damaged DNA is not repaired by copying a correct sequence from one chromosome in a homologous pair and using it to replace an incorrect sequence on the other chromosome in the pair. Not only would it be difficult to identify the specific sequence needed, but chromosomes in a homologous pair often contain different alleles of a gene. DNA damage cannot be repaired by simply deleting an incorrect DNA sequence from a strand of DNA. A cell requires many genes to function, and removing a damaged section

Select which examples are induced mutations. - Errors in DNA replication cause the formation of point mutations - Ionizing radiation causes chromosomal fragmentation. - Nitrous acid causes the deamination of cytosine to uracil. - Transposition causes the formation of insertions

-Nitrous acid causes the deamination of cytosine to uracil. -Ionizing radiation causes chromosomal fragmentation. Induced mutations occur when a cell is either accidentally or deliberately exposed to a mutagen. The mutagen interacts with DNA to cause a mutation. Conversely, spontaneous mutations are mutations that occur naturally. Mutagens can be physical or chemical. Ionizing radiation, an example of a physical mutagen, results in the formation of free radicals that can react with the sugar‑phosphate bond of DNA, leading to fragmentation. As a result, ionizing radiation causes large‑scale chromosomal fragmentation. Nitrous acid, an example of a chemical mutagen, causes the deamination of adenine to hypoxanthine. Spontaneous mutations occur naturally during events such as DNA replication. Errors in DNA replication lead to point mutations, insertions, and deletions. Transposition refers to the movement of transposable elements. Once present in the genome, transposable elements do not require mutagen exposure to introduce mutations. The movement of transposable elements can cause insertions or deletions, depending on the mechanism of action.

The figure shows a transposable element inserted into a chromosome. Which sequence below includes the insertion site that this transposable element inserted into? The sequence of only the top strand is shown in the answers. [The illustration shows a DNA double strand. The sequence of the top strand is as follows: Flanking direct repeat starts T, G, C, A, A; Flanking direct repeat ends; transposable element starts; terminal inverted repeat starts A, T, C, G, C, A; terminal inverted repeat ends; terminal inverted repeat starts T, G, C, G, A, T; terminal inverted repeat ends; Flanking direct repeat starts T, G, C, A, A; Flanking direct repeat ends. The sequence of the bottom strand is as follows: Flanking direct repeat starts A, C, G, T, T; Flanking direct repeat ends; transposable element starts; terminal inverted repeat starts T, A, G, C, G, T; terminal inverted repeat ends; terminal inverted repeat starts A, C, G,

...AGTGCAACG... This sequence includes the sequence of the flanking direct repeat TGCAA.

The given DNA non-template sequence (coding sequence) is transcribed from 5' to 3' (L-R). Use the sequence to determine the type of mutation and the type of base substitutions that apply to each scenario. Place only one statement for each scenario. 5' A T G A C C G A A C G C T T G 3'

1) Mutation I: A thymine is substituted for nucleotide 6 = The type of mutation is silent and transition 2) Mutation 2: A cytosine is substituted for nucleotide 9 = The type of mutation is missense and transversion. 3) Mutation 3: An adenine is substituted for nucleotide 14 = The type of mutation is called nonsense and transversion. Missense mutations cause alterations to the nucleotide sequence, resulting in an amino acid change. The original amino acid is replaced by a different amino acid. Missense mutations alter the protein product. Silent mutations occur when a mutation alters a base pair in DNA, but there is no change in the amino acid. Silent mutations produce unaltered, functional proteins. Nonsense mutations cause the insertion of a premature stop codon in place of an amino acid. Nonsense mutations result in truncated proteins. Transitions and transversions are types of base substitutions. A transition occurs when a purine replaces another purine or when a pyrimidine replaces another pyrimidine. A transversion occurs when a purine replaces a pyrimidine or when a pyrimidine replaces a purine. The mutation of C to T at nucleotide 6 substitutes one pyrimidine base for the other. This type of replacement is a transition. In this case, the transition changes codon ACC to ACU, resulting in the same amino acid as the original amino acid. The mutation of A to C at nucleotide 9 substitutes a purine with a pyrimidine. This type of replacement is a transversion. In this case, the transversion changes codon GAA to GAC, resulting in an amino acid that is different from the amino acid encoded by the original triplet. The mutation of T to A at nucleotide 14 replaces a pyrimidine with a purine. This type of replacement is a transversion. In this case, the transversion changes codon UUG to UAG, resulting in a prem

The given nucleotide sequence is found in a short stretch of DNA. 5'-GA-3' 3'-CT-5' 1. What mutant sequence can result from spontaneous depurination in this stretch of DNA? 5′-GT-3′ 3′-CA-5′ 5′-GG-3′ 3′-CC-5′ 5′-AA-3′ 3′-TT-5′ 5′-GC-3′ 3′-CG-5′ 5′-CA-3′ 3′-GT-5′ 2. What mutant sequence can result from spontaneous deamination in this stretch of DNA? 5′-GT-3′ 3′-CA-5′ 5′-TA-3′ 3′-AT-5′ 5′-CA-3′ 3′-GT-5′ 5′-GC-3′ 3′-CT-5′ 5′-AA-3′ 3′-TT-5′

1. Depurination: 5'-AA-3' & 3'-TT-5' 2. Deamination: 5'-AA-3' & 3'-TT-5' Chemical changes happen frequently within DNA sequences. For example, depurination is the loss of a purine group from a nucleotide. Depurination occurs spontaneously and frequently in cells. Deamination, another chemical change that occurs in DNA, is the loss of an amino group from a nucleotide. This loss can either happen spontaneously or be induced by chemical exposure. Chemical changes such as these can alter the pairing properties of a nucleotide and, after replication, the repair process can result in a single base‑pair change. A depurinated nucleotide cannot act as a template for a complementary base during replication. Either adenine or guanine can undergo depurination. Then, adenine is typically incorporated in place of the base with the missing purine. Because adenine is incorporated, only the depurination of guanine will result in a change in the DNA sequence provided. After the depurination of guanine, the starting DNA sequence becomes 5′-AA-3′ 3′-TT-5′ A deaminated nucleotide can have altered pairing compared to the original nucleotide. In this example, the deamination of cytosine will result in a uracil. Uracil can base pair with adenine during replication, so after another replication cycle, the adenine will pair with thymine. Thus, an TA pair is now in place of the original CG pair. In this case, after deamination, the starting sequence would become 5′-AA-3′ 3′-TT-5′

The Ames test determines the frequency with which a chemical causes mutations in DNA. The results of the Ames test for the substances A, B, and C are provided. Label the carcinogenic potential of each of these substances based on the production of his+ revertants in the presence or absence of liver extract (-+ LE). his-strain + substance A -LE +LE his- strain + substance B LE +LE his- strain + substance C -LE +LE

1st strain- carcinogenic 2nd strain- non-carcinogenic 3rd strain- undetermined The Ames test is used to identify chemicals that can mutate DNA upon contact with the human body. Since accumulation of mutations can cause cancer, such chemicals are called mutagens or carcinogens. The Ames test determines the frequency with which a substance can induce mutations. One of the ways that the Ames test detects mutations is by measuring the rate at which the his− strains of the Salmonella bacterium are converted to his+ revertants. The his− strains carry mutations in the histidine operon that prevent histidine synthesis. So, his− cells cannot grow on plates without histidine. However, mutagens can mutate the histidine operon and reverse the his− mutations to produce his+ revertants. The his+ revertants synthesize histidine and therefore can grow in the absence of histidine. In this study, substances A, B, and C are mixed with his− strains and added to plates without histidine. Each substance is tested for its mutagenic potential in the presence and absence of liver extract (LE) from rats. LE is used in the Ames test to mimic the metabolic processes of mammalian livers, which may break down a non‑mutagenic substance into a potentially mutagenic form. Thus, addition of LE helps to determine if a chemical is potentially carcinogenic to humans if ingested and metabolized by the liver. For substance A, no his+ revertants are seen in the absence of LE. This suggests that substance A is not mutagenic in its natural form. But, substance A produces revertants in the presence of LE, suggesting that liver enzymes can convert substance A into a mutagenic form. So, substance A is likely carcinogenic upon ingestion. For substance B, no his+ revertants are seen in the presence or absence of LE. This suggests that substance B co

Given the sequence shown, what would be the resulting mutant sequence if it undergoes alkylation of guanine? DNA: 5'-AGTCCGATTAGCCCGTAATT-3' 5'-AATTTAATTAGTTTATAATT-3' 3'- AATTTAATTAGTTTATAATT -5' 3'-TTAGGTTAATCGGGTATTAA-5' 3'-TTAATGCCCGATTAGCCTGA-5'

3'-TTAGGTTAATCGGGTATTAA-5' This DNA sequence accurately produces the mutant strand after alkylation.

Given the sequence shown, what is the mutant sequence and what would be the change in base composition of adenine from the original if the strand underwent hydroxylation during before replicating? DNA: 5'-AGTCCGATTAGCCCGTAATT-3' 5'-TCAAAGTAATGAAAGATTAA-3'; 55% 5'-AATTAGAAAGTAATGAAACT-3'; 55% 5'-TCAAAGTAATGAAAGATTAA-3'; 30% 5'-AATTAGAAAGTAATGAAACT-3'; 30%

5'-AATTAGAAAGTAATGAAACT-3'; 30% The strand shown is the strand produced after one round of replication when undergoing hydroxylation. Once the mutant strand is found, the change in base composition is the difference between the final mutant and the original strand. In the original strand, there are five adenine bases, which would comprise 25% of the original strand. The mutant would contain 11 adenine bases, which would comprise 55%. The difference would get you to a 30% change.

Peter is assessing the presence of mutations in model DNA strands. He captures the DNA sequence shown. What would the resulting RNA complement be if undergoing the mutations shown? DNA: 5'-TCAATAGATGTTTTACCGGGTTAC-3' Mutation: transitions at position 1, 5, 10, 14, and 17 5'-CUAAUCCGGAAAAGCACCUAUUGA-3' 5'-GUAACCCGGUAAAACAUCUAUUGA-3' 5'-AUGAUCCAGCAAGACACCUGUUGA-3' 5'-AUAAUCCGGCAAAGCACCUAUUGA-3'

5'-AUAAUCCGGCAAAGCACCUAUUGA-3' This is the complete RNA complement with the mutations included. In purines, transitions occur between adenine and guanine while, in pyrimidines, transitions occur between cytosine and uracil.

Joel is assessing the presence of mutations in model DNA strands. He captures the DNA sequence shown. What would the resulting RNA complement be if undergoing the mutations shown? Note that the mutations occur in the order of position. DNA: 5'-TCAATAGATGTTTTACCGGGTTAC-3' Mutation: insertions at positions 4, 7, and 13; deletions at 2, 9, and 24 5'-GAAGCCUCGUAACAACAUCUAUUG-3' 5'-GUAACCCGGUAAAACAUCUAUUGA-3' 5'-GAAGCCTCGTAACAACATCTATTG-3' 5'-GAGACUCGGUGAAAACAUCUAUUG-3'

5'-GAAGCCUCGUAACAACAUCUAUUG-3' This is the complement following the mutations based on the position at which the mutation occurs as it increases.

Zidovudine (AZT) is a drug used to treat patients with acquired immunodeficiency syndrome (AIDS). AZT works by blocking the reverse transcriptase enzyme used by the human immunodeficiency virus (HIV), the causative agent of AIDS. What type of transposable elements would be affected by AZT and what would be the most likely effect? - Transposable elements that use an RNA intermediate for transposition would be affected, as the RNA intermediate would not be able to converted into DNA - Transposable elements that transpose through a copy-and-paste mechanism would be blocked at the replication step. -LTR retrotransposons only would be blocked at the reverse transcription strep -All types of retrotransposons would be blocked at the reverse transcription step - All transposable elements would be affected, as they would no longer be able to transpose to a new location

All types of retrotransposons would be blocked at the reverse transcription step Transposable elements that use an RNA intermediate for transposition would be affected, as the RNA intermediate would not be able to converted into DNA Zidovudine (AZT) is a drug that works by preventing the enzyme reverse transcriptase from transforming an RNA sequence into a DNA sequence. AZT should affect any transposable element that uses an RNA intermediate for transposition like retrotransposons because they transpose through an RNA intermediate that is reverse transcribed to DNA by reverse transcriptase. If endogenous reverse transcriptases in human cells have similar sensitivity to AZT as HIV reverse transcriptase, then AZT should inhibit retrotransposons.

Which of these statements is true regarding depurination? Depurination is a common cause of spontaneous mutations secondary to depyrimidination. In the absence of base-pairing constraints, a matched nucleotide is incorporated into the template DNA strand opposite the apurinic site. An apurinic site cannot act as a template for complementary base pairing in replication. Depurination is the result of a break in the covalent bond between a purine and the 3'-carbon atom of the deoxyribose sugar.

An apurinic site cannot act as a template for complementary base pairing in replication. Since there is a loss of a nucleotide, there would be no way to act as a template for base pairing.

Which of these is a step in the process of assessing carcinogenesis in a chemical? The bacteria are incubated, and the resulting colonies that appear have undergone his- to his+ mutation. Bacterial strains are mixed with liver enzymes that have the ability to convert compounds into potential mutagens. None of the bacteria are mixed with the chemical to be tested for mutagenic activity. The bacteria are plated on a medium that incorporates histidine.

Bacterial strains are mixed with liver enzymes that have the ability to convert compounds into potential mutagens. The liver enzymes can be utilized with his- to convert compounds into mutagens. This is the first step in screening for carcinogenesis in a chemical.

Which of the examples is not one of the basic types of gene mutations? Deletions of base pairs Insertions of base pairs Base-pair rearrangements Base-pair substitutions All are basic types of mutations

Base-pair rearrangements

Which of the sequences listed are possible flanking sequences that could be generated by a transposing insertion after the first six base pairs of the target sequence GCATAGCCTGAT? CGTATC GCAACG GATACG TAGTCC GCATAG

CGTATC GCATAG A transposon, also called a transposable element (TE), is a DNA sequence that can move to a different region of the genome through one of several different mechanisms. Some TEs remain as DNA during transposition, whereas other TEs function through an RNA intermediate. During transposition, a TE can translocate either by excision and insertion or by duplication. Because DNA is double‑stranded, there are two 6 bp flanking sequences that are possible out of the listed sequences. When comparing the possible sequences to the given sequence, GCATAG is possible because the sequence is found within the given sequence. There is also the second strand to consider, which is complementary to GCATAG. Determine the complementary sequence of GCATAG by replacing each base with its complementary base. For example, A is complementary to T. The resulting sequence is CGTATC. During transposition, transposase binds to the insertion sequence, indicated in the first figure, and makes a staggered cut, leaving behind two single‑stranded sections of DNA, as shown in the second figure. The TE inserts into this cut region, as shown in the second figure below. Single‑stranded regions of DNA flank the TE, which are replicated by DNA polymerase. As shown in the third figure below, DNA polymerase replication generates double‑stranded DNA and thus duplicates the original insertion sequence. The flanking sequences are also called direct repeats because the orientation of the repeats is the same on each end of the transposon. [see image][A circular piece of double stranded DNA. One strand has the sequence C T G A A T A G C C T. The other strand has the complimentary sequence G A C T T A T C G G A. A transposable element has inserted into the circular double stranded DNA. On one side of the transposable element the sequence for

Expansion of triplets of nucleotides are "fixed" into the DNA strand by which of the processes listed? DNA recombination DNA replication and DNA recombination DNA replication DNA replication and DNA repair synthesis DNA repair synthesis

DNA replication and DNA repair synthesis

Which of these statements is FALSE regarding deamination? Deamination is a mutation that is typically spontaneous only. Thymine's presence in DNA is attributed to the presence of a form of methylated cytosine termed 5-methylcytosine. The deamination of a nucleotide would typically lead to an incorporated error during the second round of replication. Deamination is the addition of an amino group to a base.

Deamination is a mutation that is typically spontaneous only. Deamination can arise from spontaneous mutations or through an induction by mutagenic chemicals.

Hydroxylamine is a chemical mutagen that causes, specifically, GC-to-AT transitions in phage T4, while 5-bromouracil readily causes both types of transitions. UV light causes an increase in the frequency of rII mutations in T4. Most of these UV-induced mutations—57 of 62 analyzed—revert at a high frequency when exposed to 5-bromouracil but not when exposed to hydroxylamine. The remaining five mutations reverted with both mutagens. What type of mutation does UV mainly create when producing rII mutants? G-to-A G-to-C A-to-C A-to-G

G-to-A Hydroxylamine would not be able to revert these mutations, but 5-bromouracil would be able to.

In order to determine whether radiation associated with the atomic bombing of Hiroshima and Nagasaki produced recessive germ-line mutations, scientists examined the sex ratio of the children of the survivors of the blasts. Why might an increase in germ-line mutations be expected to alter the sex ratio? More females than males are expected to die because females do not have a Y chromosome that suppresses X-linked recessive lethal mutations. More males than females are expected to die because of recessive lethal mutations on the Y chromosome. More females than males are expected to die of sex-linked recessive lethal mutations because females have two X chromosomes. More males than females are expected to die of sex-linked recessive lethal mutations because males have only one X chromosome.

Germ‑line mutations occur in the cells that develop into egg and sperm. Unlike somatic mutations, germ‑line mutations are transmitted to the offspring. Children can inherit autosomal mutations, which can be on any of the 22 pairs of homologous autosomes in a human genome. Children can also inherit sex‑linked mutations, which can be on either the X or the Y sex chromosome. Female children have a pair of homologous sex chromosomes (XX), whereas males have nonhomologous sex chromosomes (XY). In humans, at least one X chromosome is required for viability in both males and females, whereas the Y chromosome does not contain any genes that are vital for survival. Thus, lethality can be used as a phenotypic indicator of an X‑linked mutation, but cannot be used as an indicator of a Y‑linked mutation. A recessive mutation on a single chromosome can be phenotypically expressed if there is no homologous allele present to mask its activity. Males normally have one copy of each type of sex chromosome (XY). Thus, a lethal X‑linked or Y‑linked recessive mutation is always expressed in males but does not affect females (XX). If nuclear radiation had produced an increase in recessive germ‑line mutations that were X‑linked and lethal, then male offspring would be disproportionately affected. A recessive X‑linked mutation in a male is phenotypically expressed because it cannot be suppressed by a homologous wild‑type allele. Thus, the sex ratio of the children of the survivors would be skewed toward females.

Where would a germ-line mutation in a parent cell be located in the offspring? It is found in somatic and germ-line cells. It is found in germ-line cells only. It is found in somatic cells only. It is found in neither somatic or germ-line cells. It will not be passed down to the offspring.

It is found in somatic and germ-line cells. A germ-line mutation can be passed to future generations, producing offspring that carry the mutation in all their somatic and germ-line cells.

Which of these is a disadvantage of mutations in populations? Mutations allow organisms to adapt to environmental changes. Mutations are the source of genetic diversity. Mutations allow for offspring to further the line of inheritance by the principles of evolution. Mutations can be the source of many diseases and disorders.

Mutations can be the source of many diseases and disorders. The increased rate of diseases and disorders is exponentially greater with those who undergo genetic mutations.

Which one of these statements is correct concerning nucleotide-excision repair? Nucleotide-excision repair is a complex process that requires multiple enzymes to remove DNA lesions from the double helix. Once a distortion has been located, helicase enzymes peel the damaged strand and allow the strand to be replaced by DNA ligase and sealed by DNA polymerase. The sugar backbone is cleaved on one side of the damage to allow for a replacement strand by DNA polymerase. The process of nucleotide-excision repair seeks to scan DNA and locate distortions in the two-dimensional configuration of DNA.

Nucleotide-excision repair is a complex process that requires multiple enzymes to remove DNA lesions from the double helix. The process involves many enzymes due to the impact on gene expression. This process includes several polymerases, helicases, and ligases for the repair of the damaged strand.

Classify each definition or example as a somatic mutation, gametic (germ line) mutation, our both.

Somatic mutation: The mutation affects only the individual in which the mutation occurs and is not passed on to the progency. A particular tobacco leaf becomes discolored due to mutation halfway through the life of the plant Gametic mutation: The mutation arises in the gametes of the individual and is trasmitted to the progeny A man receives a pelvic X-ray. None months later, his child is born with a chromosomal abnormality Both: Mutations can be caused by an alteration in the DNA sequence Mutations are stable alterations in the DNA sequence. Mutations can be categorized in a variety of ways. In eukaryotic, multicellular organisms, one categorization is based on the type of cell in which the mutation initially arises. Mutations that arise in the cells that become gametes are called germ line mutations. Mutations that occur in the cells of the body other than germ line cells are called somatic mutations. In humans, gametes are produced in the gonads. Ionizing radiation, such as ultraviolet rays and X‑rays, can cause chromosomal structural abnormalities, such as translocations, inversions, and deletions. Exposure of the gametes to ionizing radiation may lead to the formation of gametic mutations. Specifically, gametic mutations can manifest as alterations in the DNA sequence or chromosomal aberrations. Gametic mutations are transmitted to the progeny of the individual in which the mutation originated. As a result, both the somatic and germ cells of the progeny will have the mutation. Somatic mutations can result in an organism that is genotypically and phenotypically a mosaic of normal and mutant tissue. Localized regions of phenotypic abnormality, such as small patches of discoloration in otherwise normal leaves, are examples of somatic mutations. Since somatic mutations do not arise in the gametes of the orga

Suppose the fictional condition lycanthropy is an autosomal dominant disorder that causes an affected person to have a strong physical reaction to the changing lunar cycle. Most cases of lycanthropy are due to spontaneous new mutations in the gametes of normal individuals. These new cases are due to a spontaneous mutation that occurs in paternal gametes, as opposed to maternal gametes. Additionally, the likelihood of this mutation occurring increases as the father ages. Which statements represent a related hypothesis for these findings? As age increases, speed decreases; therefore, the ability for a man to outrun a lycanthrope is reduced, and he is more likely to develop lycanthropy through horizontal transmission. Sperm undergo more mitotic cellular divisions than eggs and therefore have a higher risk of developing a spontaneous mutation. The gene involved in lycanthropy may be in a mutational hotspot. The muta

Sperm undergo more mitotic cellular divisions than eggs and therefore have a higher risk of developing a spontaneous mutation. The gene involved in lycanthropy may be in a mutational hotspot. The mutation for lycanthropy may confer a benefit to the sperm, increasing its chance of survival when compared to a normal sperm. In this fictional scenario, the cause of lycanthropy is an autosomal dominant mutation. The dominant mutation has a strong positive correlation with the paternal gamete, sperm. The disease has also been associated with older fathers. Hypotheses that correspond to these paternal attributes of the disease should include information about mutation rates or the age‑related occurrence of mutations. As a man ages, he continually produces sperm through many mitotic cellular divisions. The more times replication occurs, the more likely an error will arise in any given cell. Because more cellular divisions occur in males in the production of sperm than in females in the production of eggs, the process of producing sperm in males increases the probability that a spontaneous mutation will occur in a single gamete. The gene involved in lycanthropy may also be in a mutational hotspot. Given the fact that men are producing more sperm, if the gene is in a mutational hotspot, changes are more likely to be observed in sperm as opposed to eggs because they are produced far more frequently. If the mutation conferred an advantage that helped sperm reach and fertilize an egg, it would likely remain in the population, despite the side effects of the disease phenotype. The spontaneous mutation increases the fitness of the man, if only temporarily, and would likely not be removed via selection. The somatic mutation rate does not differ overall between males and females. Additionally, somatic mutation rate will not be

Suppose Sally grew a wild type E. coli culture in rich liquid media that contained all 20 amino acids until the culture was dividing exponentially, with one cell division approximately every 20 minutes. She then added the mutagen 5-bromouracil to the media. After the cells had grown for 20 more minutes, she washed the cells to remove the mutagen and resuspended the washed cells in sterile water. Next, Sally plated the resuspended cells on minimal media supplemented with tryptophan and obtained well-separated colonies, such that each colony arose from a single bacterial cell. She replica-plated these colonies on minimal media and selected a single colony that grew on the media supplemented with tryptophan, but not on minimal media. Sally inoculated 10 test tubes containing fresh minimal media supplemented with tryptophan with cells from this colony and grew the 10 cultures until the cells were dividing exponentially

Spontaneous reverse mutation Spontaneous mutations occur naturally, as a result of errors during DNA replication, or because of spontaneous chemical changes that occur in particular bases. In contrast, induced mutations are the result of exposure to a chemical or physical agent. Mutations that change a wild type gene to a mutant gene are classified as forward mutations. Reverse mutations change these mutant genes again, so that wild type function is restored. Wild type E. coli is able to grow on minimal media, as it can produce all 20 amino acids. In Sally's experiment, wild type E. coli cells were randomly mutated by 5-bromouracil. Therefore, each of the mutant colonies on her first set of plates contained mutations in different genes. Sally specifically selected a mutant colony that was able to grow on media supplemented with tryptophan, but not on minimal media. This colony therefore had an induced forward mutation in a gene involved in tryptophan biosynthesis. She then grew 10 cultures of this mutant in media containing tryptophan but lacking a mutagen, before plating cells from these cultures onto plates. Spontaneous reverse mutations occurred in 7 of the 10 cultures, producing cells that were once again able to grow in the absence of tryptophan. The plate that contained about 100 colonies was derived from a culture where the mutation occurred early in the culture's growth, so that the culture contained more descendants of the reverse mutant. Plates with fewer colonies were derived from cultures where the mutation occurred later in the growth period. The 0.1mL cultures that were plated on the last three plates did not contain any cells that had undergone the reverse mutation, and therefore no colonies grew on those plates.

The table contains the DNA sequence for a segment of the human insulin gene and the same DNA sequence with mutation. Original sequence: ATG GAA TAA AGC CCT TGA ACC AGC Mutated sequence: ATG GAA TAA AGG CCT TGA ACC AGC Which type of mutation occurred in the original sequence to generate the mutated sequence? substitution inversion deletion Insertion

Substitution A mutation is a permanent change in the nucleotide sequence of DNA in a cell or organism and can involve one or more nucleotides. There are several different types of mutations, including substitution, insertion, deletion, and inversion mutations. Substitution mutations occur when a nucleotide found at a particular location in a DNA sequence is changed to a different nucleotide. For example, if a nucleotide is an adenine (A) in the original sequence, a substitution mutation would be a change in that nucleotide to a thymine (T), cytosine (C), or guanine (G). Insertion mutations occur when one or more nucleotides are added to a DNA sequence, whereas deletion mutations occur when one or more nucleotides are removed from a DNA sequence. An inversion mutation occurs when a region of the DNA sequence is reversed. For example, an inversion mutation may cause a DNA sequence that is normally ATGTAC to be reversed and incorporated into the DNA as CATGTA. A mutation in which an insertion, deletion, or substitution involves a single nucleotide is referred to as a point mutation. In the human insulin example, a cytosine (C) has been replaced by a guanine (G). The position of the mutation is indicated above the original sequence with a plus sign. This type of mutation is referred to as a substitution mutation. + Original sequence: ATG GAA TAA AGC CCT TGA ACC AGC Mutated sequence: ATG GAA TAA AGG CCT TGA ACC AGC There are several reasons why mutations may occur. Inside cells, DNA replication is constantly taking place. DNA polymerase, one of the enzymes responsible for DNA replication, can repair replication errors. However, not all replication errors are recognized and as a result, insertion, deletion, or substitution mutations may be incorporated into in n

Which of these statements concerning intragenic suppressor mutations is true? The function of intragenic suppressor mutations are limited to same-gene alterations and frameshift translocations. A distinction with the intragenic suppressor mutations is the disposition of the mutations on different genes. Nonsense mutations are processes utilized in intragenic suppressor mutations to make compensatory changes in the protein. The actions of intragenic suppressor mutations can still result in the production of the same amino acid as the original, nonmutated codon.

The actions of intragenic suppressor mutations can still result in the production of the same amino acid as the original, nonmutated codon. The action of the suppressor mutation is for the reduction of expression even if the amino acid being encoded is the same with the change in nucleotides.

A genetic engineer is manufacturing RNA molecules for study. They are initially sequencing the DNA molecule shown for transcription. The resulting RNA is shown. Based on the sequences given, which of these conclusions CANNOT be made? DNA: 5'-CTATCCTCGATATTCGGCCAT-3' RNA: 5'-AUGGACGAGUAGCGCGGC-3' The length of the RNA translated, due to mutations, has decreased by 43%. The mutations present in the RNA cause a frame shift in the stop codons from position 19. The concentration of glutamine has decreased due to the mutations present. There are more missense mutations present than nonsense mutations.

The concentration of glutamine has decreased due to the mutations present. The concentration of glutamine did not change when comparing a mutation-free complement with the RNA shown.

Which of these is NOT true in the generation of flanking direct repeats? Short flanking direct repeats are generated in the process of transposition as they are not part of the transposable element. The cuts on either side leave long single-stranded pieces of DNA which, through transcription, create flanking direct repeats. Short flanking direct repeats are present on both sides of transposable elements and are of constant length. The cuts that create flanking direct repeats are typically staggered.

The cuts on either side leave long single-stranded pieces of DNA which, through transcription, create flanking direct repeats. The cuts do leave single-stranded pieces of DNA, but it is through replication that the repeats are generated.

Seth is evaluating DNA sequences for his research abroad program using electronic models. From those models, he can mark and assess changes in the sequencing during the replication and transcription phase. The original model and its mutated form are shown. Which one of these statements can Seth conclude from the models? [The illustration on the left shows a DNA sugar phosphate backbone running from 5 prime at the top to 3 prime at the bottom. The pentose sugars have bases on the C1 and phosphate molecules on the C4. The first sugar molecule at the top has pyrimidine labeled] The mutation exhibited is not a common form of an induced chemical mutation. In the base-pairing model during replication, the missing base would typically be replaced by cytosine. The mutation observed with the loss of object Y can either be guanine or adenine. The mutation observed can be classified as depyrimidination.

The mutation observed with the loss of object Y can either be guanine or adenine. The chemical change that leads to a loss of a purine molecule is termed depurination. The purines that are bases in DNA are guanine or adenine.

Mary is assessing nucleotides through a drawing algorithm. She is trying to reduce the mutations seen from an RNA complement based on its DNA template. The DNA template and the mutated RNA complement are shown. Which of these statements is INCORRECT? DNA: 5'-TCCCTCCAGTCGGGGAGACAT-3' Mutant RNA: 5'-AUUGCUCCCCGACUCGAGGAG-3' The mutations have removed the start codon (AUG) from the sequence. The number of transitions and transversions between the RNA complement and the mutant are the same. The amount of arginine (CGU, CGC, CGA, or CGG) is equal to the amount of leucine (CUU, CUC, CUA, or CUG) in both RNA strands. The concentration of adenine is the same in the RNA complement, mutant RNA, and original DNA strand.

The number of transitions and transversions between the RNA complement and the mutant are the same. There are actually three transversions versus two transitions between the two molecules.

Which of these is INCORRECT concerning germ-line mutations? The inheritance of germ-line mutations can be seen in all of the somatic and germ-line cells of offspring. The rise of a germ-line mutation is inherited in daughter cells and leads to a population of genetically identical cells. The rise of germ-line mutations is through a combination of meiosis and sexual reproduction, producing a mutation in approximately half of the offspring. The effect of germ-line mutations are typically seen in multicellular organisms.

The rise of a germ-line mutation is inherited in daughter cells and leads to a population of genetically identical cells. This is how somatic mutations are seen.

Many incorrectly inserted nucleotides that escape detection by proofreading are corrected by mismatch repair. A strain of E. coli was found to have functional mismatch repair genes, but it is unable to methylate DNA. What would you expect that the phenotype of such a strain would be? The strain would only create mutations at AT sites. The phenotype would be normal and similar to wild type. The strain would not be able to replicate its DNA, so it would be lethal. The strain would have an enhanced spontaneous mutation rate.

The strain would have an enhanced spontaneous mutation rate. The strain would not be able to distinguish the old DNA strand from the new one during DNA replication, so mismatch may sometimes "correct" a mispairing and create a permanent mutation. Alternatively, mismatch repair may not be active, and mispairing will produce mutations. In either event, an increase in mutations will result.

Which of these statements concerning intergenic suppressor mutations is FALSE? The presence of intergenic suppressor mutations can be less detrimental than the presence of nonsense mutations. There are no compensatory mechanisms relating to the restoration of original function with intergenic suppressor mutations. They can be referred to as extragenic suppressor mutations. An intergenic suppressor mutation occurs in a gene other than the one bearing the original mutation that it suppresses.

There are no compensatory mechanisms relating to the restoration of original function with intergenic suppressor mutations. There is a compensatory mechanism involving the second gene that could restore the original interaction with the first gene being suppressed.

A template strand of DNA contains the nucleotide sequence. 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5' 1. 24 Use codon table to translate the amino acid sequence for each mutation. Match the translated amino acid sequence to the appropriate mutation. All amino acid sequences are written in the amino-to-carboxyl direction. (Mutations) Transition at nucleotide 11 Transition at nucleotide 13 Deletion at nucleotide 7 Transversion of T to A at nucleotide 15 Addition of TGG after nucleotide 6 Transition at Nucleotide 9 (Amino acid sequences) MET THR GLY ASN GLN LEU TYR MET THR GLY ASN MET THR THR GLY ASN GLN LEU TYR MET THR GLY SER GLN LEU TYR MET THR GLY ASN HIS LEU TYR MET THR ALA LLE ASN TYR ILE

Transition at nucleotide 11 = MET THR GLY SER GLN LEU TYR Transition at nucleotide 13 = MET THR GLY ASN Deletion at nucleotide 7 = MET THR ALA LLE ASN TYR ILE Transversion of T to A at nucleotide 15 = MET THR GLY ASN HIS LEU TYR Addition of TGG after nucleotide 6 = MET THR THR GLY ASN GLN LEU TYR Transition at Nucleotide 9 = MET THR GLY ASN GLN LEU TYR DNA is transcribed to RNA, which is translated to an amino acid chain, or peptide, that ultimately forms a functioning protein. DNA mutations manifest as altered amino acid sequences that can cause various protein structural or functional issues. Types of DNA mutations include transitions (pyrimidine to pyrimidine or purine to purine), transversions (purine to pyrimidine or pyrimidine to purine), deletions, and insertions. The extent to which a DNA mutation affects a protein's structure or function depends on how the mutation alters the amino acid sequence. RNA sequences are translated to amino acids three nucleotides at a time, beginning with the start codon, which codes for methionine (Met). Nucleotides can be inserted or deleted in multiples of three without affecting the reading frame of the sequence. In such cases, a codon or codons will be inserted into or deleted from the sequence, but the downstream sequence will remain intact. Nucleotide insertions or deletions that do not occur in multiples of three are called frameshift mutations because they change the reading frame of all downstream nucleotide sequences. Some transitions and transversions result in identical peptides because redundant codon sequences encode the same amino acid. Alternatively, a single nucleotide substitution may change the codon such that a different amino acid is encoded.

Which of these options is the correct order detailing the process of depurination? I. A nucleotide is incorporated into the new synthesized strand opposite the apurinic site. II. DNA strands separate, creating two mutant strands of DNA. III. DNA strands separate, providing one strand with an apurinic site. IV. The base pairing of one strand leads to a permanent mutation. V. An incorrect base is incorporated into the newly synthesized strand of DNA. VI. A DNA sequence undergoes depurination. III, VI, V, II, IV, I VI, III, V, II, IV, I VI, II, V, III, IV, I VI, II, I, III, IV, V

VI, III, V, II, IV, I This sequence details the process of separation and replication and how bases are incorrectly integrated into strands of DNA.

A codon that specifies leucine undergoes a single-base substitution, producing a new codon that specifies methionine. The codons that specify leucine are UUA, UUG, CUU, CUC, CUA, and CUG. The only codon that specifies methionine is AUG. Which of these correctly describes the mutation? a transition at the first nucleotide position of one of the leucine codons a transversion at the first nucleotide position of a leucine codon a transition at the third nucleotide position of a leucine codon a transversion at the third nucleotide position of a leucine codon

a transversion at the first nucleotide position of a leucine codon A transversion at the first position can convert either UUG or CUG to AUG.

Trinucleotide repeat expansions involve all of the items except... repetitive DNA segments. triplets of base pairs. hairpins. replication. all of the items are involved.

all of the items are involved.

What is the most common result of depurination? induced chemical mutation loss of a pyrimidine base covalent bond formation between the purine and the 1' carbon atom an incorporation error leading to a replication error

an incorporation error leading to a replication error With a base lacking its pair, an incorrect nucleotide would take its place, resulting in the replication of the incorrect nucleotide. This is a form of incorporation error leading to replication errors.

In a mouse cell, a cytosine within the genome deaminates spontaneously and becomes a uracil. Which DNA repair system is most likely to detect and correct this defect before it can be fixed in the genome as a permanent mutation? base-excision repair nucleotide-excision repair mismatch repair photoreactivation

base-excision repair This repair system targets bases for correction, so base-excision repair would be the system utilized for repairing the sequence before it becomes a permanent mutation.

Which type of mutation probably has the smallest effect on the function of the protein encoded by the mutated gene? they all have no effect insertion of base pairs base-pair substituions deletions of base pairs they all have the same effect

base-pair substitutions

Retrotransposons are a type of transposable element, or transposon. These segments of DNA can duplicate and insert themselves into new locations in the genome. For example, the Alu sequence is about 300 bases long, and it is the most abundant retrotransposon in primate genomes. In fact, it makes up approximately 15% of the human genome. Choose the description that best explains how the Alu sequence can affect the size of the human genome. - can either increase or decrease the size of the human genome because transposable element insertion mutations are coupled with telomere shortening. - cannot influence the human genome because the human genome cannot blend with any of the other primate genomes. - can increase the size of the human genome because it adds 300 bases to the genome each time it is duplicated. - can decrease the size of the human genome because the element exits the human genome to transpose into t

can increase the size of the human genome because it adds 300 bases to the genome each time it is duplicated. Transposable elements, or transposons, are segments of DNA that move and insert themselves into the genome of many organisms. Because of this behavior, these elements are sometimes called jumping genes. Some kinds of transposable elements move around in the genome but do not make copies of themselves. Others, like the Alu sequence, make copies of themselves and insert themselves into new locations. Over time, sequences like Alu can make up a substantial portion of an organism's genome. Transposable elements like the Alu sequence are insertion mutations, so they always add bases into the genome, thus increasing its size. Because they alter the actual sequence of DNA in a cell, the mutations are heritable, so they can be retained from mother cell to daughter cell and from generation to generation if they occur in reproductive cells.

Which of these is not always a typical feature of transposition? creation of staggered cuts in the target DNA replication of DNA at short, single-stranded gaps on both sides of the transposable element joining of the transposable element to single-stranded ends of the target DNA creation of an RNA intermediate prior to insertion in target DNA

creation of an RNA intermediate prior to insertion in target DNA An RNA intermediate is created only during transposition of a retrotransposon.

A rare autosomal recessive disease called xeroderma pigmentosum (XP) results in a number of phenotypic traits including abnormal skin pigmentation. People with this disease also exhibit a strong predisposition to skin cancer. This can be best explained by a(n) increase in the depurination of guanines during DNA replication. increase in homologous recombination. decrease in nucleotide-excision repair activity. decrease in the deamination of cytosine during DNA replication.

decrease in nucleotide-excision repair activity. XP is a disease resulting from defects in the DNA excision repair mechanism. This is one reason XP individuals may exhibit increased skin-cancer rates.

Which type of DNA mutation results in a change in the reading frame of an mRNA?

deletion of a single nucleotide A frameshift mutation involves an insertion or deletion of one or two nucleotides somewhere in a gene. Since codons are sequences of three nucleotides, adding or deleting one or two nucleotides shifts the reading frame to a completely different series of codons following the mutation. For example, if a single letter b is added to the sentence, "The cat ate the rat," the sentence becomes "The cab tat eth era t." A protein made from a sequence with a frameshift mutation is often nonfunctional. Not all mutations cause such drastic changes to the resulting protein sequence. Substituting one codon or nucleotide for another can change a single amino acid in the protein, but would not impact subsequent amino acids. Adding or deleting a single codon adds or deletes a single amino acid and does not change the rest of the amino acid sequence in the protein. These mutations may or may not impact the function of the protein, depending on where in the protein the changed amino acid is located.

Long stretches of which amino acid is known to be highly toxic to cells? alanine guanine glycine tyrosine glutamine

glutamine

A geneticist wants to isolate mutants in mice that are defective in nucleotide-excision repair (NER) but is unable to do biochemical analysis on the NER system and so must use some other method to identify putative NER mutations. Which of these would most likely be useful in identifying NER mutations in mice? identifying possible NER mutants by their increased susceptibility to UV irradiation compared to normal mice identifying possible NER mutants by their high spontaneous mutation rates for base-pair substitution and frameshift mutations compared to normal mice identifying possible NER mutants by their progeny consisting of a reduced number of females with a normal number of males when they are crossed to normal mice identifying possible NER mutants by their high rate of cytosine deamination compared to normal mice

identifying possible NER mutants by their increased susceptibility to UV irradiation compared to normal mice NER is the major repair system that corrects helix distorting DNA lesions such as pyrimidine dimers.

After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the 10th position within the coding region of a gene. This mutation led to a change of proline into serine at the fourth position in the resulting peptide. Original / Mutant DNA: ATG-CGT-ACT-CCT-TAA / ATG-CGT-ACT-TCT-TAA mRNA: AUG-CGU-ACU-CCU-UAA / AUG-CGU-ACU-UCU-UAA Peptide: Met-Arg-Thr-Pro-STOP / Met-Arg-Thr-Ser-STOP Using this information and the sequences listed, select all the types of mutations that occurred. -transversion -induced -spontaneous -missense -transition -silent -point

induced, missense, transition, and point A DNA mutation is a permanent change in a nucleotide sequence in the genome. Point mutations, also known as base substitutions, describe single nucleotide changes in a DNA sequence. There are two types of point mutations, transitions and transversions. Transitions occur when a purine nucleotide is changed to another purine, or when a pyrimidine is changed to another pyrimidine. Thus, in the example, the C to T in the 10th position (10C>T) mutation is a transition mutation because thymine and cytosine are both pyrimidines. Unlike transition mutations, transversions occur when a purine is changed to a pyrimidine, or a pyrimidine is changed to a purine. A point mutation in a protein‑coding DNA sequence results in a change in the mRNA sequence transcribed from that particular gene. A change in the mRNA codon sequence can then result in a change in the sequence of the protein or peptide which is translated from that particular mRNA. Missense mutations occur when a mutation changes the amino acid that a particular codon specifies. In the example, the 10C>T DNA mutation changes the fourth mRNA codon from CCU to UCU. At the peptide level, this mutation led to the replacement of the proline residue with a serine residue in the 4th position (P4S or Pro4Ser). Whereas missense mutations result in changes in the peptide sequence, nonsense mutations are point mutations that results in a premature stop codon replacing the original amino acid. Induced mutations occur as a result of exposure to chemical mutagens or radiation. In this example, a chemical mutagen was used to induce mutations in a DNA sequence. Mutations can also occur spontaneously, which means that they arise naturally in organisms in the absence of mutagens. For example, a mutation that occurs during DNA replic

Normally, a type of flower is purple. Researchers isolated a mutant that is pink and bred a large population of pink flowers. Geneticists have shown that pink is recessive. After many generations, a purple mutant appeared within the pure-breeding pink population. The enzyme that is supposed to convert pink pigment to purple was isolated from members of the original purple population (enzyme 1), from members of the pure-breeding pink population (enzyme 2), and from the new purple mutant (enzyme 3). The amino acid sequence of a portion of each enzyme is shown: Enzyme 1: ...Leu-Pro-Val-Ala-Pro... Enzyme 2: ...Leu-Leu (truncated) Enzyme 3: ...Leu-Leu-Leu-Ala-Pro Which of these mechanisms would best account for the production of the normal phenotype in the purple mutant that appeared among the pink population? intergenic suppression intragenic suppression nonsense suppression reverse mutation to wild type

intragenic suppression The amino acid sequence of enzyme 2 indicates that the first mutation was a frameshift, and the sequence of enzyme 3 indicates that a second frameshift just downstream of the first one restored normal function by restoring the original reading frame.

The repair mechanism that repairs errors resulting from bases incorrectly paired with each other during DNA replication is called base-excision repair. SOS repair. nucleotide-excision repair. mismatch repair.

mismatch repair. Mismatch repair is the repair of incorrectly paired bases detected by mismatch-repair enzymes.

The Ames II test uses auxotrophic strains of bacteria to detect base pair substitutions and frameshift mutations. The test identifies a chemical as a mutagen when a bacterial strain has undergone a spontaneous reverse mutation. more his+ colonies appear on chemically treated plates than on control plates. more bacterial cells are killed by the liver extract on the chemically treated plate. a his- strain cannot synthesize histidine.

more his+ colonies appear on chemically treated plates than on control plates. More his+ colonies would increase the degree of mutagens exhibited with the chemical being tested.

Which of these always results from transposition? increase in the number of copies of a transposable element the gene for transposase being turned off after being expressed creation of mutant phenotypes movement of a transposable element within the genome or between genomes

movement of a transposable element within the genome or between genomes Transposition is the movement of a transposable element from place to place within the genome.

Insertion of additional repeats in repetitive segments of DNA often involves which change? transformation transcription translation rearrangement slippage

slippage