Ch 18-22 Quiz
Indicate the implications for nuclear structure or function of each of the following experimental observations. Ribosomal proteins are synthesized in the cytoplasm but are packaged with rRNA into ribosomal subunits in the nucleus. A) Ribosomal proteins must pass inward from the cytoplasm to the nucleus at a rate adequate to sustain ribosomal subunit assembly; ribosomal subunits must move outward from the nucleus to the cytoplasm at a rate commensurate with their rate of assembly. B) Ribosomal proteins must pass inward from the cytoplasm to the nucleus at a rate adequate to prevent proteins from dissolving; ribosomal subunits must move outward from the nucleus to the cytoplasm at a rate commensurate with their rate of dissolving. C) Ribosomal proteins must pass outward from the nucleus to the cytoplasm to the nucleus at a rate adequate to sustain ribosomal subunit assembly; ribosomal subunits must move inward from the cytoplasm to the cytoplasm at a rate commensurate with their rate of assembly.
a
Reword the following statement to make it true: The DNA of nucleoli carries the cell's tRNA genes, which are present in clusters of multiple copies. A) The DNA of nucleoli carries the cell's rRNA genes, which are present in clusters of multiple copies. B) The DNA of nucleoli carries the cell's mRNA genes, which are present in clusters of multiple copies. C) The DNA of nucleoli carries the cell's tRNA and mRNA genes, but mRNA genes are present in clusters in a very few number of copies
a
Shine-Delgarno sequences are present in mRNAs of A) prokaryotes. B) eukaryotes. C) fungi. D) algae. E) mosses.
a
The appropriate folding of a newly translated product is essential, and continual misfolding often leads to disease, especially in vertebrates. This misfolding, particularly in the situation of prion diseases, may be due to A) chaperone activity. B) rearrangements by translocase. C) insertion of inappropriate amino acids during translation. D) errors facilitated by the enzyme foldase. E) errors perpetuated during self-assembly.
a
Which of the following is true of transfer RNA? A) It is responsible for correct positioning of amino acids in a polypeptide. B) It serves as the site of protein synthesis. C) It functions in transcription, translation and replication. D) It is an important component of ribosomes. E) It functions in replication only.
a
Which of the following terms is used to indicate the entire set of RNA molecules that can be made by a cell? A) transcriptomes B) genomes C) proteomes D) desmosomes E) total RNA
a
You are using genetic engineering to design a protein that needs to be synthesized in the cytoplasm and then localized in the nucleus of the cell. To accomplish this, one could add A) a nuclear localization signal into the DNA that will be present in the mature protein. B) the compound during mitosis, at a time when the nuclear membrane is dispersed. C) a nucleotide or few nucleotides to the protein. D) a series of specific polysaccharides to the carboxyterminal end of the protein. E) all of the above
a
A change in a single nucleotide that results in no change in the amino acid sequence of the polypeptide produced is known as a A) frameshift mutation. B) silent mutation. C) missense mutation. D) nonsense mutation. E) none of the above
b
An agent that would work well as an antibiotic against prokaryotic infection would target the A) mitochondria. B) 50S large ribosomal subunit. C) 40S small ribosomal subunit. D) RNA polymerase II. E) DNA polymerase.
b
Eukaryotic-like (possessing a defined nucleus) cells were obtained from a Martian soil sample. The nucleus was carefully isolated and the chromatin obtained. The fibers had a "beads on a string" appearance, suggesting some type of "histones." Following digestion with micrococcal nuclease, protein removal, and gel electrophoresis, DNA fragments were obtained that are multiples of 280 base pairs in length. Longer incubation with micrococcal nuclease prior to protein removal results in fragments 200 base pairs in length. The amount of DNA that is wrapped around the "core histones" is therefore A) 80 base pairs in length. B) 200 base pairs in length. C) 360 base pairs in length. D) 480 base pairs in length. E) Not enough information is given to determine the answer.
b
If you were designing a method to specifically inhibit prokaryotic transcription, but not eukaryotic transcription, interfering with which of the following would work best? A) DNase activity B) recognition of the promoter region C) an intercalating agent D) ribosomal binding E) RNA polymerase II activity
b
In the following gene sequence, the original sequence is ABC* DEFGH. It now reads ABC* DGFEH. The * indicates the centromere. This type of mutation is a(n) A) nonsense mutation. B) inversion. C) translocation. D) duplication. E) point mutation.
b
Indicate the implications for nuclear structure or function of each of the following experimental observations. If gold particles up to 26 nm in diameter are coated with a polypeptide containing a nuclear localization signal (NLS) and are then injected into the cytoplasm of a living cell, they are transported into the nucleus. If they are injected into the nucleus, however, they remain there. A) The NLS only triggers transport from cytoplasm to nucleus, not from nucleus to cytoplasm, suggesting that gold particles have a large charge that prevents their moving away from nucleus. B) The NLS only triggers transport from cytoplasm to nucleus, not from nucleus to cytoplasm, suggesting that NLS receptor proteins (importins) function only in the cytoplasm. C) The NLS only triggers transport from cytoplasm to nucleus, not from nucleus to cytoplasm, suggesting that NLS receptor proteins (importins) are attached to the outer side of the nucleus. D) The NLS only triggers transport from nucleus to cytoplasm, not from cytoplasm to nucleus, suggesting that NLS receptor proteins (importins) function only in the nucleus.
b
Indicate the implications for nuclear structure or function of each of the following experimental observations. Many of the proteins of the nuclear envelope appear from electrophoretic analysis to be the same as those found in the endoplasmic reticulum. A) The proteins in the nuclear envelope that are probably caught in transit are the same as those found in the endoplasmic reticulum.. B) The nuclear membranes and the endoplasmic reticulum are likely to have a common origin. C) The nuclear membranes are changed during electrophoretic analysis so that they become similar to those of the endoplasmic reticulum.
b
Indicate the implications for nuclear structure or function of each of the following experimental observations. Sucrose crosses the nuclear envelope so rapidly that its rate of movement cannot be accurately measured. A) The nuclear envelope has pores that are designed to transport sucrose molecules so that they can cross it without any resistance. B) Unlike most membranes, the nuclear envelope appears to be freely permeable to a polar organic molecule. C) Sucrose can dissolve the nuclear envelope because of its polarity. After sucrose molecules have passed, nuclear envelope goes back to its initial state. D) There is a small concentration difference between two sides of the nuclear envelope that forces sucrose to move very fast.
b
Indicate the implications for nuclear structure or function of each of the following experimental observations. Treatment of nuclei with the nonionic detergent Triton X-100 dissolves the nuclear envelope but leaves an otherwise intact nucleus. A) The nucleus seems to produce a new insoluble envelope following the dissolution of the previous one. B) The integrity of the nucleus does not seem to depend entirely on the envelope. C) While dissolving the nuclear envelope, Triton X-100 produces a new envelope that protects the nucleus.
b
Polycistronic mRNAs encode A) one product that it alternatively spliced. B) more than one protein. C) a single message. D) exclusively archaeal proteins. E) none of the above
b
Ribosomes that do not anchor on the surface of the rough endoplasmic reticulum during translation MOST probably A) have a defect in ribosomal proteins that allow attachment to the surface. B) are synthesizing cytoplasmic proteins. C) do not make the appropriate anchor protein. D) have a signal peptidase error. E) all of the above
b
The higher the gene density in a particular unit of DNA, A) the more likely it will exist as heterochromatin. B) the more likely it will exist as euchromatin. C) the lower the number of genes are likely to be in that unit of DNA. D) the more likely it will be replicated late during replication. E) the less likely it is currently unwound
b
Which of the following statements about functional nuclear domains is correct? Choose all that apply. A) There is a single functional domain where all nuclear activity occurs. B) They provide localized regions of function. C) They are sites of low activity. D) They are highly discrete and organized. E) They refer to protein domains encoded by genomic DNA.
bd
Indicate the implications for nuclear structure or function of each of the following experimental observations. If nucleoli are irradiated with a microbeam of ultraviolet light, synthesis of ribosomal RNA is inhibited. A) Ultraviolet light probably accelerates processes that prevent rRNA synthesis. B) Ultraviolet light destroys all RNA molecules. C) Nucleoli are probably responsible for rRNA synthesis.
c
Indicate the implications for nuclear structure or function of each of the following experimental observations. Nuclear pore complexes sometimes stain heavily for RNA and protein. A) The stained pores contain complexes of RNA and protein, probably ribonucleo-protein particles attached to the membrane by hydrogen bonds. B) The stained pores contain complexes of RNA and protein, probably ribonucleo-protein particles that are part of the nuclear pore complex. C) The stained pores contain complexes of RNA and protein, probably ribonucleo-protein particles caught in transit.
c
Messenger RNAs that contain no stop codons due to a frameshift mutation are eliminated by A) nonstop decay. B) directed RNase activity. C) nonsense-mediated decay. D) error-mediated repair. E) none of the above
c
Of the following codons, which encodes a normal translational stop? A) UUU B) AUG C) UAG D) AAA E) AGG
c
Reword the following statement to make it true: A single nucleolus always corresponds to a single nucleolus organizer region (NOR). A) A single nucleolus always corresponds to two NORs. B) A nucleolus does not contain any NORs. C) A single nucleolus may contain a number of NORs.
c
The mitochondrial DNA can be used to identify a species based upon A) NADH dehydrogenase sequences. B) variation in the mitochondrial ribosomes. C) 648 bp DNA bar code region. D) leucine codon usage. E) none of the above
c
The nucleolus A) is surrounded by a thin nucleolar membrane. B) is found, one per cell, in eukaryotes. C) contains the NOR of rRNA genes. D) synthesizes ribosomal proteins. E) all of the above
c
The process by which cytosolic polypeptides are transported to a target organelle is via which of the following? A) transportin mechanisms B) cotranslational import C) posttranslational import D) the activity of ribosomes E) the importin protein
c
When one portion of a chromosome becomes physically part of another chromosome, the type of mutation is referred to as a(n) A) nonsense mutation. B) inversion. C) translocation. D) duplication. E) nonstop mutation.
c
Which of the following 13 base DNA probes would best be able to detect the following segment of a gene of interest during FISH? (Note: Real probes need to be longer to reduce the likelihood of this sequence being present somewhere else in the genome, but these sequences will suffice for this question.) 5'~AGTCCTAGCTGCAATATAGCGATAGCTGCATTGCAGCTAA~3' A) 5' GCTAAGATCATAA 3' B) 5' CACACATGCTATT 3' C) 5' AATGCAGCTATCG 3' D) 5' TAAATGCTAGCAT 3' E) 3' GTACCTGCATAAG 5'
c
Which of the following activities is NOT associated with post-translational processing? A) addition of lipid groups B) specific cleavage of polypeptides C) polyadenylation D) glycosylation E) chaperonin activity
c
intramolecular protein splicing results in the formation of the final protein and the A) protease. B) proteosome. C) inteins. D) all of the above E) none of the above
c
All of the following are associated with a protein-folding disease except A) prions. B) tau protein. C) amyloid plaques. D) E-cadherin. E) apoplipoprotein E.
d
In eukaryotic cells, we sometimes find reverse transcriptase activity, even though the cells are not infected with virus. This activity can be attributed to A) infection with small bacteria known as mycoplasmas. B) the presence of viroids. C) the presence of transposons integrating into polymerase genes. D) the presence of retrotransposons. E) a novel viral infection.
d
Indicate the implications for nuclear structure or function of each of the following experimental observations. Colloidal gold particles with a diameter of 5.5 nm equilibrate rapidly between the nucleus and cytoplasm when injected into an amoeba, but gold particles with a diameter of 15 nm do not. A) Large gold particles are very slow and unwieldy, preventing them from passing through polar membranes B) The aqueous channels in nuclear pore complexes have diameters of about 15-20 nm, but only particles with a diameter of one third could pass through them. C) Large gold particles have a larger charge which prevents them from passing through polar membrane. D) The aqueous channels in nuclear pore complexes have diameters of at least 5.5 nm, but not as great as 15 nm.
d
Numerous Xenopus cells were exposed to various amounts of ultraviolet light. Some of the resulting cells were observed to lack nucleoli. As a result, one would expect that the cell could not A) perform cellular respiration. B) replicate its DNA. C) perform photosynthesis. D) synthesize rRNA. E) none of the above
d
One reason that prokaryotic genes do not contain introns is that A) bacterial proteins are very short and not subject to mutation. B) integrated viral DNA is not recognized for transcription. C) due to the short time the bacterium is around as a single organism, a 5' cap and poly A tail are added immediately for translation to take place. D) as prokaryotes do not have a nucleus, translation sometimes begins before transcription has been completed. E) the introns are cut out during binary fission.
d
Reword the following statement to make it true: Nucleoli are membrane-bounded structures present in the eukaryotic nucleus. A) Nucleoli are two lipid bilayers that surround nucleus in eukaryotic cells. B) Nucleoli are large protein complexes that cross the nuclear envelope in eukaryotic cells. C) Nucleoli are thin, dense meshworks of fibers lining the inner surfaces of the inner nuclear membranes of most eukaryotic cells. D) Nucleoli are structures made of DNA, RNA, and protein that are present in the eukaryotic nucleus.
d
Segments of polypeptides that are retained following protein splicing are called A) introns. B) exons. C) inteins. D) exteins. E) cleaved.
d
Which of the following nucleotides in the anticodon can allow for "wobble" in translation? A) uracil B) thymine C) guanine D) inosine E) carboxycytosine
d
Which of the following organelles does not receive proteins synthesized on cytoplasmic ribosomes by posttranslational import? A) mitochondria B) chloroplast C) peroxisomes D) lysosome E) nucleus
d
Which one of the following is least likely to cause mutations in DNA? A) aflatoxins that are found in moldy grains B) hydroxyl radicals formed as by-products of aerobic respiration C) ultraviolet radiation from sunlight D) light from an incandescent bulb
d
A reduction in surface area relative to the volume of a cell limits its size, but some cells have modifications that allow them to be somewhat larger. Which of the following is NOT one of the modifications that a cell may exhibit in order to overcome a reduction in surface area? A) folding of the membrane B) organelles C) compartmentalization of activities D) cytoplasmic streaming E) production of the cell wall
e
All of the following are associated with a protein-folding disease except A) prions. B) apoplipoprotein E. C) tau protein. D) amyloid plaques. E) E-cadherin.
e
All of the following structures are found within the nucleus of a eukaryotic cell except A) Cajal bodies B) speckles C) nucleolus D) promyeloctic leukemia (PML) bodies E) All of the above are found in the nucleus
e
If more than one codon specifies the same amino acid, the code is said to be A) complementary. B) inverse. C) redundant. D) ambiguous. E) degenerate.
e
Peptide bond formation is catalyzed by an RNA molecule in A) prokaryotes. B) eukaryotes. C) yeast only. D) cyanobacteria. E) both choices A and B
e
The mRNA is translated in the 3' to 5' direction in A) prokaryotes. B) eukaryotes. C) archaea. D) all of the above E) none of the above
e
The nuclear membrane functions as a A) means of separating nuclear and cytoplasmic constituents. B) means of localization of the chromosomes within the cell. C) selective barrier, allowing certain substances in or out. D) means of sequestering many of the mRNA processing activities from the cytosol. E) all of the above
e
Which of the following statements about mutations is incorrect? A) If a mutation occurs in a germ line cell, the resulting fertilized embryo will carry the mutation in every cell. B) Mistakes in translation are not as critical as mistakes in replication. C) If a mutation occurs in a bacterial cell, all subsequent progeny cells will carry that mutation. D) Proofreading by DNA polymerases helps reduce a cell's observed frequency of mutation. E) Mistakes in transcription lead to alterations in the nucleotide sequence in the DNA.
e
Which one of the following statements about the nucleus is correct? A) The inner membrane of the nuclear envelope is continuous with the endoplasmic reticulum. B) In higher eukaryotes such as animals, the nucleus is more accurately referred to as the nucleolus. C) The nuclear lamina is typically located in the central region of the nucleus. D) The intermembrane space is between the inner and outer membranes of the nuclear envelope. E) The aqueous environment inside the nucleus is referred to as the nucleoplasm.
e
With which organelle membrane would you expect to find the receptor protein importin? A) mitochondrion B) nucleolus C) chloroplast D) plastid E) nucleus
e
You conduct an experiment by incorporating purple fluorescent dNTPs early in S phase, followed by gold fluorescent dNTPs late in S phase. At the conclusion of S-phase, you examine the nucleus of the cell using a fluorescent microscope and see that the only incorporated fluorescence is purple. Which one of the following represents the most likely interpretation of your results? A)Most DNA replication is initiated late during S-phase. B) Most DNA replication is not initiated early during S-phase. C) DNA that is located at the periphery of the cell is replicated late in S phase. D) DNA synthesis initiates late during S-phase but not early during S-phase. E) DNA synthesis initiates early during S-phase but not late during S-phase.
e
Which of the following statements about mutations is/are incorrect? Choose all that apply. A) Germ-line mutations can be passed down to offspring. B) Mutations arise from sources other than just mistakes made during DNA replication. C) Mutations in RNA during transcription are not inherited by daughter cells over multiple generations. D) Mistakes in transcription are not as critical as mistakes in replication. E) DNA replication machinery generates errors at a lower rate than RNA transcription machinery. F) Mistakes in DNA replication do not lead to heritable mutations. G) Somatic mutations are often passed down to offspring.
fg
The sequence of amino acids that serves as a targeting signal for a protein to be transported from the nucleus to the cytoplasm is most accurately referred to as a:
nuclear export signal.
