Ch. 24 Reading Quiz

Suppose the size of a population of whales is 2400. According to genetic drift theory, what is the probability that a newly-arisen neutral mutation will become fixed in this population? -1/2400 -1/6000 -1/4800 -1/2 -1/1200

1/4800

Refer to Figure 24.2 in your textbook. If the ancestral sequence was not available for comparison, the number of nucleotide substitutions inferred from pairwise comparison of Sequence 1 and Sequence 2 would be ___, which is ________ the actual number of changes. -3; an underestimate of -2; an underestimate of -4; equal to -5; equal to -3; equal to

3; an underestimate of

The globin gene family is an example of -gene duplication leading to divergence of function. -lateral gene transfer. -in vitro evolution. -concerted evolution by unequal crossing over. -concerted evolution by biased gene conversion.

gene duplication leading to divergence of function.

The nucleotide at a position in a DNA sequence changes from C to A to T. This is an example of a _______ substitution. -back -multiple -parallel -coincident -single

multiple

Genes found in different species that diverge as a result of speciation are called _______, whereas genes in the same or different organisms that arise by gene duplication are called _______. -paralogs; orthologs -orthologs; homologs -homologs; paralogs -paralogs; homologs -orthologs; paralogs

orthologs; paralogs

Consider the great diversity of genome size among organisms. As genome size increases, the relative proportion of noncoding DNA -steadily decreases. -steadily increases. -is relatively stable. -increases for awhile, and then decreases. -decreases for awhile, and then increases.

steadily increases.

In a phylogenetic tree of primates, a gene involved in the production of brain peptides shows 25 silent substitutions but only four missense substitutions. From these results, we can infer that -the evolution of the gene is affected only by mutation and genetic drift. -strong positive selection has been operating on the gene. -the gene is following a molecular clock. -the gene is a pseudogene. -strong purifying selection has been operating on the gene.

strong purifying selection has been operating on the gene.

Comparisons of the genes that code for lysozyme and the amino acid sequence of the enzyme from a number of organisms revealed that -the amino acid changes in lysozyme uniquely shared by animals with foregut fermentation are due to convergent evolution. -a common recent ancestor is necessary for organisms to develop very similar adaptations. -the rate of nonsynonymous mutations is higher than that of synonymous mutations in most lineages. -bovine (cattle) lysozyme is very similar overall to langur lysozyme. -all of the changes in lysozyme are neutral and occured at a constant rate in different lineages.

the amino acid changes in lysozyme uniquely shared by animals with foregut fermentation are due to convergent evolution.

Which of the following nucleotide substitutions in a codon in an mRNA strand that codes for a protein would likely have the greatest effect on the activity of the protein? -GGA to GAA -GGA to GCU -GGA to GGG -GGU to GGG -GGU to GGC

GGA to GAA

Sequences from parts of a homologous gene from three species of dragonflies are presented below. Dragonfly 1: AGTCAGTAGATAGTTCGATAGCCA Dragonfly 2: AGTCTGTAGATAGTTCGATAGCCA Dragonfly 3: AGTCAGTAGATAGCGATCAGCCA Which of the following statements is False regarding the three sequences? -The sequence alignments shown reveal the minimum number of nucleotide changes between the gene sequences of the three dragonfly species. -Gaps have to be inserted at two places to align the three sequences. -Based on the gene sequences compared, Dragonfly 2 and Dragonfly 3 are less closely related than Dragonfly 1 and Dragonfly 2. -The gene sequences of Dragonfly 1 and Dragonfly 2 have the greatest similarity. -The gene sequences of Dragonfly 1 and Dragonfly 3 have the greatest % difference.

The gene sequences of Dragonfly 1 and Dragonfly 3 have the greatest % difference.

Which of the following, about synonymous, mutations is true? -They change the amino acid composition of the protein. -They can occur because of the redundancy of the genetic code. -They usually evolve more slowly than nonsynonymous substitutions. -They will likely be lethal. -They will affect the structure of the protein.

They can occur because of the redundancy of the genetic code.