Ch. 7 Study Guide

29) Answer the following questions about bacterial replication. h. The ___________________ strand is made toward the replication fork, while the ___________________ strand is made away from the replication fork.

1. Leading= Toward 2. Lagging=Away

27) The __________________ of a transfer RNA molecule is complementary to a codon in a messenger RNA molecule.

Anticodon (#27)

6) An enzyme that covalently bonds nucleotide fragments in DNA is A) RNA polymerase B) DNA ligase C) DNA polymerase D) Transposase E) Gyrase

B) DNA ligase

31) Answer the following questions about bacterial translation e. What is tRNA used for?

Each tRNA brings the appropriate amino acid for a particular codon.

20) True or False? All tRNA molecules have the same nucleotide sequence.

False All tRNA molecules have DIFFERENT nucleotide sequences coding for different amino acids.

21) True or False? The enzyme-dependent method of transcription termination involves the mRNA forming a stem-loop structure.

False The self-terminator method of transcription termination involves mRNA forming a stem-loop structure.

29) Answer the following questions about bacterial replication. i. What is ligase for?

Ligase is used to add a phosphodiester bond between Okazaki fragments.

31) Answer the following questions about bacterial translation. b. Where does this attachment happen? (Name the sequence on the nucleic acid where the ribosome can attach.)

Ribosome Binding Site

29) Answer the following questions about bacterial replication. g. Below is a template strand of DNA. Add the newly replicated strand, draw an arrow representing the direction in which it was made, and mark the 5' and 3' ends. 5ʹ- AAATGCTGCACACTGCA - 3ʹ

3' TTTACGAGCTGTGACGT 5' from the 5' end to the 3' end

33) The bar below represents a piece of DNA containing the lac operon. B. When lactose is present, transcription of the genes that encode enzymes for lactose catabolism __________ (can or cannot?) occur. Why?

33) B. CAN; Lactose binds to the Lac Repressor, preventing it from binding to the operator. If the repressor is not bound to the operator, transcription is NOT blocked.

33) The bar below represents a piece of DNA containing the lac operon. A. On the bar above, label the following elements: Promoter, Operator, gene that encodes the Lac Repressor, and the set of genes that encode enzymes involved in lactose catabolism (Hint: Each shaded box represents an element.)

33) A. 1. Lac Repressor-------- 2. Promoter-- 3. Operator--- 4. Genes that code for enzymes used in lactose catabolism

30) Answer the following questions about bacterial transcription. d. Below is a template strand of DNA. Add the product of transcription, draw an arrow representing the direction in which it was made, and mark the 5' and 3' ends. 3ʹ - CCATACGGGGCTTATAATATT - 5ʹ

5'-GGUAUGCCCCGAAUAUUAUAA-3' from 5' to 3' end

7) DNA is constructed of A) Two strands of nucleotides running antiparallel. B) A single strand of nucleotides with internal hydrogen bonding. C) Two strands of identical nucleotides with hydrogen bonds between them. D) Nucleotides bonded A to C and G to T. E) None of the above.

A) Two strands of nucleotides running antiparallel.

10) The nucleoid A) contains the bacterial chromosome. B) is surrounded by a membrane. C) contains only RNA molecules. D) Both A and B are correct. E) A, B, and C are correct.

A) contains the bacterial chromosome.

13) Which of the following is the strongest base pair? A) guanine-cytosine B) adenine-thymine C) adenine-uracil D) B and C E) A and B

A) guanine-cytosine

14) Which of the following must be removed from an mRNA molecule before it can be translated in eukaryotes? A) intron B) codon C) anticodon D) exon E) promoter

A) intron

16) Which of the following causes mutations by creating thymine dimers? A) ultraviolet light B) ionizing radiation C) gamma rays D) benzopyrene E) nucleotide analogs

A) ultraviolet light

31) Answer the following questions about bacterial translation f. Once translation is underway, what site of the ribosome (A, P, or E) does a new tRNA bind to? (Hint: I'm not asking about the first tRNA during initiation.)

A-site

34) Conjugation can occur by donor cells that carry the F-factor on a plasmid or by donor cells that carry the F-factor on their chromosome. A. Define "F-factor".

A. F-factor is the gene (or set of genes) used by the bacterium to make a sex pilus.

2) Which of the following statements is false? A) DNA polymerase joins nucleotides in one direction only. B) DNA replication proceeds in one direction around the bacterial chromosome. C) The leading strand of DNA is made continuously. D) Multiple replication forks are possible on a bacterial chromosome. E) The lagging strand of DNA is started by an RNA primer.

B) DNA replication proceeds in one direction around the bacterial chromosome.

9) Which of the following is found at the 5ʹ end of a DNA strand? A) histones B) a phosphate group C) a hydrogen D) a hydroxyl group E) a methyl group

B) a phosphate group

1) Which of the following pairs is mismatched? A) DNA polymerase - makes a molecule of DNA from a DNA template B) DNA ligase - joins segments of DNA C) RNA polymerase - makes a molecule of RNA from an RNA template D) DNA gyrase - reduces DNA supercoiling E) Helicase - breaks hydrogen bonds between bases

C) RNA polymerase - makes a molecule of RNA from an RNA template (MISMATCHED) Primase actually makes a small molecule of RNA from an RNA template

5) If you knew the sequence of nucleotides within a gene, which one of the following could you determine with the most accuracy? A) The secondary structure of the protein B) The quaternary structure of the protein C) The primary structure of the protein D) The tertiary structure of the protein E) Can't tell

C) The primary structure of the protein

15) Semiconservative DNA replication means that A) the sequence of a DNA molecule is preserved as it is being replicated. B) nucleotides are constantly being recycled as cells make DNA. C) each daughter DNA molecule is composed of one original strand and one new strand. D) each strand of a double-stranded DNA molecule is replicated differently. E) the cell can proofread its newly synthesized DNA part of the time.

C) each daughter DNA molecule is composed of one original strand and one new strand.

19) All of the following are associated with the phenotype of an organism EXCEPT: A) cellular structures. B) morphology. C) gene sequences. D) ability to move. E) metabolic pathways.

C) gene sequences.

8) In transcription, A) Proteins are made. B) DNA is changed to RNA. C) DNA is replicated. D) DNA is copied to RNA. E) RNA is copied to DNA.

D) DNA is copied to RNA.

18) Okazaki fragments are produced during A) DNA repair. B) transcription. C) translation. D) DNA replication. E) transduction.

D) DNA replication.

17) Frederick Griffith discovered A) transposons. B) DNA. C) the lac operon. D) transformation. E) conjugation.

D) transformation.

29) Answer the following questions about bacterial replication. b. The double-stranded DNA is separated into two template strands. Name the two enzymes that are involved in this process.

DNA Helicase unzips DNA molecule DNA Gyrase uncoils

29) Answer the following questions about bacterial replication. f. What is the name of the enzyme that is used to build the new DNA strand (be very specific)?

DNA Polymerase III

29) Answer the following questions about bacterial replication. e. Why is the primer necessary for replication to occur?

DNA polymerase would NOT be able to attach to the template. It can only bind to a double-stranded nucleic acid.

11) Plasmids can be found in which of the following organisms? A) bacteria B) protozoa C) fungi D) Both A and B E) A, B, and C

E) A, B, and C Plasmids can be found in bacteria, protozoa, and fungi, although most common in bacteria.

12) Which of the following is involved in translation? A) tRNA B) mRNA C) rRNA D) Both A and C E) A, B, and C

E) A, B, and C tRNA, mRNA, and rRNA are all involved in translation.

3) Which of the following are true about bacteriocins? A) The genes coding for them are on plasmids. B) They are used by one group of bacteria to kill off another group of bacteria. C) Bacteria that produce bacteriocins are resistant to their own bacteriocins. D) A and C only. E) A, B, and C.

E) A, B, and C. -The genes coding for them are on plasmids. -They are used by one group of bacteria to kill off another group of bacteria. -Bacteria that produce bacteriocins are resistant to their own bacteriocins.

4) Genetic change in bacteria can be brought about by A) Transformation B) Transduction C) Conjugation D) Mutation E) All of these

E) All of these Transformation, transduction, conjugation, and mutation

23) True or False? Bidirectional replication means that each strand of a DNA molecule is replicated in the opposite direction from the other.

False Bidirectional replications mean, In bacteria, both strands are copied at the same time. Two replication forks moving in opposite directions

26) A(n) ___________________ is a specific sequence of nucleotides that codes for a protein or an RNA molecule.

Gene (#26)

28) The ______________________ is the set of genes in the genome of an organism.

Genotype

34) Conjugation can occur by donor cells that carry the F-factor on a plasmid or by donor cells that carry the F-factor on their chromosome. B. Cells that have F-factor on their chromosome are called___________________ cells. (Write out the full name, not just the abbreviation.)

Hfr high frequency of recombination cells

34) Conjugation can occur by donor cells that carry the F-factor on a plasmid or by donor cells that carry the F-factor on their chromosome. C. In terms of changes to the recipient cell, describe how the different types of donor cells effect conjugation.

If the donor has F-factor on a plasmid, the entire plasmid is transferred and the recipient cell become F+. If the donor is an Hfr cell, usually only a portion of the chromosome (because it is so huge) is transferred. Most of the time, the recipient does not receive F-factor and therefore remains F-.

32) Each of the following (a. — c.) is a type of substitution mutation. Name the type. Original mRNA: UUUUAUGCACGU Original protein: Phe — Tyr — Ala — Arg C. mRNA: UUUUAUGGACGU protein: Phe — Tyr — Gly — Arg Type of mutation: ___________________

Missense Mutation

32) Each of the following (a. — c.) is a type of substitution mutation. Name the type. Original mRNA: UUUUAUGCACGU Original protein: Phe — Tyr — Ala — Arg B. mRNA: UUUUAAGCACGU protein: Phe — STOP Type of mutation: ___________________

Nonsense Mutation

29) Answer the following questions about bacterial replication. a. Where did replication start? (What's the name of the location on the chromosome?)

Origin of replication

29) Answer the following questions about bacterial replication. d. What is the name of the enzyme that makes the primer?

Primase

30) Answer the following questions about bacterial transcription. a. Where did bacterial transcription begin? (What is the name of the sequence of DNA where transcription can start?)

Promoter

30) Answer the following questions about bacterial transcription. b. What is the name of the enzyme that is used for Transcription?

RNA Polymerase

29) Answer the following questions about bacterial replication. c. How does the bacterial cell prevent the two strands from coming back together?

SSBP (single strand binding proteins) keep the strands separated

30) Answer the following questions about bacterial transcription. c. The enzyme named in ʺbʺ has two main parts. What are they? What do they do?

Sigma Subunit: finds the promoter and binds to it; Core Subunit: binds to sigma that is stuck onto a promoter and performs transcription (makes phosphodiester bonds between RNA nucleotides)

32) Each of the following (a. — c.) is a type of substitution mutation. Name the type. Original mRNA: UUUUAUGCACGU Original protein: Phe — Tyr — Ala — Arg A. mRNA: UUCUAUGCACGU protein: Phe — Tyr — Ala — Arg Type of mutation: ___________________

Silent Mutation

30) Answer the following questions about bacterial transcription. e. A sequence on the DNA known as the _____________ will end transcription.

Terminator

31) Answer the following questions about bacterial translation. c. Describe how the ribosome can attach.

The 16S rRNA of the small subunit of the ribosome has a sequence that is complementary to the ribosome binding site of the mRNA. Thus, the nucleotides of the 16S rRNA will hydrogen bond to the ribosome binding site, sticking the ribosome and mRNA together.

31) Answer the following questions about bacterial translation g. What is the catalyst for the reaction that forms the peptide bond between amino acids?

The 23S rRNA of the large subunit acts as a ribozyme (an RNA enzyme) to catalyze this reaction.

31) Answer the following questions about bacterial translation d. Once the ribosome is attached, where does translation begin?

Translation begins at the start codon.

31) Answer the following questions about bacterial translation i. How does translation end?

Translation ends by release factors bind to the stop codon and all parts separate.

24) True or False? In generalized transduction, viruses carry random DNA sequences from one cell to another.

True In generalized transduction, viruses carry RANDOM DNA sequences from one cell to another

True or False? Positive selection methods work by eliminating cells with wild-type phenotypes, leaving only mutants.

True Positive selection methods work by eliminating cells with wild-type phenotypes, leaving only mutants whereas negative selection find the mutant indirectly.

22) True or False? The structure of DNA explains both its ability to encode genetic information and the way in which it is copied during cell reproduction.

True The structure of DNA explains BOTH its ability to encode genetic information and the way in which it is copied during cell reproduction.

31) Answer the following questions about bacterial translation h. Using the genetic code (see textbook or notes), translate the mRNA you transcribed in Question 30.

fMET - Pro - Arg - Ile - Leu Ignore GGU because AUG is the start codon and ignore UAA because it is stop codon

31) Answer the following questions about bacterial translation. a. Before translation can occur, the ribosome must first attach itself to the ______________ (name the type of nucleic acid - be specific).

mRNA messenger RNA