Chapter 14 BIO PLQ
Which of the following is most likely to occur when a tumor-suppressor gene is mutated? Multiple Choice The tumor-suppressor gene may be overactive. The resulting tumor-suppressor protein would further suppress cell proliferation. The resulting tumor-suppressor protein would activate an oncogene. The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. None of the choices are possible.
The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation.
Which of the following events must occur to cause a chromosomal translocation, such as that seen in individuals with chronic myelogenous leukemia (CML)? Multiple Choice A mutation in the DNA must occur. The broken ends must pair correctly. Two different chromosomes must break. One chromosome must break in two distinct locations. A transposon must be present in one of the chromosomes.
Two different chromosomes must break
An actively dividing cell is missing an entire chromosome. How might this lead to cancer? Multiple Choice The proto-oncogene ras will lose its ability to hydrolyze GTP to form GDP. It will continue to promote cell division and lead to cancer. Various proto-oncogenes may have been deleted from the genome, so cells will not divide when they should. The deleted chromosome will signal certain genes, like p53, to promote apoptosis. the proto-oncogene fos may be present in multiple copies, leading to over expression and cancer. Various tumor suppressor genes may have been deleted from the genome, so cell proliferation occurs regardless of the damaged genome.
Various tumor suppressor genes may have been deleted from the genome, so cell proliferation occurs regardless of the damaged genome
_______ can convert proto-oncogenes into oncogenes. Multiple Choice Missense mutations Chromosomal translocations Retroviral insertions Gene amplifications All of these choices are correct
All of these choices are correct
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp Multiple Choice substitution - nonsense base addition-frameshift base addition - missense base addition - silent substitution - missense
Base-addition frameshift
Should a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. Multiple Choice cis-acting elements Ras's checkpoint proteins trans-acting elements growth factors
Checkpoint protein
A gene created from the fusion of two gene fragments is considered a Multiple Choice structural gene. proto-oncogene. chimeric gene. tumor-suppressor gene. regulatory gene.
Chimeric gene
Which of the following results in a spontaneous mutation? Multiple Choice exposure to ultraviolet light and benzo (a)-pyrene exposure to benzo (a)-pyrene, a chemical substance found in cigarette smoke exposure to X-rays exposure to ultraviolet light free radicals produced by cellular metabolism
Free radicals produced by cellular metabolism
When cancer cells have the ability to migrate to other parts of the body, they are said to be Multiple Choice oncogenic. genetic. metastatic. invasive. benign.
Metastatic
Assume each of the following letters represents an amino acid. What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDBATPAW Multiple Choice nonsense frameshift silent missense sense
Missense
Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the b-globin gene? Multiple Choice nonsense frameshift sense missense silent
Missense
Which of the following statements about cancer is FALSE? Multiple Choice It is caused by an accumulation of mutations. At least 80% of all human cancers are related to exposure to carcinogens. Most cancers involve genetic changes that are passed from parent to offspring. Over 1 million Americans are diagnosed with cancer each year. It is characterized by uncontrolled cell division.
Most cancers involve genetic changes that are passed from parent to offspring.
A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? Multiple Choice frameshift mutation sense mutation missense mutation silent mutation nonsense mutation
Nonsense Mutation
A mutation in a gene in the fruit fly Drosophila was found to affect eye color. The protein affected was found to be completely normal in its molecular weight and amino acid sequence, although much less of the protein is made in mutant flies. A reasonable explanation for the change in levels of protein is that the mutation Multiple Choice causes the stop codon to be replaced by a sense codon. is a frame shift mutation near the start of the coding region. affects the splicing of the mRNA. occurs in the promoter of the gene, within several hundred base pairs of the start of transcription. is a change of a codon for serine into another codon for serine.
Occurs in the promoter of the gene, within several hundred base pairs of the start of transcription.
A mutation causes a gene to become overactive, contributing to uncontrolled cell growth. Which term best describes this gene? Multiple Choice tumor-suppressor gene alternatively spliced gene spliced gene malignant gene oncogene
Oncogene
MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and an increased rate of cell division, then the mutated gene is called a(n) Multiple Choice spliceosome. transposon. tumor-suppressor gene. oncogene. None of the choices are correct.
Oncogene
Which of the following is true concerning a somatic cell mutation? Multiple Choice Only a small group of cells within the organism is affected by the mutation. All of the gametes carry the mutation. All cells within the organism are affected by the mutation. A small fraction of the gametes carry the mutation. Half of the gametes carry the mutation.
Only a small group of cells within the organism is affected by the mutation.
In the Ames test for mutagenicity, why was rat liver extract included in the control sample? Multiple Choice Rat liver extract contains enzymes that may be necessary for certain mutagens to work. Since it must be added to the experimental sample, it is also added to the control sample. Rat liver extract was being tested for its mutagenic properties Rat liver extract serves as an indicator for mutagenicity. It allows scientists to count the mutated colonies in each sample. Rat liver extract contains enzymes that may be necessary for certain mutagens to work. Mutagenicity of rat liver extract alone was tested by the control, while mutagenicity of a chemical mutagen alone was tested in the second sample Bacterial cells can only make the amino acid histidine if rat liver extract is present
Rat liver extract contains enzymes that may be necessary for certain mutagens to work. Since it must be added to the experimental sample, it is also added to the control sample.
In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive. A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be concluded from these results? Multiple Choice The newly synthesized compound induces a mutation in the bacteria and the bacteria no longer produce histidine. The bacteria produce histidine. The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. The bacteria no longer produce histidine. The newly synthesized compound induces a mutation in the bacteria.
The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine.
