Exam 4
Define cancer AND state the GENERAL cause of all types of cancer.
Cancer is unrestrained cell growth. All cancer is caused by DNA mutation.
Chin dimples is recessive (c) to having no chin dimples which is dominant (C). Also, normal pigmentation is dominant (A) to albinism (a) in humans. A woman who is heterozygous for both traits marries a man heterozygous for albinism and who has chin dimples. What are the genotypes and ratios of genotypes for their offspring?
CcAA: 1/8, CcAa: 1/4, ccAA: 1/8, ccAa: 1/4, Ccaa: 1/8, ccaa: 1/8
Which of the following is NOT a checkpoint that controls the progression of the cell cycle?
Cytokinesis involves the formation of cleavage furrow to separate the cells.
Explain what the central dogma of molecular biology means in your own words
DNA is the template that codes for all polypeptides. Before polypeptides can be made, the DNA must be transcribed into a mRNA first. That mRNA can leave the nucleus and be translated in the cytoplasm by the ribosome to make the polypeptide.
What does not happen in the cytokinesis of plant cells?
Formation of cleavage furrow to separate the cells.
Principle(s) of the chromosome theory of inheritance include: Check all that apply.
Genes are transmitted from parent to offspring via chromosomes. Diploid cells contain a maternal and paternal set of chromosomes. The paternal and maternal chromosomes segregate independently during meiosis. Gametes are haploid.
In a test cross, peas of an unknown genotype are crossed with peas of a known genotype. In this example, smooth peas are the unknown and wrinkled peas are the known (rr). If half of the offspring from that cross are smooth and half are wrinkled, what is the genotype of the unknown plant?
Heterozygous: Rr
Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate.
IV, III, I, V, II
A woman of blood group A has a child with a man of blood group B. The child's blood is type O. What are the genotypes of the parents?
Mother: IAiO; father: IBiO
Colchicine is a toxin that binds to tubulin proteins and prevents microtubules from polymerizing. What affect might this have on dividing cells?
Sister chromatids will not be properly separated into separate daughter cells
Which of the following statements about the 5′cap and mRNA processing is TRUE?
The addition of a 5′ cap to mRNA occurs while the pre-mRNA is being made.
A mutation occurs in a gene that encodes a G1-cyclin, such that the protein is unable to bind to its CDK. How will this affect the cell cycle?
The cell will be stuck in G1 and will not advance through the cell cycle.
An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits.
4
The process by which haploid cells are produced from diploid cells is called
meiosis
A mutation causes a gene to become overactive, contributing to uncontrolled cell growth. Which term best describes this gene?
oncogene
When a single-gene mutation can have phenotypic effects at multiple stages of development, it is
pleiotropic.
What factors are recognized by the cell in order to recognize the stop codon and disassemble the translation machinery?
release factors
Which of the following serves as the "translator" or intermediary between an mRNA codon and an amino acid?
tRNA
More than one codon can specify the same amino acid.
true
Most oncogenes encode proteins that function in cell growth signaling pathways.
true
What is the function of the poly A tail?
The poly A tail increases mRNA stability in eukaryotes
The two-factor crosses performed by Mendel support the observation that
alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits.
Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
base addition frameshift
Which protein directs apoptosis?
caspase
Which region of a structural gene contains the information that specifies an amino acid sequence
coding region
A haploid cell is a cell
containing only one copy of each chromosome.
An organized unit of DNA sequences that enables a segment of DNA to be transcribed into RNA and ultimately results in the formation of a functional product is called a _______.
gene
The fact that most monosomies and trisomies are lethal to human embryos illustrates the
importance of the orderly distribution of genetic material during meiosis.
If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example?
incomplete dominance
The centromere
is a region of DNA where sister chromatids associate.
Which of the following statements about the cell cycle is correct?
When the S phase of the cell cycle is finished, a cell has twice as many chromatids as the number of chromosomes in the G1 phase.
Which of the following statements is FALSE concerning sister chromatids?
Sister chromatids separate during telophase.
The process that produces mRNA from DNA is called
transcription.
Decide which sequence of events is most CORRECT for the initiation and elongation steps of translation in prokaryotic cells? (1) initiator tRNA binds start codon on mRNA (2) small ribosomal subunit binds to mRNA (3) large ribosomal subunit binds (4) tRNA entry and peptidyl transfer reaction (5) translocation of ribosome and release of tRNA
2, 1, 3, 4, 5
Humans have __________ different types of autosomes.
22
Homologous chromosomes are identical copies of each other.
false