Genetics 332 Final Exam review

8. Your dog Fluffy's extended family has some members with a mutation in a gene that determines cell fate and produces dew claws. Not surprisingly, Fluffy has dewclaws. When you characterize the protein encoded by this mutant gene, you discover a difference in only a single amino acid where a leucine becomes a proline. Which of the following is most likely to be the type of mutation in your dog's genome? A. SNP B. CNV C. translocation D. transposon E. deletion

A- SNP

4. What types of genetic variation can be determined between two individuals of the same species through a standard karyotype analysis using Giemsa staining? Choose all that apply. a. SNPs b. translocations c. allele differences made up of one point mutation (a different nucleotide) d. Chromosome number. e. Heterochromatin and euchromatin differences

A- SNPs B- Translocation E- Heterochromatin and euchromatin differences

In cats, the allele for long hair (l) is recessive to the dominant short hair allele (L) so that heterozygous Ll cats have short hair. Your two cats, one short-haired and one long-haired, have mated and you want to predict the probabilities in their first litter.What will the offspring genotypes most likely be if your short-haired cat is Ll? What will the offspring genotypes be if your short-haired cat is LL? a. half short hair, all short hair b. all short hair, half short hair c. all short hair, all short hair d. 1⁄4 short hair, 3⁄4 short hair e. 3⁄4 short hair, 1⁄4 short hair

A- half short hair, all short hair

You've been doing a lot of PCR and the carbon footprint of shipping enzymes overnight on dry ice to your research lab is too much. So, you want to clone and make your own DNA polymerase instead of buying it every time you do an experiment. Given this sequence of the 5' end of the gene encoding Taq DNA polymerase ATGCCAGAATTAAATAATCAAAATTTTAATCACTTAAAAATTCATACACAGTATTCAATTTGTGAAGGTG CTATCAAAATTGATAACTTAAAAGATTTTTGTAAAGAAAAAAAAATACCTTGCTTAGGTATTTCAGACAC ATCTAATTTATGTGGTGCATTAGAGTTTGCTGAAAATATTTCTAAGGTTGGTACACAGCCAATTATTGGC ACTCAAATCTATTTTAAATTTGAAGATACAACAGGGCTATTACCCCTAATAGCTCTTAACGAAAATGGAT the best forward PCR primer would be: A. 5' ATGCCAGAATTAAATAATC B. 5' GATTATTTAATTCTGGCAT C. 5' TACGGTCTTAATTTATTAG D. 5' TCTTAACGAAAATGGAT E. 5' ATCCATTTTCGTTAAGA

A. 5' ATGCCAGAATTAAATAATC

Which one of these shows part of the events of translation, in order? A. 5' cap recognition, scanning, initiation, peptide bond, tRNA recycling B. methionine, initiation, scanning, polyadenylation C. histone deacetylation, separating the double helix, initiation, elongation, termination D. tRNA charging, rRNA unwinding, mRNA elongation, ribosome termination E. Kozak, Shine-Dalgarno, hairpin attenuation, methionine, tryptophan

A. 5' cap recognition, scanning, initiation, peptide bond, tRNA recycling

You want to PCR the MYO5C gene and use DNA sequencing to test if you have the SNP variant that puts you at increased risk of developing type 2 diabetes. In what order might your experiments be? A. PCR your DNA using MYO5C-specific primers, then sequence the PCR product, then align with the genome and look for that particular SNP (rs3825801) B. Sequence your genome using SNP-specific primers, then do a GWAS for rs3825801 C. PCR the whole genome, then sequence only the MYO5C locus to look for a new mutation in rs3825801 D. Clone your MYO5C gene from some cheek cells, then overexpress it in a hepatocyte cell line in vitro or a mouse in vivo to test if it produces type 2 diabetes-like insulin resistance, compared to a wild-type MYO5C. E. Collect a blood sample now and freeze it, then see if you develop type 2 diabetes. If so, collect another blood sample and quantify the mRNA expression levels of MYO5C rs3825801 to compare before vs after

A. PCR your DNA using MYO5C-specific primers, then sequence the PCR product, then align with the genome and look for that particular SNP (rs3825801)

You've done an experiment where you isolated your favorite transcription factor, Nrf2, after starvation, which is a time when you know that it is bound to DNA. You digested the DNA sample with a DNAse enzyme, which destroys any DNA that isn't occupied by a TF.How could you use this sample to identify a consensus sequence? A. Use Sanger sequencing to sequence all of the DNA fragments in your sample and compare them B. Use PCR to amplify all of the DNA fragments in your sample and compare them C. Use transcriptomics to sequence all of the mRNAs in your sample and compare them D. Use RNA polymerase to make extra copies of the DNA fragments in your sample E. Test whether these DNA sequences can be detected by FISH after starvation

A. Use Sanger sequencing to sequence all of the DNA fragments in your sample and compare them

. A surprising kind of mutation that can arise during recombination and eliminate heterozygosity in a region, preventing you from determining individual haplotypes at one or more loci, is: A. a gene conversion B. a photodimer C. a CNV D. a telomere E. a SNP

A. a gene conversion

Which of the following can affect (can change, or can occur to) a protein after it is translated? Select all that apply. A. acetylation B. phosphorylation C. transcription D. translocation E. mutation

A. acetylation B. phosphorylation D. translocation

What's the best primer for reverse transcriptase? A. oligo-dT, because it recognizes the 3' polyA tail and is the ideal substrate to produce the reverse complementary sequence of an mRNA B. Shine-Dalgarno sequence, because all mRNAs have this sequence C. ATAT because it binds the TATA sequence in a reverse and complementary manner D. Sigma factor, because RNA polymerase uses this at the 5' end every time it transcribes an mRNA E. snRNA, because spliceosomal sequences work with all eukaryotic mRNAs

A. oligo-dT, because it recognizes the 3' polyA tail and is the ideal substrate to produce the reverse complementary sequence of an mRNA

Which of the following would not disqualify the white-tailed deer (Odocoileus virginianus) population in Broome County from reaching Hardy-Weinberg equilibrium for a gene of interest? A. mixing between this population and another population that lives in Tompkins County (Ithaca area) B. non-random mating between deer based on coat appearance C. a small # of individuals that are able to breed and produce offspring D. a fitness advantage for one allele of the gene of interest, compared with other alleles (the allele makes a pretty coat) E. All of the above would prevent a population from reaching HWE.

All of the above would prevent a population from reaching HWE.

Choose all of the following statements that apply to complex (a.k.a. quantitative) traits. a. In a population, the phenotypic variation of a quantitative trait is a continuous range rather than discrete, distinct traits.b. A quantitative trait is typically influenced by many genes (polygenic). c. A quantitative trait can be influenced by the diet, environment, circadian rhythms, or other conditions that control the expression and function of genes. d. Many human diseases and common traits are complex, quantitative traits. e. Quantitative traits do not follow the inheritance patterns described by Gregor Mendel.

All of them

How does an update in reference genomes change an individual's predicted ancestry? a. the reference genome has sequenced more SNPs in regions of the genome that are conserved across all animals b. the reference population includes more individuals from the same family c. sequencing more individuals in each reference population allows the refinement of training algorithms that assign SNPs to specific reference populations d. whole genome sequencing of individuals from the reference population gives more detailed data than the old SNP arrays e. Updating reference genomes and how they are analyzed can't change ancestry predictions because ancestry doesn't change.

B- the reference population includes more individuals from the same family

18. Which of the following does not require a consensus sequence made of several NTs? A. transcription factor binding site B. 5' capping region of a new eukaryotic mRNA C. recognition of splice sites at the exon/intron boundary of eukaryotic mRNAs D. miRNA target sites in mRNAs that it base pairs with E. translational initiation

B. 5' capping region of a new eukaryotic mRNA

10. When we talk about genome-wide association, what do we mean by a significant association? A. Genes throughout a chromosome are associated with each other in haplotypes B. A genetic locus is associated with higher risk of a trait in cases, compared with controls C. Linkage occurs between the associated genes D. Genes are made up of nucleotides which are linked by phosphodiester bonds E. The association of SNPs that are observed explain all cases of the disease in a population.

B. A genetic locus is associated with higher risk of a trait in cases, compared with controls

Many geneticists would consider a high LOD score to be more interesting than a low LOD score because: A. A high LOD score means more subjects in your study population have the disease than you expected B. A high LOD score means you may have identified a significant linkage between a gene and a disease or another trait. C. A high LOD score means there are a lot of recombination hotspots (recombinants) in your population D. A high LOD score means the severity of disease is very high in the study E. A high LOD score means the parental haplotypes are found in most offspring in the study population

B. A high LOD score means you may have identified a significant linkage between a gene and a disease or another trait.

. Genetic interference occurs when: A. Recombination can't occur due to the binding of histone proteins in nucleosomes. B. The likelihood of a crossover event is lower than expected when in proximity to another crossover. C. The effect of one allele or gene masks the effect of another gene. D. Heterochromatin blocks the replication of a gene because histones and nucleosomes are interfering. E. Some genotypes can't be observed, due to recessive lethality.

B. The likelihood of a crossover event is lower than expected when in proximity to another crossover.

DNA damage can be caused by ___ and repaired by ___ A. evolution; mutation B. UV light; NER C. zinc oxide; ROS D. ions; X-ray irradiation E. haplotypes; inversion

B. UV light; NER

When trp levels are low, the corresponding trp-charged aminoacyl tRNA levels are also low. This slows translation of codons encoding tryptophan, because it takes longer to find a tRNA that can base pair with a trp-encoding codon. Which of the following changes occur when trp concentrations aren't able to meet cellular needs? A. increase of trpR expression B. increase of trp biosynthetic enzyme-encoding gene expression C. increase of attenuation secondary structures in the mRNA of the trp operon D. increase in expression of the tRNA with the anticodon that is paired with tryptophan at its CCA end E. increase in negative feedback by tryptophan

B. increase of trp biosynthetic enzyme-encoding gene expression

You've collected some data on flower color in a population of monkeyflowers in the California wilderness. Your calculated X2 is much greater than the critical chi-squared value, so the difference between your observed and expected values is ______________________ and the null hypothesis will __________________________. A. large, fail to be rejected B. statistically significant, be rejected C. non-existent, be confirmed D. minimal, be confidently rejected E. not a major underlying cause for the trait of interest, fail to be rejected

B. statistically significant, be rejected

Which of the following does NOT require a particular RNA sequence? A. splicing B. transcriptional initiation C. CRISPR D. Argonaute-mediated degradation E. translational initiation

B. transcriptional initiation

What is the best definition of a gene? A- All genes are sequence of DNA that encode mRNAs that encode proteins. B- A gene is one of many DNA regions that are found in the nucleus. C- The basic unit of inheritance in an organism's genome, a gene can encode a protein and can also affect a trait. D- A gene is a piece of DNA that varies across individual. E- A gene is the type of DNA that can have a polymorphism.

C- The basic unit of inheritance in an organism's genome, a gene can encode a protein and can also affect a trait.

In genetics, the term polymorphic refers to: a. different structural states of chromatin that occur due to dosage compensation b. different splice forms of the mRNA that can be produced from the same gene c. different nucleotides observed at the same location in a gene or locus throughout a population d. different phenotypes depending on the relative contributions of additive traits e. differences in sex development where criteria for both male and female are met

C- different nucleotides observed at the same location in a gene or locus throughout a population

Given the sequencing gel to the right, what is the DNA sequence in the region surrounded by the dotted line, which contains 7 bands? A. 5'- ATAGCAT B. 5'- ATGCATG C. 5'- TACGATA D. 5'- ATCGTAT E. unable to determine with the information given

C. 5'- TACGATA

Red flowers, R, are dominant to white, r, and variegated leaves, V, are dominant to green leaves, v. These two loci are 30 cM apart.Of 60 progeny, how many would be expected to have white flowers and green leaves? A. 3 B. 6 C. 9 D. 15 E. 30

C. 9

Because DNA replication is semi-conservative, if you shift a bacterial culture grown in a heavy radiolabeled 32P phosphate-containing medium to a lighter, conventional phosphate-only growth medium, you'd see:A. A change in the size (molecular weight) of the DNA where it has two different sizes after one cell division (aka one round of DNA replication) B. No change after one generation (cell division) but a difference after the second cell division C. A change in the size (molecular weight) of the DNA where, after one cell division, you observe a single band of DNA of lower density/size, representing one heavy P strand and one light P strand D. A change in the size of DNA so there are eventually three different sizes: heavy base paired with heavy, heavy base paired with light, and light base paired with light strands E. No growth because the 32P is a terminator nucleotide that stops DNA replication.

C. A change in the size (molecular weight) of the DNA where, after one cell division, you observe a single band of DNA of lower density/size, representing one heavy P strand and one light P strand

What are the haplotypes of the individuals shown? A. AGT, AGA, AGA B. AGA, AGG, GTG, GTT C. AGTA, ACAT, TCAA, and AGTT D. TAGGA and TAGGT E. TCAA, TGTA, TCAT

C. AGTA, ACAT, TCAA, and AGTT

When using CRISPR as a genetic tool, what role does the cell play? A. Cells provide the exonuclease activity to cut DNA B. Cells provide the viral genome to act as CRISPR substrate C. Cells repair the DNA after Cas9 cuts the DNA. D. Cells provide the plasmid that encodes Cas9 and the guide RNA .E. Cells are passive and don't do anything; the researcher provides everything needed to edit the genome.

C. Cells repair the DNA after Cas9 cuts the DNA.

Gene A encodes a transcriptional activator of gene B. Gene B mRNA is increased when the cell is exposed to UV light. Which of the following is likely to explain the function of gene B? A. Gene B encodes a transcription factor that is activated by UV light B. Gene A encodes an enzyme that repairs the protein product of Gene B C. Gene B encodes an enzyme that repairs the DNA damage from UV light D. Gene B encodes a eukaryotic initiation factor that increases translation E. Gene B encodes an enzyme that repairs the protein product of Gene A

C. Gene B encodes an enzyme that repairs the DNA damage from UV light

You are on the trail of a serial killer whose DNA has been recovered from a crime scene. Which of the following would not be good evidence to choose a suspect? A. Evidence placing the suspect at the crime scene when it occurred B. Two distant relatives for a suspect have similar haplotypes to the killer's DNA. C. The killer has the same height and skin color as your suspect. D. The killer has the same genotype as your suspect .E. The killer has the same haplotype as your suspect.

C. The killer has the same height and skin color as your suspect.

Which of the following is not a difference between the leading and lagging strands in a replication fork or bubble during DNA replication? (choose only one) A. The leading strand has one DNA polymerase whereas the lagging strand has a few B. The lagging strand has Okazaki fragments whereas the leading strand does not. C. The leading strand doesn't require gyrases and helicases to unwind it, whereas the lagging strand is slower due to a need for unwinding. D. The lagging strand needs ligase to complete the phosphodiester backbone between segments whereas the leading strand does not E. The lagging strand will be the reverse complement of the leading strand.

C. The leading strand doesn't require gyrases and helicases to unwind it, whereas the lagging strand is slower due to a need for unwinding.

Which of the following best describes the transcriptional regulation of the Sxl gene? A. An autosomal transcription factor regulates expression of Sxl on the X chromosome; more Sxl is produced in XX individuals, compared to XY individuals. B. A Y-linked transcription factor, Sxl acts as a lethal protein in males, so its expression is limited to females C. The ratio of X chromosomes to autosomes means females have twice as much transcription factor (TF), which is encoded on the X chromosome. Cells are only able to overcome inhibition of the TF by another protein in females, where the TF drives Sxl expression D. The relative expression of Sxl:SRY is regulated by a TF downstream of the hormone testosterone and determines the sex of an individual during development E. Sxl is a positive transcriptional regulator in females, whereas it inhibits transcription in males to produce lethality.

C. The ratio of X chromosomes to autosomes means females have twice as much transcription factor (TF), which is encoded on the X chromosome. Cells are only able to overcome inhibition of the TF by another protein in females, where the TF drives Sxl expression

A truncated protein results when: A. RNA polymerase encounters a hairpin B. A tRNA without a charged amino acid binds the ribosome's A site C. a point mutation in a codon upstream of the stop codon produces an early stop codon, and the ribosome is released prematurely D. RNA polymerase reaches a stop codon in the rRNA, which binds a release factor instead of a tRNAE. Poly-A polymerase fails to add the poly-A tail to the nascent polypeptide

C. a point mutation in a codon upstream of the stop codon produces an early stop codon, and the ribosome is released prematurely

You do a three-point test cross with two diploid mosquitos harboring three marker genes: s, sharpened proboscis (for sucking blood), b, brown body, and bl, black eyes. The genotypes (or haplotypes) of the parental gametes are: s, b, bl and s+, b+,bl+ The genotypes of DCO (double crossover) gametes are: s, b, bl+ and s+, b+, bl When we examine the genetic map, which locus is in the middle on the chromosome? A. s, sharpened proboscis B. b, brown body C. bl, black eyes

C. bl, black eyes

Which of the following could not be determined after you receive the sequence of a novel mRNA in an email from your collaborator? Select all that apply. A. sequence of amino acids that will be in the protein it encodes B. potential target sites for miRNAs C. the splice sites used to produce it D. the consensus sequence used to drive transcription from its promoter E. All of the above can be defined for a typed sequence if you know it's an mRNA

C. the splice sites used to produce it D. the consensus sequence used to drive transcription from its promoter

UAU codons encode Tyr (tyrosine) and UAC codons also encode Tyr. The theory underlying the ability of one anticodon to recognize (and base pair with) codons ending in C or U is called: A. the Central Dogma B. ribozyme C. wobble D. Shine-Dalgarno E. EF-CU

C. wobble

What would the tRNA's anticodon sequence for #24 be? A. 5'- UAG- 3' B. 5'-ATA- 3 'C. 5'-GTA-3' D. 5'-GUA-3' E. 5'- AUG- 3'

D. 5'-GUA-3'

A recent GWAS paper published in the journal Nature Genetics by Mahajan et al (May 2022) entitled "Multi-ancestry genetic study of type 2 diabetes highlights the power of diverse populations for discovery and translation" identified a significant association for MYO5C (rs3825801, P = 3.8 × 10−11). What does this mean? A. People with the MYO5C gene are more likely to have type 2 diabetes, compared with those who don't. B. The levels of MYO5C protein are increased in type 2 diabetes patients. C. Everyone with type 2 diabetes has the risk allele of MYO5C called rs3825801 D. An individual with the rs3825801 SNP in the MYO5C gene is more likely to develop type 2 diabetes than someone with a different allele at that location in the genome. E. MYO5C encodes a protein that functions in the progress or development of type 2 diabetes.

D. An individual with the rs3825801 SNP in the MYO5C gene is more likely to develop type 2 diabetes than someone with a different allele at that location in the genome.

Which of the following is not a difference between gene expression (a.k.a. the Central Dogma) in eukaryotes and prokaryotes? (choose only one) A. Eukaryotes have several RNA polymerases whereas prokaryotes typically have only one.B . Eukaryotic RNAs require more processing and transport before being translated than prokaryotic RNAs C. Eukaryotic RNAs encode the start codon as a regular methionine, whereas prokaryotes start with f-met. D. Eukaryotic gene expression uses specific transcription factors under different cellular conditions, whereas prokaryotes do not. E. All of the above describe differences between eukaryotic and prokaryotic cells.

D. Eukaryotic gene expression uses specific transcription factors under different cellular conditions, whereas prokaryotes do not.

6. Which of the following describes FISH? A. FISH is when pieces of DNA move from one location in the genome to another B. FISH is when you're fishing through the nucleus for a particular binding site C. FISH is the conversion of heterochromatin into euchromatin to reveal a target sequence D. FISH is the use of a fluorescent probe to detect a specific sequence of nucleic acids E. FISH tells you where a new SNP has occurred.

D. FISH is the use of a fluorescent probe to detect a specific sequence of nucleic acids

What is being shown in this cartoon? A. Recruitment of the sigma (σ) subunit to begin transcription B. The A, P, and E sites of the complete ribosome ready to initiate translation C. The poly-A binding protein about to translate an mRNA D. Translational initiation at the Shine-Dalgarno sequence by the small ribosomal subunit E. Cas9 looking for a guide RNA target site.

D. Translational initiation at the Shine-Dalgarno sequence by the small ribosomal subunit

"CRISPR" technology uses a _____ to find the correct target sequence in the genome. A. Cas9 B. exonuclease C. base pair D. guide RNA E. recombinase

D. guide RNA

Which of the following will not change Genetic Admixture? A. difference in the number of recombination events in a diverse population B. difference in the number of breeds in a mixed breed dog, who breeds a lot C. appearance of an inherited sterility phenotype in many families in a population D. a sudden isolation of populations by geology E. All of the above would affect the degree of admixture.

E- All of the above would affect the degree of admixture.

Two heterozygous carriers have the genotype HbA HbS and have phenotypically normal red blood cells but carry the HbS allele that produces sickled RBCs in an autosomal recessive inheritance pattern.If these two individuals produce offspring, what is the probability that all three of their children will have normal blood cells? A. 3/64 = 0.046875 B. 9/64 = 0.140625 C. 9/16 = 0.5625 D. 18/64 = 0.28125 E. 27/64 = 0.421875

E. 27/64 = 0.421875

What information cannot be determined from a complete, thoroughly-researched pedigree? A. parentage of an individual B. # siblings of an individual C. whether two trait-associated loci are closely linked to each other or are more than 50 cM apart D. whether an allele might be associated with a trait E. All of the above can be determined from the most detailed pedigrees.

E. All of the above can be determined from the most detailed pedigrees.

2. Diploid cells can have two of each: A. gene B. chromosome C. allele D. genomic region E. All of the above could be answers to this question.

E. All of the above could be answers to this question.

Which of the following events couldaffect the results of a GWAS?(Select one answer only). A. Expanding the range of different regional reference populations analyzed for the trait of interest B. Increasing the number of individuals sequenced in your study cohort. C. Increasing the number of affected individuals (carrying the trait or phenotype of interest) D. Using a correction factor to adjust the significance threshold, in order to draw a more conservative set of conclusions E. All of the above would affect the results of a GWAS.

E. All of the above would affect the results of a GWAS.

Riboswitches regulate translation by: A. generating ligands that bind the ribosome B. adding a 5'cap and poly-A tail to increase ribosome recruitment C. encoding the Kozak sequence as a landmark or signpost for the ribosome D. switching the charged tRNA for an uncharged tRNA so translation can proceed E. changing the secondary structure of an RNA to allow or reduce translation

E. changing the secondary structure of an RNA to allow or reduce translation

The molecular machinery for _____ closely follows DNA polymerase and its replisome to fix any errors that DNA pol's proofreading exonuclease domain doesn't fix. A. nucleotide excision repair B. base repair C. homologousrepair D. trinucleotide repeat repair E. mismatch repair

E. mismatch repair

The AMP-activated enzyme AMP kinase (AMPK) phosphorylates the transcription factor Nrf2 and increases the mRNA levels of its target genes. Which of the following would be the most plausible mechanism for this response? A. Nrf2 target genes encode proteins that synthesize AMP. B. AMP is a ligand for Nrf2 C. Nrf2 translocates to the nucleus and acts as a positive regulator of transcription when phosphorylated D. Nrf2 recruits histone acetylases (aka histone acetyl transferases) to the promoters of AMP-dependent genes to help make heterochromatinE. AMPK is a negative regulator of Nrf2 activity

Nrf2 translocates to the nucleus and acts as a positive regulator of transcription when phosphorylated

What would be the effect of an E. coli strain that carried a deletion of the lac operon's operator sequence? A. The lacZ gene would not be expressed under any condition B. The lacZ gene would be expressed under all conditions C. The lacZ gene would only be expressed when glucose levels are low D. The lacZ gene would only be expressed when lactose levels are low E. The lacZ gene would only be expressed when lactose levels are high

The lacZ gene would be expressed under all conditions

Consider eye color, an X-linked trait in fruit flies. Wild type eyes are red and are dominant to white eyes. A white-eyed female was crossed to a red-eyed male. The F1s were crossed to their siblings to produce F2s. What are the expected proportions of offspring in the F2 generation? a. 25% red eyed females: 25% white eyed females: 25% red eyed males: 25% white eyed males b. 50% red eyed females: 25% white eyed males: 25% red eyed males c. 25% white eyed females: 25% red eyed females: 50% red eyed males d. 50% white eyed males: 50% red eyed females e. 50% red eyed males: 50% white eyed females

a. 25% red eyed females: 25% white eyed females: 25% red eyed males: 25% white eyed males

In birds, males are the homogametic sex while females are the heterogametic sex. Which of the following is true in this system of sex determination? a. The gender of the offspring is determined by the female parent's gamete. b. Male offspring have a ZW chromosome pattern due to the maternal contribution from their mothers. c. The gender of the offspring is determined by the male parent's gamete. d. Female offspring have a ZZ chromosome pattern due to the maternal Z they inherited. e. Males and females are determined by environmental conditions rather than chromosomes.

a. The gender of the offspring is determined by the female parent's gamete.

Consider the results from physical, genetic, and hormonal sex determination tests for an athlete that competes in the female category: Physical characteristics: female genitals fully formedGenetic test findings: one Barr body present in all cells, SRY gene absent Hormone test findings: Testosterone (T) = 11.8 nmol/L What is the most likely cause for high T in this individual? Keep in mind that a genetic mutation to a particular gene is unlikely to alter the chromosome structure. a. XX with a mutation in a gene that causes constitutive androgen hyperplasia b. XY with a mutation in the SRY gene c. XYY d. X0/XY mosaic e. XXY/XY mosaic

a. XX with a mutation in a gene that causes constitutive androgen hyperplasia

Serrate Drosophila flies are heterozygous for a dominant mutation that results in a notched wing. The mating of 2 Serrate flies produces 2 flies with notched wings and 1 normal winged fly.The mutation causing the serrate wing phenotype is likely a(n) ______ allele. a. lethal b. epistatic c. codominant d. pleiotropic e. variably expressed

a. lethal

In guinea pigs, smooth hair is due to a dominant allele (S) and curly hair is due to a recessive allele (s). Black coat color is due to a B allele that is dominant to brown coat (b). A third allele at the coat color locus, when homozygous, produces a white coat. When a true breeding* smooth-haired white guinea pig was crossed to a true breeding curly, brown guinea pig, the F1 offspring had smooth, brown-and-white spotted fur. *True breeding animals produce F1 offspring of the same genotype and phenotype as the parents when mated to each other. This is how researchers maintain "stocks" of a particular genotype for experiments. What is the relationship between the brown and white color alleles? a. they are codominant b. they show incomplete dominance c. brown is dominant to white d. brown is epistatic to white e. brown and black are both recessive to white

a. they are codominant

If 36% of a population show a recessive trait (aa), what will be the frequency of heterozygous individuals in the following generation, assuming Hardy-Weinberg equilibrium? a. 0.6 = 60% b. 0.48 = 48% c. 0.4 = 40% d. 0.36 = 36% e. 0.16 = 16%

b. 0.48 = 48%

What are the predicted phenotypic ratios of a cross between 2 gerbils with the genotypes XxYYTt (Note these are not X and Y chromosomes, but alleles of genes X and Y that are on different autosomes and segregate independently) a. 12 black: 4 white b. 9: black: 7 white c. 9 white: 7 black d. 8 black: 4 whitee. 15 black: 1 white

b. 9: black: 7 white

A form of vitamin D-resistant rickets, known as hypophosphatemia, is inherited as an X-linked dominant trait. If a male with hypophosphatemia marries a normal (unaffected) female, which of the following predictions concerning their progeny (biological offspring) would be most likely to come true? a. All of their sons would inherit the disease b. All of their daughters would inherit the disease c. About 50% of their sons would inherit the disease d. About 50% of their daughters would inherit the disease e. None of their daughters would inherit the disease

b. All of their daughters would inherit the disease

What is the relationship among alleles, genes, chromosomes, genomes, and DNA? a. Each chromosome in a cell contains hundreds of genomes, which are composed of DNA. b. The complete set of genes in a cell is made of DNA and comprises the genome. Genes can have one or more alleles and are found in distinct regions of a chromosome. c. A genome contains hundreds of genes, composed of a chromosome that is one long piece of double- stranded DNA per cell. d. Alleles are variations of a gene that change the binding properties of DNA, each of which has its own chromosome. e. A genome contains hundreds of chromosomes, which are composed of DNA, all of which encodes genes.

b. The complete set of genes in a cell is made of DNA and comprises the genome. Genes can have one or more alleles and are found in distinct regions of a chromosome.

In humans, an autosomal gene controls hair growth. In males, the B allele prevents head hair growth (complete baldness) and is dominant to the wild type allele that allows hair growth, so that Bb males are completely bald. By contrast, Bb females that are heterozygous for this same baldness allele have normal hair growth, while females that are homozygous for the baldness allele (BB) have reduced hair growth. What term best describes this allele conferring baldness? a. sex-linked b. sex-influenced c. recessive d. dominant epistasis e. pleiotropic

b. sex-influenced

Consider the following cross: AaBbDd X aabbDd. What proportion of the offspring is expected to show the dominant phenotype for all three traits?a. 9/16 = 0.5625 b. 6/16 = 0.375 c. 3/16 = 0.1875 d. 1/8 = 0.125 e. 1/16=0.0625

c. 3/16 = 0.1875

In Labrador retrievers, the B allele is required for black fur and is dominant to the b allele which produces brown fur. A second gene called the extension locus determines whether the color is extended onto the fur. The E allele allows for color extension of black or brown and is dominant over the e allele, which leads to a yellow color. What would be the expected phenotypic ratios for the following cross? BbEe x BbEe a. 1 black: 1 brown: 2 yellow b. 2 black: 1 brown : 1 yellow c. 9 black : 3 brown : 4 yellow d. 9 black : 4 brown: 3 yellow

c. 9 black : 3 brown : 4 yellow

The phenomenon where sunlight increases the appearance of freckles in individuals who harbor two copies of the trait-associated allele of the mc1R gene is called: a. a monohybrid cross b. a translocation c. a gene-by-environment interaction d. a copy number variant e. dominance

c. a gene-by-environment interaction

What is the role of the SRY gene in humans? a. it is located on the Y-chromosome and initiates the X-inactivation process in females b. it is located on the Y-chromosome and causes the Y to pair with the X chromosome during meiosis in males. c. it is located on the Y chromosome and initiates the developmental pathway toward the male gonad. d. It is located on the Y chromosome and stimulates expression of X chromosome genes to balance their expression levels between males and females e. it is located on the Y chromosome and prevents the formation of Barr bodies in males

c. it is located on the Y chromosome and initiates the developmental pathway toward the male gonad.

This pedigree shows the genotype at two loci, gene A and gene D. The haplotypes of each individual are shown. What can be determined about the gametes that produced individual II- 1? a. 1 parental/non-recombinant gamete, 1 unknown b. 1 non-parental/recombinant gamete, 1 unknown c. 2 parental/non-recombinant gametes d. 1 parental/non-recombinant and 1 non-parental/recombinant gamete e. not enough information to determine either gamete

d. 1 parental/non-recombinant and 1 non-parental/recombinant gamete

In guinea pigs, smooth hair is due to a dominant allele (S) and curly hair is due to a recessive allele (s). Black coat color is due to a B allele that is dominant to brown coat (b). A third allele at the coat color locus, when homozygous, produces a white coat. When a true breeding smooth-haired white guinea pig was crossed to a true breeding curly, brown guinea pig, the F1 offspring had smooth, brown and white spotted fur. What are the expected phenotype ratios for the F2 progeny from an F1 x F1 cross? A. all smooth with brown and white spotted coats b. 4/16 brown, smooth coat; 4/16 white, smooth coat; 12/16 spotted, smooth coat c. 3/16 brown, smooth coat; 3/16 white, smooth coat; 6/16 spotted, smooth coat, 4/16 curly spotted coat d. 6/16 spotted smooth, 3/16 brown smooth, 3/16 white smooth, 2/16 spotted curly, 1/16 brown curly, 1/16 white curly e. 1/16 smooth brown coat, 3/16 curly brown coat, 1/16 smooth white coat, 3/16 curly white coat, 2/16 curly spotted coat, 6/16 spotted smooth coat

d. 6/16 spotted smooth, 3/16 brown smooth, 3/16 white smooth, 2/16 spotted curly, 1/16 brown curly, 1/16 white curly

12. In cats, short hair is due to an allele (L) in FMG5 gene that is dominant to the recessive (l) allele. The amount of black color that is deposited into the fur in the cats you're fostering is controlled by the MLPH gene, where the D allele results in full color deposition and is dominant to the d allele, which leads to a diluted (faint- in this case, gray) color. Two short haired, black cats that are heterozygous at both loci (LlDd) are mated. What are the expected phenotypic ratios of their kittens? a. 9/16 long black hair: 3/16 short gray hair: 3/16 long gray hair: 1/16 short black hair b. 9/16 short black hair: 3/16 long gray hair: 3/16 short gray hair: 1/16 long black hair c. 9/16 short black hair: 3/16 short hair with black and gray stripes: 3/16 long hair with black and gray stripes: 1/16 long gray hair d. 9/16 short black hair: 3/16 short gray hair: 3/16 long black hair: 1/16 long gray e. 1⁄4 short black: 1⁄4 short gray: 1⁄4 long black: 1⁄4 long gray

d. 9/16 short black hair: 3/16 short gray hair: 3/16 long black hair: 1/16 long gray.

Dosage compensation can entail: a. red and white pigment genes combining to make a pink colored flower b. Sxl killing half the females to even out the number of X chromosomes in the population c. mating of yeast cells to make diploid male and female offspring d. condensing one copy of the X chromosome in XX individuals to reduce the expression of X-linked genes e. All of the above describe dosage compensation.

d. condensing one copy of the X chromosome in XX individuals to reduce the expression of X-linked genes

In a woman, a nondisjunction event occurred during Meiosis I affecting an X chromosome.If all 4 gametes (eggs) were fertilized by a gamete (sperm) containing a Y chromosome, what proportion of her resulting offspring would have Klinefelter's syndrome (XXY)?a. 0% b. 25% c. 50% d. 75% e. 100%

e. 100%

19. What is the probability that their next child will be freckled with normal eyelashes? a. 3⁄4 = 0.75 = 75% b. 2/3 = 0.66 = 66% c. 1⁄2 = 0.5 = 50% d. 1⁄4 = 0.25 = 25% e. 3/16 = 0.1875= 18.75%

e. 3/16 = 0.1875= 18.75%

Consider the results from physical, genetic, and hormonal sex determination tests for an athlete that competes in the female category: Physical characteristics: genitals neither typically male nor typically femaleGenetic test findings: Barr body present in some cells and absent in others, SRY gene present Hormone test findings: Testosterone (T) = 3 nmol/L What is the most likely karyotype of this individual? Keep in mind that a genetic mutation to a particular gene is unlikely to alter the chromosome structure. a. XXX b. XY c. XXY d. X0/XY e. XXY/XY

e. XXY/XY

. A haplotype refers to: a. part of the genome that contribute to the same phenotype b. part of the genome that is expressed only in haploid (gamete) cells c. part of the genome that is spatially restricted to the same chromosome and probably within a sub-section close to each other within the chromosomed. part of the genome that segregates (is likely to be inherited) together e. c. and d. are both correct

e. c. and d. are both correct

While doing field work on a remote island in the northern hemisphere, you discover a new species of turtles that appear to be members of the elusive genus known as Turtwig. You attempt to discover what sex determination system it uses by catching Turtwigs and performing a series of controlled crosses, using a pair of Turtwigs that you have placed in large enclosure to isolate them from other potential mates. You begin your work in coldest time of the year (February), when the average temperatures are only around 21°C (~70°F). Your first crosses yield only females. You complete your field work in June, when average temperatures are higher, around 30°C (~86°F). Your last set of crosses yield only males. Which of the following modes of sex determination best explains these data? a. ZZ/ZW b. XX/XY c. haplo/diploidy (XO/XX) d. sequential hermaphroditism e. environmental sex determination

e. environmental sex determination