genetics module 3 exam
Name and describe three different kinds of bacterial cloning vectors.
(1) plasmid: contain a multi-cloning site, origin of replication, and a selectable marker; can carry ~20-25Kb of foreign DNA (2) phage: a virus containing the DNA of interest infects bacteria; is more efficient than plasmid transformation and can carry ~25Kb of foreign DNA (3) cosmid: type of hybrid plasmid that contains plasmid sequences plus the COS sequences from phage for capsid packaging for phage transduction; cosmids form colonies, not plaques; can carry up to ~45Kb of foreign DNA (4) bacterial artificial chromosome or BA: a vector based on the bacterial F-plasmid (fertility plasmid), making its introduction in bacteria more stable than plasmids; typical foreign DNA insert size is in the hundreds of Kb
A typical prokaryotic genome has 1 million base pairs of DNA, containing 1000 genes. 1 million base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few thousand genes.
1 million base pairs of DNA, containing 1000 genes.
Most of the bacterial genomes described in the text have fewer than 10,000 genes 5,000 base pairs 500 genes 10,000 base pairs 50 genes
10,000
Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion. 400, 800, 1000 (2 of these) 400, 1200, 1600 300, 700, 2200 700, 400, 1400, 2600 300, 700, 1000, 1200
300, 700, 1000, 1200
Mycoplasma are among the smallest and perhaps the simplest self-replicating prokaryotes known. M. genitalium contains a genome of 0.58 Mb. Approximately how many genes does this bacterium contain? about 3000 426,000 12 1200 between 400 and 550
400-550
The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. Screening of genomic libraries of several other organisms reveals that all of them contain only one genomic clone -- pigs seem to be the exception to the rule here. What evolutionary events might have led to the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? How is this representative of a general type of occurrence in molecular genetic evolution?
50% credit: There was likely a duplication of this gene in pigs. 25% credit: After duplication, the gene has diverged. 25% credit: Evolutionary divergence tends to follow gene duplications, as mutations in one gene are no longer selected against as strongly (the presence of a "back up" copy of the gene means the individual will generally have at least one functional copy of the gene product). 25% credit: Alternatively, humans may have lost one copy of this gene. However, this possibility should be ruled out by the fact that pigs seem to be unique in possessing two genomic copies.
What appears to be the range of number of protein-coding genes per genome in eukaryotes?
5000 - 45000
What is a cDNA molecule?
A cDNA molecule is a DNA copy of an RNA molecule.
In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. What is a map unit, and why is it so different in these two different types of organisms?
A map unit is the amount of measured recombination between two linked points in a genome. Because one map unit in humans is many more base pairs than in yeast, the amount of homologous recombination per DNA length must be lower in humans than in Saccharomyces cerevisiae.
A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites? A 12-kb fragment An 8-kb fragment An 8-kb and a 2-kb fragment A 10-kb and a 2-kb fragment A 10-kb, an 8-kb, and a 2-kb fragment
An 8kb fragment
Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC series of plasmids?
An insert of DNA in the polylinker inactivates the lacZ component, allowing identification of recombinant plasmids under proper genetic and environmental conditions.
What is a transgenic organism?
An organism that stably carries a foreign gene within its genome
Under ideal conditions, how many copies of all the sequences of the host genome should be represented in a genomic library? Why?
At least one should be represented. Typically, library construction includes a several-fold greater number of clones than necessary for one representative of each fragment in order to increase the likelihood of cloning difficult fragments and stochastic loss.
Molecular biologists rely on many, often sophisticated, techniques to pursue their discipline. One may list ultracentrifugation, electron microscopy, X-ray diffraction, electrophoresis, and computer interfacing as fundamental. Model organisms provide the raw materials for study. List four "organisms" (or organismic groups) often used by molecular biologists and describe a major advantage of each group to the molecular biologist. We might consider these as "model organisms" of the molecular biologist.
Bacteriophage: relatively simple, short generation time. Bacteria: relatively simple, short generation time, simple growth requirements. Yeast: relatively simple for a eukaryote, short generation time, simple growth requirements. Drosophila: relatively simple to culture, extensive genetic and developmental information available, "giant" polytene (salivary gland) chromosomes.
Of the DNA sequences below, which would probably be the harder to determine? CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA
CGATATATATATATATACGAT
List four applications of PCR technology. Do not describe what PCR *does* (well, you can if you want, but you won't get points for it). Instead, list activities or fields in which PCR is useful.
Cell-free cloning Identification of restriction enzyme variants Screening for genetic disorders Diagnostic screening for infectious organisms Forensics Paleobiology
What is comparative genomics? How does its study contribute to our understanding of genetics?
Comparative genomics is a relatively new field involved in identifying similarities and differences in organization and gene content among the genomes of different organisms. Such studies are important for studying the genetic relatedness of species and for identifying gene families.
A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? Information about bacterial orthologs of the gene An EST database of the human genome Microarray data of tissues in which the gene is expressed Data about the inheritance of SNP markers in families with the disease Whole-genome-shotgun clones of the human genome
Data about the inheritance of SNP markers in families with the disease
Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides? Centrifugation sedimentation gradient. Fluorescently labeled dNTPs Fluoresently labeled dATP. Different fluorochromes attached to the four different ddNTPs.
Different fluorochromes attached to the four different ddNTPs.
Restriction endonucleases are typically used to clone genes. What factors determine the sites at which these endonucleases will cleave DNA? What characteristics do these sites tend to have?
Each RE will cleave at a specific sequence. These sequences tend to be short (4-8 bp), and tend to be palindromic (e.g., GAATTC).
The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR? Each cycle includes a "hot" saturation phase (95oC), which allows the primers to anneal to the target DNA. Each cycle includes a "hot" denaturation phase (95oC), which serves to sterilize the culture. Each cycle includes a "hot" denaturation phase (95oC), which activates the Taq polymerase. Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together. More than one of these answers is correct.
Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together.
As a model system, what are three of the advantages of the mouse as a model system?
Easy to grow • Short generation time • Produce abundant progeny • Readily mutagenized and crossed. Mice have similar body plans and stages of development as humans • Similar genome size and number of chromosomes to humans
Mario Capecchi, Sir Martin Evans, and Oliver Smithies recently won a Nobel Prize for gene targeting (gene knockouts) in mice. Describe the steps involved in creating a knockout mouse.
Embryonic stem (ES) cells heterozygous for a knockout mutation in a gene of interest (X) and homozygous for a marker gene (here, black coat color) are transplanted into the blastocoel cavity of 4.5-day embryos that are homozygous for an alternate marker (here, white coat color). The early embryos then are implanted into a pseudopregnant female. Some of the resulting progeny are chimeras, indicated by their black and white coats. Chimeric mice then are backcrossed to white mice; black progeny from this mating have ES-derived cells in their germ line. By isolating DNA from a small amount of tail tissue, it is possible to identify black mice heterozygous for the knockout allele. Intercrossing of these black mice produces individuals homozygous for the disrupted allele, that is, knockout mice
Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.
Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes. -or- Genes are more densely spaced in prokaryotes versus eukaryotes -or- prokaryotic genomes typically encode fewer genes than eukaryotic genomes Other answers are acceptable, provided they are true and make sense.
There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? Prokaryotic: presence of plasmids Prokaryotic: repetitive DNA Eukaryotic: repetitive DNA Eukaryotic: ESTs Eukaryotic: circular DNA
Eukaryotic: repetitive DNA
Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map?
Genes mapped based on recombination will appear to be very close together in centromeric regions due to low rates of recombination. Distances between the same genes on the physical map may be much greater when compared to other regions of the chromosome.
Match the following terms with their definitions. Enter one number per box. Closely related genes based on sequence and function. Homologus genes of the same locus inherited from a common ancestor. Genes related by gene duplication in the genome. Conservation of the same groups of genes in the chromosomes of 2 or more species.
Homolog ortho para synteny
This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.
Human Genome Project
Explain why the greatest diversity of human SNPs is found among African people.
Humans are thought to have first evolved in Africa. This means that any distinct population of humans (however defined) arose from a subset of the African population that became geographically isolated. Thus, any SNPs in this population arose from precursors that were already present in the African population, and another branch of those ancestral SNPs' descendents is likely still extant in the African population. Basically, for any SNP "family" in a distinct human Population X, the African population probably has a SNP family very similar to that one, plus several others with no clear analogue in Population X.
Nucleic acid blotting is commonly used in molecular biology. Two types, Southern blots and northern blots, involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure of "blotting" in this context and differentiate between Southern and northern blots.
In a Southern blot the DNA to be "probed" is cut with a restriction enzyme(s); then the fragments are separated by gel electrophoresis. Alkali treatment of the gel denatures the DNA, which is then "blotted" onto the filter (nylon or nitrocellulose). A labeled probe (RNA or DNA) is then hybridized to complementary fragments on the filter. In a northern blot, RNA is separated in the gel and "probed" with the labeled DNA.
The first commercial production of what human enzyme led to the explosion of the biotechnology industry? Polynucleotide Phosphorylase Inuslin Amylase Lactose Dehydrogenase
Inuslin
What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?
Isolated from bacteria, restriction endonucleases restrict or prevent viral infection by degrading the invading nucleic acid of the virus
The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number? It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing. There are more introns than exons. There are more exons than introns. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes. Every gene can be read in both directions, and each gene can have inversions and translocations.
It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing.
Present a general definition for a multigene superfamily.
Multigene superfamilies share DNA sequence homology, and their gene products are functionally related. They are often (but not always) found together in a single location in a chromosome. They are believed to be derived from a common ancestral gene.
A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons. OH, 2', 3' methyl, 2', 3' carboxyl, 5', 3' OH, 2', 5' None of these are correct.
OH, 2', 3'
What is meant by the term pseudogene?
Pseudogenes are nonfunctional versions of genes that resemble other gene sequences but that contain significant nucleotide substitutions, deletions, and duplications that prevent their expression. Pseudogenes are designated by the prefix (psi).
What is recombinant DNA technology? What are the safety issues related to recombinant DNA technology?
Recombinant DNA technology refers to the creation of new combinations of DNA molecules that are not normally found in nature. Safety issues generally center around the creation and release (accidental or intentional) of genetically engineered organisms that are a threat to human health or animals and plants in the environment. Many organisms that are "genetically engineered" carry genes for antibiotic resistance.
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by
Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by Knowing the isoelectric points of the piece in question. Measuring the sizes of the bands on the gel Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest Identifying the molecular weights of the fragments in question None of the above
Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest
Which technique would NOT be used to find a gene for a functional protein in a sequenced region of a genome? Scan the region for ORFs. See if an EST database contains sequences in the region. See if a SNP database contains sequences in the region. Scan the region for promoter sequences. Scan the region for intron splice sites.
See if a SNP database contains sequences in the region.
Some restriction enzymes cleave DNA in such a manner as to produce blunt ends. Most often ligation of blunt end fragments is enhanced by the use of the enzyme terminal deoxynucleotidyl transferase. Why?
Terminal deoxynucleotidyl transferase extends single-stranded ends by the addition of nucleotide tails. If complementary tails are added, the fragments can hybridize and the recombinant molecules can be ligated.
Intron frequency varies considerably among eukaryotes. Provide a general comparison of intron frequencies in yeast and humans. What about intron size?
The entire yeast genome has only about 240 introns, whereas some single genes in humans contain over 100 introns. In general, smaller genomes have smaller intron size in addition to lower intron number.
Describe the organization of the α-globin gene cluster in humans. Roughly how large is this cluster? How many genes are present? Briefly describe these genes
The α-group spans more than 30 kb and contains three genes: zeta and two copies of the alpha gene. In addition, two nonfunctional pseudogenes are in the group. Most of the DNA in this region consists of intergenic spacer DNA.
Why are telomeres and centromeres particularly difficult to sequence?
They consist of highly repetitive DNA, and so strand slippage issues can confuse the determination of a consensus sequence.
What is the purpose of a cDNA library? To produce a library of all genomic DNA of an organism. To produce a library of expressed genes. To replicate the genomic DNA. To produce a library of chloroplast genes.
To produce a library of expressed genes.
Compare the transcriptome of an organism with the proteome. What is described by each? Which one will generally have more macromolecules, and why?
Transcriptome has all RNA transcripts, coding and non coding. Proteome only has the proteins that result from those transcripts. Some genes encode non-coding RNAs that are not translated into proteins.
The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans?
You could generate cDNA libraries and compare the transcribed regions of the genome.
PCR is necessary for efficient replication of cell's DNA in interphase a technique for amplifying DNA sequences in vitro one of the control elements of the cell cycle
a technique
Plasmids are important in biotechnology because they are a vehicle for the insertion of foreign genes into bacteria recognition sites on recombinant DNA strands surfaces for protein synthesis in eukaryotic recombinants surfaces for respiratory processes in bacteria
a vehicle
What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? All produce RNA as a product. All produce RNA as a product. All produce lipid as a product. All produce DNA chains as a product.
all produce DNA
In the context of molecular genetics, reverse translation refers to assembling a DNA sequence from an amino acid sequence. assembling an RNA sequence from a DNA sequence. translating in the 3' to 5' direction. transcribing first, then translating. making an amino acid sequence from a DNA sequence.
assembling a DNA sequence from an amino acid sequence.
Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? DNA polymerase restriction enzymes specific for the target genes DNA ligase Both B and C
b c
Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis. Separate your answer(s) with a comma, and enter only the letter(s) of your choice(s).
b, e
A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that prokaryotes use a different genetic code from that of eukaryotes bacteria cannot remove eukaryotic introns. bacterial RNA polymerase cannot make RNA complementary to mammalian DNA bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA
bacteria cannot remove eukaryotic introns.
For a physical map of a chromosome, distances are measured in units of percent recombination. RFLPs. centiMorgans. base pairs. contigs.
base pairs.
a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens Reference: Ref 19-1 expression vector Enter only the letter of your choice.
c
When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that the two proteins have identical functions. the two proteins have no common origin. the two proteins share a common ancestry. the two proteins have identical tertiary structures.
common ancestry
You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful?
complementary ends
The Human Genome Project, which got under way in 1990, is an international effort to construct a physical map of the 3.3 billion base pairs in the human genome. collect samples of cells from all parts of the world in order to preserve human genetic diversity. collect plant seeds in order to reduce the impact of human activity on plant extinction. clone deleterious genes from humans and study their mode of action. clone beneficial genes from humans for eventual use in gene therapy.
construct a physical map
A bacterial polycistronic transcription unit is one that contains information for one protein product. contains information for more than one protein product. is capped at the 5'end and carries a poly-A tail at the 3'end. is void of start (AUG) and termination (UAA, UGA, UAG) triplets. none of these answers
contains information for more than one protein product.
A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________. chromosome sequence map contig clone
contig
Match each term with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens Reference: Ref 19-1 shuttle vector Enter only the letter of your choice.
e
During gel electrophoresis, __ will migrate more rapidly than __. a. cloning vectors b. ethidium bromide c. large DNA fragments d. DNA size markers e. small DNA fragments Separate your answers with a comma, and enter only the letters of your choices.
e, c
One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that each cosmid replicates nonautomously. lysogenic phages continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones. each vector can take up only a relatively small fraction of the eukaryotic DNA. each ligation product is sequence specific. the host range of the vector is limited.
each vector can take up only a relatively small fraction of the eukaryotic DNA
a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens Reference: Ref 19-1 PCR Enter only the letter of your choice.
f
A BLAST search is done to find similar gene or protein sequences. find the chromosomal location of a sequence. predict the three-dimensional structure of a protein from its amino acid sequence. find restriction sites and SNPs in a sequence. determine the conditions under which a gene is expressed.
find similar gene or protein sequences.
This is the study of "genes in their entirety."
genomics
List two especially useful characteristics of cloning vectors. high copy number and antibiotic resistance gene(s) virulence and lysogenicity ability to integrate into the host chromosome and then cause a lytic cycle nonautonomous replication and transposition reverse transcriptase and ligase activities
high copy #, resistance gene
Match each term with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens Reference: Ref 19-1 ß-galactosidase Enter only the letter of your choice.
i
All of the following are characteristics of the genomics revolution EXCEPT_____________ Large scale acquisition of DNA sequences Ability to conduct discovery-based research Enabled reverse genetics approach to genetics research Facilitated collaborative research networks Inability to understand single genes
inability to understand single genes
One major difference between prokaryotic and eukaryotic genes is that eukaryotic genes can contain internal sequences, called ________, that get removed in the mature message.
introns
Which of the below are not steps in the production of genome sequence maps: Read the sequence of individual piece of the genome. Isolate whole chromosomes. When sequences are obtained, assemble and organize the sequences in order. Identify molecular markers on specific chromosomes. All of these are steps you would use.
isolate whole chromosome
What advantages does pUC18 have in terms of recombinant DNA technology? List 3 such advantages.
large number of copies, lot of restriction enzyme sites, gender has a selectable marker
Compared with prokaryotic chromosomes, eukaryotic chromosomes are large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in polycistronic transcription units without introns. small, mainly organized in polycistronic transcription units without introns. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.
last one
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? palindrome consensus sequence multiple cloning site β-galactosidase
mcs
Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression).
microarray
A _______________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene.
multigene
A number of generalizations can be made about the organization of protein-coding genes in bacterial chromosomes. First, the gene density is very high, averaging about ________.
one gene per killable pair
In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinate control that are transcribed as a single unit. Such contiguous gene families are called transcriptomes proteomes contigs operons pseudogenes
operons
List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each.
origin of replication for propagation in the host; selectable marker like Amp resistance; polylinker or unique restriction enzyme sites to facilitate cloning
Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such words? lysogenic prototrophic palindromic conjugation insertion
palindrome
A map of the distribution of cloned genomic DNA from genomic clone libraries.
physical map
A map of the order, overlap, and orientation of physically isolated pieces of the genome.
physical map
In what way are specific DNA sequences of the template amplified in the polymerase chain reaction? In other words, how does one target the target?
primers
The set of all proteins encoded by the genome is called the _______ . genome transcriptome metabolome proteome pharmacogenome glycome
proteome
A gene construct that indicates when transcription occurs because the protein is easily identified (often GUS or GFP).
reporter gene
Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? DNAse gene cloning hydrogen sulfide reverse transcriptase isolation of stem cells from a lamb embryo and production of a zygotic equivalent
reverse trans
Name the two strategic methods that scientists are using to sequence genomes.
shotgun, clone by clone
Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common? All are alternate forms of the ancestor All require plasmid cloning techniques All are derived from a single ancestor All contain mutations
single ancestor
Over the years, sophisticated plasmid vectors have been developed for use in recombinant DNA technology. Describe the useful features that have been introduced in these vectors.
small size to allow large inserts high copy number large numbers of unique restriction sites (polylinkers) variety of selection schemes (pigmented colonies, antibiotic resistance)
Compared with eukaryotic chromosomes, bacterial chromosomes are large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in polycistronic transcription units without introns. small, with high gene density. large, triple-helix, Z-DNA, organized in monocistronic units with introns.
small, with high gene density.
Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? single-stranded complementary tails blunt ends poly-A sequences 5' cap interference
ss comp tail
What two factors contribute significantly to the wide ranges of genome size among eukaryotes?
the amount of introns and the differences in the number of genes
What is a concise definition of proteomics?
the process of defining the complete set of proteins encoded by a genome
Assume that one conducted a typical cloning experiment using pUC18, transformed an appropriate host bacterial strain (one carrying the lacZ complementing region), and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant pUC18? Explain your answer.
the white colonies because of insertional inactivation of the lacZ component
How are pseudogenes formed?
thought to be formed through either duplication errors or through retrotransposition.
What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?
to determine if vector is present in host cell
What term is used to refer to the process in which DNA can be introduced into host bacterial cells?
transformation
The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. complementation analysis, enhance temperature extremes, enhance epistasis analysis, enhance visual examination, eliminate chemical removal, activate
visual examination, eliminate
