GENETICS TEST 3

Ace your homework & exams now with Quizwiz!

Okazaki fragments are found in all of the following EXCEPT in: A) the leading strand. B) the lagging strand. C) eukaryotic DNA. D) bacterial DNA. E) linear replication models.

A DNA molecule of 50 base pairs contains 15 cytosine bases (C). How many thymine bases will it have? A) 10 B) 15 C) 30 D) 35 E) 60

A bacterial protein is encoded by the following mRNA sequence: 5-AUGGUGCUCAUGCCCTAA-3. The second methionine codon (AUG) in this mRNA sequence will: A) serve as the initiation codon. B) encode N-formylmethionine. C) encode methionine that will eventually be removed. D) encode unformylated methionine. E) be skipped as the translation progresses.

A centromere is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

A drug that destroyed small nucleolar RNA (snoRNA) would inhibit which process? A) RNA splicing of pre-mRNA B) translation C) assembly of the nucleosome D) replication E) transcription

A gene-encoding sequence is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

A high-resolution X-ray diffraction technique was used to obtain detailed secondary structure of a DNA molecule. The characteristics of the DNA showed it was a left-handed helix with a general shape that was longer and narrower than the classic Watson-Crick model of DNA. Which form of DNA was resolved? A) A-DNA B) B-DNA C) Z-DNA D) H-DNA E) single-stranded DNA

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail? A) The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail. B) The poly(A) tail facilitates the attachment of the ribosome to the mRNA. C) The poly(A) tail is important for proper nuclear export of the mRNA. D) The poly(A) tail at the 3 end translates to a long stretch of repeated amino acids. E) Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.

A microbiologist isolated a mutant strain of E. coli that is extremely susceptible to bacteriophage infection, by a wide range of bacteriophages. Which of the following genes might she explore as a possible site of the mutation that results in this phenotype? A) A gene that encodes a small nucleolar RNA B) A gene that encodes a Cas protein C) A gene that encodes a Piwi-interacting RNA D) A gene that encodes either a miRNA or a siRNA E) A gene that encodes an immune RNA

A normal chromosome in a higher eukaryotic species would NOT be expected to contain: A) one centromere. B) one copy of telomere. C) two copies of histone 2A per nucleosome. D) satellite DNA. E) tandem repeat sequences.

ABCE

A plant has green leaves with multiple yellow spots. When used as an egg donor in a cross with a normal plant that has all green leaves, some of the progeny have green and yellow leaves and some have all green leaves. When used as the pollen donor in a cross with a normal plant, all the progeny have all green leaves. Which of the following statements explain(s) the result of this cross? (Select all that apply.) A) The original plant with green leaves with multiple yellow spots is likely heteroplasmic for a mutation in the chloroplast genome. B) The yellow spots are cells that, by replicative segregation, have received only mutant chloroplast genomes. C) The plants with yellow leaves that originate from the plant with yellow spots as the egg donor received the mutant chloroplast maternally. D) Presumably, eggs that are heteroplasmic for mutant chloroplasts will not produce viable plants. E) When the plant is the pollen donor, the plant with nonmutant chloroplast DNA will contribute the chloroplasts, and all progeny will have all green leaves.

A ribosomal RNA gene is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

A scientist is studying a gene known as the ABC gene in bacteria. Into a bacterial cell, she inserts an miRNA that is complementary to a portion of the ABC mRNA found in the cell. What result would you predict? A) There will be an increase in the amount of ABC protein made. B) There will be a decrease in the amount of ABC protein made. C) There will be an increase in the transcription of the ABC gene. D) There will be a decrease in the transcription of the ABC gene. E) No change will result from the insertion of the miRNA.

A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic cell, she inserts an miRNA that is complementary to a portion of the XYZ mRNA found in the cell. What result would you predict? A) There will be an increase in the amount of XYZ protein made. B) There will be a decrease in the amount of XYZ protein made. C) There will be an increase in the transcription of the XYZ gene. D) There will be a decrease in the transcription of the XYZ gene. E) No change will result from the insertion of the miRNA.

A tRNA anticodon is 5 GCU 3. What amino acid does it carry? A) ala B) arg C) ser D) pro E) thr

A tRNA gene is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

A telomere is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

A yeast strain was exposed to chemical mutagen. As expected, exposure to mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. Which of the following answers would BEST explain this apparent discrepancy? A) The DNA sequence change occurred in a synonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. B) If the protein sequence was not affected, no lethal phenotype manifested. C) The DNA sequence change resulted in an amino acid change, but that amino acid change had no negative effect on protein function (i.e., was a neutral change). D) The DNA sequence change occurred in a nonsynonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. E) All mutations that cause a change in DNA sequence result in a lethal phenotype.

After the peptide bond forms, what will happen next? A) tRNA A will be carrying the polypeptide and it will shift to the P site. B) tRNA A will be carrying the polypeptide and it will shift to the A site. C) tRNA B will be carrying the polypeptide and it will shift to the P site. D) tRNA B will be carrying the polypeptide and it will shift to the A site. E) Ribosome disassembles to release the tRNAs and to allow new tRNA to enter.

All DNA polymerases synthesize new DNA by adding nucleotides to the _____ of the growing DNA chain. A) 3OH B) 5OH C) 3 phosphate D) 5 phosphate E) nitrogenous base

Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation or alteration of histone proteins is referred to as _____ changes. A) genetic B) mutational C) sensitivity D) epigenetic

An Alu sequence is an example of which type of DNA sequence in eukaryotes? A) moderately repetitive DNA B) highly repetitive DNA C) short interspersed elements D) long interspersed elements E) unique-sequence DNA

An in vitro transcription system that contains a bacterial gene does not initiate transcription. What is one possible problem? A) Histones that were on the DNA when it was isolated from E. coli are blocking access to the template. B) There is a mutation in the inverted repeat sequence that prevents a hairpin secondary structure from forming. C) There is a mutation at -10, where a promoter consensus sequence is located. D) Rho factor has not been added. E) TATA-binding protein (TBP) has not been added.

An in vitro transcription system that contains a bacterial gene initiates transcription from random points on the DNA. Which of the following proteins MOST likely is missing from the reaction? A) sigma factor B) rho factor C) RNA polymerase II D) TATA-binding protein (TBP) E) TFIID

An in vitro transcription system transcribes a bacterial gene but terminates inefficiently. What is one possible problem? A) There is a mutation in the -10 consensus sequence, which is required for efficient termination. B) Rho factor has not been added. C) Sigma factor has not been added. D) A hairpin secondary structure has formed at the 3 end of the mRNA, interfering with termination. E) Histones were added prematurely and interfered with termination.

An mRNA has the codon 5 UAC 3. What tRNA anticodon will bind to it? A) 5 AUG 3 B) 5 GUA 3 C) 5ATC3 D) 5 CTA 3 E) 5 CAU 3

An mRNA has the stop codon 5 UAA 3. What tRNA anticodon will bind to it? A) 5ATT3 B) 5 AUC 3' C) 5' ACU 3 D) 5 UUA 3 E) none

Anticodons are found in _____ molecules. A) mRNA B) tRNA C) rRNA D) snRNA E) miRNA

Assuming that the origins are approximately equally distributed across the chromosomes, what is the average number of origins per human chromosome? A) 4783 B) 19,130 C) 4.6 × 106 D) 1.21 × 109 E) 2.9 × 1010

Assuming there are no heteroplasmic individuals but that people from different families have different DNA, how many different mitochondrial DNAs are there in the pedigree below? A) 2 B) 4 C) 5 D) 6 E) 7

Based on the pedigree below, which of the following statements correctly interpreted the pedigree with respect to X-linked dominant, X-linked recessive, Y-linked, mitochondrial, autosomal recessive, and autosomal dominant inheritance? (Select all that apply.) A) The phenotype presented is X-linked dominant because II-3 has the same phenotype as I-1. B) The phenotype presented is X-linked recessive because III-3 and III-4 do not have the same phenotype as II-5. C) The phenotype cannot be Y-linked because II-2 doesn't have the same phenotype as I-1. D) The phenotype could be autosomal recessive as III-3 and III-4 don't have the same phenotype as II-5. E) The phenotype could be autosomal dominant if II-5 and II-6 are heterozygotes, and III-3 and III-4 are homozygous recessive.

Below is a list of steps in the processing of ribosomal RNAs. Please select the choice that lists the steps in the CORRECT sequential order. 1. Methyl groups added to specific bases and the 2-carbon atom of some ribose sugars 2. Transcription of the rRNA precursors from DNA3. Cleavage of precursor rRNA4. Individual rRNA molecules ready for ribosome assembly 5. Trimming of precursor rRNA A) 3, 1, 2, 5, 4 B) 2, 3, 4, 5, 1 C) 4, 2, 3, 1, 5 D) 1, 3, 5, 4, 1 E) 2, 1, 3, 5, 4

Below is a list of steps of eukaryotic pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Recognition and binding the 3 AAUAAA sequence by specific protein factors 2. Cleavage at the poly(A) site3. Addition of the 5 cap4. Export to the cytoplasm 5. Addition of the poly(A) tail A) 3, 1, 2, 5, 4 B) 2, 3, 4, 5, 1 C) 4, 2, 3, 1, 5 D) 1, 3, 5, 4, 1 E) 5, 4, 1, 3, 2

Below is a list of steps of intron removal and splicing during pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Attachment of snRNP U1 to the 5 splice site2. Transcription of the DNA template into the pre-mRNA molecule 3. Release of lariat structure4. Splicing together of exons5. Transesterification reaction at the branch point adenine A) 1, 2, 3, 4, 5 B) 4, 1, 3, 5, 2 C) 2, 1, 5, 3, 4 D) 3, 5, 1, 2, 4 E) 5, 3, 4, 1, 2

Both strands of a DNA molecule are used as a template when which of the following molecules is synthesized? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Choose the BEST consensus sequence for the following set of nucleotide sequences. TAAGACGCCATGA AAAGTCGCAATCA AAAGTTCCGTTCA AGAGTTGCTATCA AGAGTTGCAA TCA A) Y ACGTRGCA TG/CA B) AYTRTRGCATGA C) AAAGTNGANTCA D) ARAGTYGCNTCA E) ACTNCGYTGARA

Chromosomal puffs observed on polytene chromosomes indicate the region that is most likely _____. (Select all that apply.) A) transcriptionally inactive B) transcriptionally active C) DNAse I sensitive D) DNAse I insensitive

Codons that specify the same amino acid are said to be: A) wobbly. B) isoaccepting. C) hypothetical. D) synonymous. E) anonymous.

Copies of a gene that arose by gene duplication are part of a gene: A) complex. B) family.C) tandemoplex. D) structure.E) chromosome.

Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene comprises approximately 190,000 nucleotides and produces an mRNA of 6128 nucleotides in length. What is a possible explanation for the difference in the sizes of the gene and the mRNA? A) The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA production. B) The CFTR gene likely has many introns that are excised prior to translation of the CFTR protein. C) The 5ʹ cap and the poly(A) tail get removed prior to translation of the CFTR protein. D) Methylation of the 5ʹ cap silences portions of the gene, preventing those regions from being transcribed into mRNA. E) The mutation that causes cystic fibrosis creates a new terminator sequence, resulting in a shorter mRNA.

DNA can be isolated from cells, and the different types of DNA from the cell can be separated by density gradient centrifugation. The following figures show the density gradient centrifugation profiles for DNA isolated from four different cell types: plant, animal, wild-type yeast with a plasmid, and petite yeast. The large peak to the left in all the figures is: A) mitochondrial DNA. B) genomic DNA. C) chloroplast DNA. D) plasmids.

DNA can be isolated from cells, and the different types of DNA from the cell can be separated by density gradient centrifugation. The following figures show the density gradient centrifugation profiles for DNA isolated from four different cell types: plant, animal, wild-type yeast with a plasmid, and petite yeast. The peak farthest to the right in Figure 1 is: A) plasmids. B) mitochondrial DNA. C) genomic DNA. D) chloroplast DNA.

DNA can be isolated from cells, and the different types of DNA from the cell can be separated by density gradient centrifugation. The following figures show the density gradient centrifugation profiles for DNA isolated from four different cell types: plant, animal, wild-type yeast with a plasmid, and petite yeast. Which figure has the DNA profile for the petite yeast? A) 1 B) 2 C) 3 D) 4

DNA can be isolated from cells, and the different types of DNA from the cell can be separated by density gradient centrifugation. The following figures show the density gradient centrifugation profiles for DNA isolated from four different cell types: plant, animal, wild-type yeast with a plasmid, and petite yeast. Which figure has the DNA profile for the plant cell? A) 1 B) 2 C) 3 D) 4

DNA can be isolated from cells, and the different types of DNA from the cell can be separated by density gradient centrifugation. The following figures show the density gradient centrifugation profiles for DNA isolated from four different cell types: plant, animal, wild-type yeast with a plasmid, and petite yeast. Which figure has the DNA profile that would most closely match DNA from a human cell?A) 1B) 2 C) 3 D) 4

DNA polymerase I and DNA polymerase III both have _____ activity but only DNA polymerase I has _____ activity. A) 5 3 exonuclease; 3 5 exonuclease B) 5 3 polymerase; 3 5 polymerase C) 3 5 polymerase; 5 3 polymerase D) 3 5 exonuclease; 5 3 exonuclease E) 5 3 polymerase; 3 5 exonuclease

DNA polymerases require all of the following for DNA replication EXCEPT: A) a DNA template. B) a primer. C) free 3 OH. D) 3 to 5 polymerase activity. E) dNTPs.

DNA primase requires a _____ template and _____ nucleotides to initiate primer synthesis. A) DNA; DNA B) RNA; RNA C) DNA; RNA D) RNA; DNA E) leading strand; DNA

DNA synthesis during replication is initiated from: A) a free 5 OH. B) DNA primers. C) RNA primers. D) telomerase. E) DNA polymerase I.

During DNA replication, the synthesis of the new strand requires the addition of a new dNTP to the 3ʹ-OH group of the growing nucleotide strand by DNA polymerase. Which of the following provides the energy needed for this step? A) the template strand B) the energy of pentose sugar C) 5ʹ end of the growing DNA D) cleavage of two phosphate groups from the dNTP E) The reaction does not require an energy source.

During elongation, an incoming charged tRNA enters at the _____ site of the ribosome. A) peptidyl (P) B) aminoacyl (A) C) exit (E) D) Shine-Dalgarno E) Kozak

During initiation of translation: A) the initiator tRNAmet binds to the A site of a ribosome. B) specific rRNA base pairs with a sequence in mRNA to position a ribosome at the start codon. C) IF-3 must be recruited to the 30S ribosome in order for the 70S initiation complex to assemble. D) there is no energy expenditure as the tRNA binding to mRNA is via complementary base pairing. E) both 70S and 30S ribosome subunits must simultaneously recognize an mRNA to bind.

During initiation, the _____ subunit is the first part of the ribosome to associate with the mRNA. A) small B) large C) intermediary D) secondary E) tertiary

During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an mRNA in step-by-step manner. Which of the following reasons prevents the 5 capping process, involving methylation, from occurring on a DNA strand? A) lack of an OH group on the 2 carbon of the deoxyribose B) lack of an OH group on the 3 carbon of the deoxyribose C) lack of a uracil nitrogenous base on the DNA strand D) lack of GTP hydrolysis associated with DNA transcription E) lack of a H on the 4 carbon of the deoxyribose

During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an mRNA. Arrange the following steps of the capping process in the CORRECT order. 1. Addition of a guanine nucleotide via a 5-5 bond2. Removal of a phosphate from a ribonucleotide triphosphate at the 5 head of the pre-mRNA3. Methylation at the 2 position of the sugar in the second and the third nucleotides 4. Methylation at position 7 of the terminal guanine base A) 1, 2, 3, 4 B) 2, 4, 1, 3 C) 4, 1, 3, 2 D) 2, 1, 4, 3 E) 3, 2, 4, 1

ABC

E. coli strains that have both the original ade1- mutant allele shown above and a mutant allele for a gene that encodes a lysine tRNA are able to make some normal ade1 enzyme. The mutant lysine tRNA allele makes a tRNA that has one base that is different from the wild-type tRNA. Which of the following statements would help explain how the lysine tRNA mutation allows synthesis of the normal ade1 enzyme? (Select all that apply.) A) The mutation in the lysine tRNA gene changes the sequence of the anticodon. B) The mutant tRNA pairs with UAG, a stop codon. C) When the mRNA from the ade1- allele is being translated, a mutant tRNAlysine could incorporate a lysine into the protein, bypassing the mutant UAG. D) The ade1- mutant would always result in a stop signal regardless of the mutant tRNA. E) The mutant tRNA would always match with UAG and prevent normal termination of the polypeptide chain.

E. coli strains that have both the original ade1- mutant allele shown above and a mutant allele for a gene that encodes a lysine tRNA are able to make some normal ade1 enzyme. The mutant lysine tRNA allele makes a tRNA that has one base that is different from the wild-type tRNA. Why might the mutant lysine tRNA allele affect overall cell growth? A) The mutant tRNAlysine will occasionally cause translation to continue beyond the normal stop codon on mRNAs that normally use UAG as a stop codon. B) The premature stop codon from the ade1- allele will always cause shortened proteins. C) The mutant tRNA will prevent the translational machinery from recognizing the normal stop codon on the mRNA and so will result in incorrect proteins. D) The mutant tRNAlysine will recognize the stop codon on the mutant ade1- allele and cause the protein to be terminated. E) The mutant tRNAlysine will incorporate a lysine at every UAG stop codon.

Explain the effect on DNA replication of mutations that destroy each of the following activities in DNA polymerase. Also, for each kind of mutation, how might you detect the effect in an in vitro replication reaction? 5 to 3 polymerase 5 to 3 exonuclease 3 to 5 exonuclease

For any sequence of nucleotides, how many reading frames are possible? A) 1 B) 2 C) 3 D) 5 E) 10

For which of the following is the "end-replication problem" relevant? A) circular DNA B) linear chromosomes C) the centromere region of a chromosome D) rolling-circle model of replication E) theta model of replication

Given the figure below, within which of the following would the 5ʹ untranslated region be located? A) promoter B) exon 1 C) exon 4 D) intron 1 E) A 5ʹ untranslated region would not be present in this figure.

Given the figure below, within which of the following would the Shine-Dalgarno sequence be located? A) promoter B) exon 1 C) exon 4 D) intron 1 E) A 5ʹ untranslated region would not be present in this figure.

Guide RNAs are needed in: A) transcription. B) translation. C) RNA interference. D) RNA editing. E) RNA splicing.

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the HIGHEST temperature? A) 10% AT and 90% GC B) 30% AT and 70% GC C) 50% AT and 50% GC D) 70% AT and 30% GC E) 90% AT and 10% GC

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the LOWEST temperature? A) 10% AT and 90% GC B) 30% AT and 70% GC C) 50% AT and 50% GC D) 70% AT and 30% GC E) 90% AT and 10% GC

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral DNA? A) 14C B) 15N C) 18O D) 32P E) 35S

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral protein? A) 14C B) 15N C) 18O D) 32P E) 35S

How did Albert Kossel contribute to our understanding of DNA? A) used X-ray diffraction to examine the structure of DNA B) determined that DNA contains four different nitrogenous bases C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA D) found that the phosphorus-containing components are the genetic material of phages E) discovered "the transforming principle" that could genetically alter bacteria

How did Alfred Hershey and Martha Chase contribute to our understanding of DNA? A) used X-ray diffraction to examine the structure of DNA B) determined that DNA contains four different nitrogenous bases C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA D) found that the phosphorus-containing components are the genetic material of phages E) discovered "the transforming principle" that could genetically alter bacteria

How did Avery, MacLeod, and McCarty contribute to our understanding of DNA? A) used X-ray diffraction to examine the structure of DNA B) determined that DNA contains four different nitrogenous bases C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA D) found that the phosphorus-containing components are the genetic material of phages E) discovered "the transforming principle" that could genetically alter bacteria

How did Chargaff's rules contribute to Watson and Crick's elucidation of the structure of DNA? A) The rules suggested an equal concentration of sugars and phosphates. B) The rules suggested the amounts of all four bases were equal. C) The rules suggested the base-pairing combinations of adenine with thymine and guanine with cytosine. D) The rules suggested that each base corresponds to an amino acid.

How did Fred Griffith contribute to our understanding of DNA? A) used X-ray diffraction to examine the structure of DNA B) determined that DNA contains four different nitrogenous bases C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA D) found that the phosphorus-containing components are the genetic material of phages E) discovered "the transforming principle" that could genetically alter bacteria

How did Rosalind Franklin contribute to our understanding of DNA? A) used X-ray diffraction to show that the structure of DNA is helical B) determined that DNA contains four different nitrogenous bases C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA D) found that the phosphorus-containing components are the genetic material of phages E) used models to show that DNA is a double helix

How does histone acetylation affect chromatin? A) It loosens the chromatin and allows increased transcription. B) It allows DNA to become resistant to damage. C) It helps the histones have a greater affinity for DNA. D) It inhibits DNA replication by making it more difficult to separate the DNA strands. E) It causes the chromatin to become more condensed in preparation for metaphase.

How does the mutation affect the enzyme? A) The protein won't be synthesized and translation will stop at the third codon. B) The protein will not be changed because the mutation did not change the amino acid. C) The protein will be changed because the mutation altered the amino acid. D) The protein will not be changed because the mRNA was not changed.

How does this mutation change the mRNA? A) The third codon in the mRNA is changed from AAG (lysine) to UAG (stop). B) The third codon in the mRNA is changed from GCA (alanine) to GCU (alanine). C) The third codon in the mRNA is changed from CAA (glutamine) to CUA (leucine). D) The third codon in the mRNA is changed from CGU (arginine) to CGA (arginine). E) There is no change in the mRNA.

How many base pairs per turn of the helix would MOST likely correspond to a positively supercoiled DNA molecule?A) 0B) 5 C) 10 D) 15 E) 100

How many base pairs per turn of the helix would MOST likely correspond to a relaxed DNA molecule?A) 0B) 5 C) 10 D) 15 E) 100

How many complete rotations would MOST likely correspond to a negatively supercoiled DNA molecule that is 100 bp in length?A) 0B) 5 C) 10 D) 15 E) 100

How many complete rotations would MOST likely correspond to a positively supercoiled DNA molecule that is 100 bp in length? A) 0 B) 5 C) 10 D) 15 E) 100

How many complete rotations would MOST likely correspond to a relaxed DNA molecule that is 100 bp in length?A) 0B) 5 C) 10 D) 15 E) 100

How many different types of histones are found in the nucleosome that packages mitochondrial DNA? A) zero B) one C) two D) three E) four

How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases? A)45 B) 100 C) 115 D) 135 E) 150

How many introns are present on a gene that consists of four exons? A) two B) three C) four D) five E) The number cannot be determined from the information provided.

How many membranes separate the mitochondrial matrix from the cytoplasm? A) zero B) one C) two D) three E) four

How many of each of the following does this DNA molecule have? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC A. 3 hydroxyls B. hydrogen bonds C. purines D. ribose sugars

If a DNA molecule contains 27% cytosine bases (C), then what percentage of thymine bases will it have? A) 10% B) 27% C) 46% D) 23% E) 52%

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)? A) 30% B) 60% C) 35% D) 70% E) 15%

ACE

If a bacterial chromosome were inserted into a eukaryotic cell, would it be stable and segregate like eukaryotic chromosomes do during mitosis and meiosis? (Select all that apply.) A) It would not be stable due to the lack of a eukaryotic-specific origin of replication; hence, it could not replicate properly in a eukaryotic cell. B) It would be generally stable because the chemical nature of DNA is the same regardless of the cell type. C) Due to the lack of centromeres on prokaryotic chromosomes, the chromosomes will not segregate normally during cell division. D) The prokaryotic chromosome can be induced to be stabilized by cleavage of circular form to mimic linear eukaryotic chromosome. E) The bacterial chromosome would be lost and eventually degraded.

If a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I is produced, what will be the MOST likely consequence of this mutation? A) The DNA strands would contain pieces of RNA. B) The DNA would not exist in a supercoiled state. C) There would be no DNA replication on the leading or lagging strands. D) There would be no RNA primers laid down. E) The DNA will not be able to unwind to initiate replication.

If a splice site were mutated so that splicing did not take place, what would be the effect on the amino acid sequence? A) It would be shorter than normal. B) It would be longer than normal. C) It would be the same length but would encode a different protein. D) It would be unable to fold into its correct structure. E) It depends on the mutant mRNA sequence.

If ribonucleotides were depleted from a cell during S phase, how would DNA synthesis be affected? (Ignore energetic considerations.) A) There would be no effect because ribonucleotides are used in RNA synthesis, not DNA synthesis. B) DNA synthesis would continue but at a slower rate. C) There would only be an effect during M phase, not in S phase. D) DNA synthesis would not be affected because ribonucleotides are only used during the process of transcription. E) Replication would cease because ribonucleotides are required to initiate DNA synthesis.

If the DNA strand 5ʹ-GTACCGTC-3ʹ were used as a template, what would be the sequence of the transcribed RNA? A) 5-GUACCGUC-3 B) 5-GACGGTAC-3 C) 5-CAUGGCAG-3 D) 5-GACGGUAC-3 E) 5-GUCGGUAC-3

If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5 to 3, is:A) AUAGGCAGU.B) UCCCAGGUG. C) CACCUGGGA. D) AGGGUCCAC. E) GACAUUAGA.

If the bottom strand of the DNA is the template, the tRNA anticodon sequence for the first RNA codon, left to right or 5 to 3, is: A) GGA. B) AUG. C) CAC. D) UCC. E) CCU.

If the bottom strand of the DNA serves as the template, the amino acid sequence of the protein produced from the RNA would be: A) met-leu-ser. B) arg-val-his. C) thr-ile-phe. D) pro-gly-trp. E) lys-val-his.

If the sequence of an RNA molecule is 5ʹ-GGCAUCGACG-3ʹ, what is the sequence of the nontemplate strand of DNA? A) 5ʹ-GGCATCGACG-3ʹ B) 3ʹ-GGCATCGACG-5ʹ C) 5ʹ-CCGTAGCTGC-3ʹ D) 3ʹ-CCGTAGCTGC-5ʹ E) 3ʹ-CGTCGA TGCC-5ʹ

If the sequence of one strand of DNA is 5-GCTAGCGTCG-3, what is the sequence of the complementary strand? A) 3-GCTAGCGTCG-5 B) 5-GCTGCGATCG-3 C) 3-CGA TCGCAGC-5 D) 5-CGA TCGCAGC-3 E) 5-CGAUCGCAGC-3

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT? A) Colinearity means that the linear nucleotide sequence of a given gene corresponds directly to the linear amino acid sequence in the corresponding polypeptide. B) The number of nucleotides in a gene should be precisely proportional to the number of amino acids present in the corresponding polypeptide. C) Colinearity generally holds true for the coding regions of prokaryotic viral genes. D) The vast majority of eukaryotic genes follow the concept of colinearity. E) The exception to colinearity between genes and polypeptides is the presence of untranslated sequences (UTRs).

In a transcription reaction, two phosphate groups are cleaved from the incoming: A) deoxyribonucleoside diphosphate. B) deoxyribonucleoside triphosphate. C) ribonucleoside diphosphate. D) ribonucleoside triphosphate. E) ribozyme.

In eukaryotes, tRNAs are transcribed in: A) the nucleus and function in the nucleus B) the nucleus but function in the cytoplasm C) the cytoplasm and function in the cytoplasm D) both the nucleus and the cytoplasm and function in the cytoplasm E) the cytoplasm and function in the nucleus

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins? A) RNA polymerase I B) RNA polymerase II C) RNA polymerase III D) RNA polymerase IV E) RNA polymerase V

In prokaryotes, a group of genes that are usually transcribed following a specific stimulus is organized as an "operon" under a single shared promoter (Chapter 16; see the figure below). The result of the transcription of the genes in the presence of a stimulus would generate a: A) crRNA. B) miRNA. C) polycistronic mRNA. D) rRNA. E) siRNA.

In prokaryotes, rho-independent transcription termination depends on a secondary structure formed in: A) the RNA polymerase that is transcribing the gene. B) the DNA template. C) the RNA that is being transcribed. D) a protein factor that binds to RNA polymerase. E) a protein factor that binds to the RNA that is being transcribed.

In the Hershey-Chase experiment, proteins and DNA were differentially labeled in order to follow where they were present. The specific labels were: A) 3H for protein and 15N for DNA. B) 35S for protein and 15N for DNA. C) 35S for protein and 32P for DNA. D) 32P for protein and 35S for DNA. E) 15N for protein and 32P for DNA.

In the diagram below, which letter indicates the 5 end of the leading strand? A) A B) B C) C D) D E) C and D

In the following DNA molecule, how many 3 ́ hydoxyls are present? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC A) 4 B) 2 C) 0 D) 24

In the following DNA molecule, how many hydrogen bonds are present? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC A) 24 B) 48 C) 58 D) 0 E) 3

In the following DNA molecule, how many purines are present? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC A) 23 B) 25 C) 48 D) 11

In the following DNA molecule, how many ribose sugars are present? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC A) 48 B) 24 C) 4 D) 2 E) 0

In transcription, to which end of the elongating strand are nucleotides always added? A) 3 B) 5 C) 3 in prokaryotes and 5 in eukaryotes D) It depends on which RNA polymerase is being used. E) It depends on which DNA strand is being used as the template.

In which of the following organisms would transcription be the LEAST similar to archaea? A) E. coli B) yeast C) plants D) mice E) humans

Indicate which of the following statements is FALSE. A) Covalent bonds connect nucleotides in a strand; noncovalent interactions hold strands into a double-stranded structure. B) Uracil is similar to thymine except that uracil lacks a methyl group on the carbon at position 5 on the carbon-nitrogen ring. C) Frederick Griffith demonstrated that a transforming chemical from dead bacteria could change the genetic information of living bacteria. D) Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses. E) The pyrimidine bases in nucleic acids are cytosine, thymine, and uracil.

Indicate which of the following statements is TRUE. A) There are three phosphates between each sugar in a molecule of DNA. B) A-, B-, and Z-form DNA are all right-handed helixes. C) There are three hydrogen bonds between AT pairs. D) Ribose sugars have a hydroxyl on the 2 carbon. E) All organisms contain DNA that is roughly 25% A, 25% T, 25% G, and 25% C.

Mechanisms that exist to detect and deal with errors in mRNA in order to ensure the accurate transfer of genetic information are collectively referred to as: A) mRNA surveillance. B) proofreading function. C) RNA interference. D) alternative processing. E) RNA transition.

Meselson and Stahl showed that DNA is replicated by a: A) conservative system. B) semiconservative system. C) dispersive system. D) semidispersive system. E) conservative system in prokaryotes and dispersive system in eukaryotes.

Mutations in which of the following regions upstream of the RNA coding sequence are LEAST likely to affect the transcription of a gene? A) -10 consensus sequence within the promoter region B) -35 consensus sequence within the promoter region C) the region between -10 and -35 consensus sequences D) the upstream elements at -40 to -60 position E) Any mutation on the upstream of a gene will definitely have deleterious effect on gene transcription.

Mutations occurred in one of the inverted repeat sequences within the rho-independent terminator sequence of a bacterium. What would likely be the consequence of this mutation? (Select all that apply.) A) The transcription may end prematurely. B) The transcription may not be initiated at all. C) The transcription may be delayed. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may not terminate and result in much longer RNA.

Over time, DNA replaced RNA as the primary carrier of genetic information, and the chemical stability of DNA is believed to be the key reason for this. Which attribute of DNA is the reason behind its chemical stability? A) DNA lacks a free hydroxyl group on the 2-carbon atom of its sugar. B) Unlike RNA, DNA is usually double stranded. C) DNA does not usually form hairpin loops. D) One of the two pyrimidines found in DNA does not involve uracil. E) DNA contains thymines, which make it more chemically stable.

Paternal transmission of mitochondria is common in which group? A) humans B) mice C) most gymnosperms D) most flowering plants E) insects

Pea plants produce both pollen and eggs. A pea plant inherits a mutation for cytoplasmic male sterility. How will this affect the plant and/or its progeny? A) The plant will be able to reproduce only by self-fertilization. B) The plant will be able to reproduce only by cross-fertilization. C) The plant will be unable to produce progeny. D) The plant will produce progeny, but the progeny will not be able to reproduce.

Process 2, illustrated above, represents: A) replication. B) transcription. C) translation. D) RNA processing. E) RNA interference.

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start. A) +1 B) -1 C) -10 D) -25 E) -35

CDE

Refer to the schematic below. Which statement(s) describe(s) mistakes in this DNA structure? (Select all that apply.) A) In this drawing of two deoxyribonucleotides in a phosphodiester bond, the 2-OH group is present. B) In this drawing of two deoxyribonucleotides in a phosphodiester bond, the phosphate of the top nucleotide has enough O atoms. C) In this drawing of two deoxyribonucleotides in a phosphodiester bond, the phosphate groups should have a negative charge. D) In this drawing of two deoxyribonucleotides in a phosphodiester bond, 5 Cs are not shown. E) In this drawing of two deoxyribonucleotides in a phosphodiester bond, there should be a double bond in each phosphate group. F) In this drawing of two deoxyribonucleotides in a phosphodiester bond, the number of O atoms in the bottom phosphate is correct.

Scientists once believed that each gene can encode a single polypeptide. We now know that _____ and _____ allow a single gene to encode more than one polypeptide. A) transcription; translation B) polyadenylation; RNA transport C) DNA methylation; chromatin condensation D) alternative processing; RNA editing E) gene silencing; RNA interference

Suppose Meselson and Stahl had obtained the following results in their experiment. These results would be consistent with which model of replication? A) conservative replication only B) semiconservative and conservative replication C) semiconservative replication only D) dispersive replication only E) semiconservative and dispersive replication

Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ cap. What would be an expected result? A) Transcription would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. B) Translation would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. C) Transcription would not occur as the transcription factors would not be able to bind to the promoter. D) Translation would not occur as the ribosome would not be able to bind to the mRNA. E) Replication would not occur as DNA polymerase would not be able to bind to the DNA at the origin of replication.

Suppose an organism ingests a drug that disassembles its spliceosomes, rendering them nonfunctional. Which of the following would be seen MOST immediately in this organism? A) All translation would stop. B) tRNA bases would no longer be modified into rare bases. C) Introns would not be removed from the pre-mRNA. D) mRNA would not be able to bind the 5ʹ cap. E) rRNA would no longer be appropriately processed.

Telomerase activity is MOST likely to be found in which cells in humans? A) red blood cells B) muscle cells C) neurons D) germ line E) any type of somatic cell

Telomerase uses _____ to synthesize new DNA. A) exonuclease activity B) a licensing factor C) strand invasion D) a DNA template E) an RNA template

Telomeres exist to help with the _____ of the ends of eukaryotic chromosomes. A) transcription B) replication C) metabolism D) destabilization E) translation

The 5 and 3 untranslated regions (UTRs) of processed mRNA molecules are derived from: A) exons. B) introns. C) promoters. D) terminators. E) the protein-coding region.

The 5 cap on an mRNA is important for all the processes listed below except for the _____ of an mRNA molecule. A) transcription B) intron removal C) stability D) initiation of translation E) ribosomal interaction

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation? A) The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly. B) The 5ʹ cap could recruit proteins that would help to assemble the ribosomes. C) The 5ʹ cap could assist in the identification of stop codons within the mRNA. D) The 5ʹ cap could serve as a marker for the ribosome to locate promoters. E) The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to the DNA.

The DNA replication enzyme that most closely resembles RNA polymerase is: A) DNA polymerase I. B) DNA polymerase III. C) primase. D) telomerase. E) helicase.

The Holliday model describes which of the following processes? A) semiconservative replication B) homologous recombination C) end replication D) RNA primer synthesis E) rolling-circle replication

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? A) It blocks access of RNA polymerase to the promoter until removed by general transcription factors. B) It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. C) It modifies histones so that nucleosomes can be removed from DNA for transcription. D) It bends and partly unwinds DNA at a promoter. E) It creates a phosphodiester bond between the nucleotides.

The _____ membrane of the chloroplast bears the enzymes and pigments required for photophosphorylation. A) outer B) middle C) thylakoid D) plasma E) double

The _____ theory states that the ancestors of mitochondria and chloroplasts were free-living bacteria. A) phylogenetic B) endosymbiotic C) cell D) cytoplasmic inheritance E) old world

The agouti locus helps determine coat color in mice, and this phenotype can vary from light to dark between genetically identical individuals. You have discovered a drug that reduces the variation in the agouti phenotype. What is a likely explanation for this drug's mechanism of action? A) It inhibits DNA polymerases. B) It inhibits DNA methyl transferases. C) It activates shelterin proteins. D) It activates mitochondrial transcription. E) It causes DNA damage.

The amino acid sequence of a polypeptide is referred to as the _____ sequence of the polypeptide. A) primary B) secondary C) tertiaryD) quaternary

The bonds that connect nucleotides in a single strand are called _____ bonds. A) phosphodiester B) peptide C) ionic D) hydrogen E) glycosidic

The calcitonin gene can encode either the hormone calcitonin or a protein called calcitonin-gene-related peptide depending on which 3 cleavage site is used. In the thyroid gland, cleavage and polyadenylation occur after the fourth exon leading to calcitonin production. However, in the brain, the exact same transcript is cleaved after the sixth exon yielding calcitonin-gene-related peptide. This is an example of: A) multiple capping. B) alternative RNA processing. C) polyadenylation. D) environmental influence. E) mutation.

The classic experiment that examined DNAse I sensitivity of chicken embryonic DNA from different tissues and at different developmental stages shows that: (Select all that apply.) A) the chromatin structure changes in the course of development. B) the gene expression pattern changes during development. C) DNAse I sensitivity comes from sporadic mutations occurred during development. D) DNAse I sensitivity only occurs in chicken but in no other organisms.

The concept that genetic information passes from DNA to RNA to protein is called the: A) central dogma. B) nitrogenous base. C) transforming principle. D) polynucleotide strand. E) reverse transcription.

The diagram shown below is one half of a replication bubble. As the DNA template strands unwind towards the right, new strands of DNA get synthesized. Which of the following represents a lagging strand? A) A B) B C) C D) D E) There is no lagging strand in this diagram.

The following diagram represents a transcription unit. What would likely happen to transcription of this transcription unit if a certain consensus sequence within region A is removed via deletion? A) The mutation in region A would result in truncated RNA transcript that is shorter than expected RNA. B) The mutation in region A does not affect the transcription as the transcript is copied only from regions B and C. C) The transcript may get copied in reverse direction as the orientation of region A is important for the direction of the transcription. D) The transcript may not be produced as the consensus sequence within region A may be important for the initiation of the transcription. E) The transcription occurs normally as there are other consensus sequences that would compensate for the loss of one.

The following diagram represents a transcription unit. Which region(s), A, B, and/or C, would be transcribed into an RNA transcript? (Select all that apply.) A) A B) B C) C

The following diagram represents the transcription unit and corresponding RNA transcripts as "Christmas-tree-like" structures captured in the electron micrograph. Which of the following statements CORRECTLY describes the orientation of the DNA and RNA transcript? (Select all that apply.) A) A represents the 5ʹ end while B represents the 3ʹ end of the DNA template undergoing transcription. B) A represents the 3ʹ end while B represents the 5ʹ end of the DNA template undergoing transcription. C) C represents the 5ʹ end while D represents the 3ʹ end of the RNA transcript. D) C represents the 3ʹ end while D represents the 5ʹ end of the RNA transcript. E) The specific orientation of the DNA template and RNA transcript cannot be determined based on the given information.`

The following diagram represents the transcription unit and corresponding RNA transcripts as "Christmas-tree-like" structures captured in the electron micrograph. Which of the following statements CORRECTLY describes the reason as to why the transcription unit looks like a "Christmas tree" with different length of tree branches along the DNA "tree trunk"? A) Depending on where the transcription begins on the DNA template, different lengths of transcripts get generated. B) Each position on the DNA dictates the specific length of the RNA transcript generated from that particular position. C) The transcript randomly grows from the DNA without any particular reason. D) A single DNA can be transcribed many times continuously, and the RNA transcript gets longer as the transcription apparatus moves down the DNA. E) There is no known reason for the transcription unit to assume the "Christmas-tree-like" shape.

The following table shows Chargaff's data that demonstrate base composition of DNA from different biological sources. Which of the following is NOT a general conclusion that is supported by these data? A) DNA consists of a series of four-nucleotide units, each containing all four bases—ATGC—in a fixed sequence. B) The amount of adenine is always equal to the amount of thymine. C) The amount of guanine is always equal to the amount of cytosine. D) Although the ratio of A/T and G/C is the constant, the relative amount of any particular base varies between species. E) (A+G)/(T+C)=1

The function of aminoacyl-tRNA synthetases is to: A) transcribe tRNA genes. B) match tRNA anticodons and mRNA codons at the ribosome. C) attach appropriate amino acids to corresponding tRNAs. D) form the peptide bond between amino acids at the ribosome. E) synthesize and transport amino acids to the ribosomes.

The genetic code is NOT universal for: A) prokaryotes, which use a different genetic code than eukaryotes. B) a few mitochondrial genes, which substitute one sense codon for another. C) viruses, which use an entirely different genetic code. D) archaebacteria, which have their own genetic code. E) animal species whose cells are more advanced and complex.

The genetic code is said to be "degenerate" because: A) there are more codons than amino acids. B) there are more amino acids than codons. C) different organisms use different codons to encode the same amino acid. D) some codons specify more than one amino acid. E) there are more tRNAs than amino acids.

The human Y chromosome is about 50 million base pairs long. About how many nucleosomes would you expect to find associated with this chromosome? A) 2,500 B) 50,000 C) 250,000 D) 1,000,000 E) 50,000,000

The human gene encoding calcitonin contains six exons and five introns and is located on chromosome 11. The pre-mRNA transcript from this gene can generate either calcitonin or calcitonin gene-related peptide (CGRP) in a tissue-specific manner. Calcitonin produced from the thyroid gland is 32 amino acids long and functions to regulate the calcium while CGRP, which contains 37 amino acids, is produced by the brain cells and involved in transmission of pain. Which of the following processes makes production of two functionally and structurally different proteins from the same gene possible? A) self-spicing introns B) differential transcription C) alternative replication D) 5 capping and polyadenylation E) alternative RNA processing

The next step in the translation of this mRNA will be the formation of a peptide bond between which two of the numbered amino acids? A) amino acid 2 and amino acid 3 B) amino acid 2 and amino acid 4 C) amino acid 1 and amino acid 3 D) amino acid 1 and amino acid 2 E) amino acid 3 and amino acid 4

The nuclear genome of a single human cell (i.e., the entire diploid complement) contains about 6.6 billion (6.6 × 109) base pairs of DNA. If synthesis at each replication fork occurs at an average rate of 50 nucleotides per second, all the DNA is replicated in 5 minutes. Assume that replication is initiated simultaneously at all origins. How many origins of replication exist in a human diploid genome? A) 220,000 B) 440,000 C) 880,000 D) 2.64 × 107 E) 1.32 × 108

The nucleotide sequence 5 ...GGAGCUCGUUGUAUU... 3 is changed to 5 GGAGACUCGUUGUAUU 3. Why does or why doesn't the amino acid sequence change? A) The reading frame changes after the mutation (the addition of an A in the fifth position) and so the amino acid sequence is modified after that point. B) The reading frame, starting at the 5 end of this sequence, would be modified because of this change and so the entire amino acid would be different. C) The amino acid is not changed since the coding sequence was not changed at the 5 position. D) A premature stop codon caused by this change would result in a truncated polypeptide. E) Just one amino acid would be changed in the resulting polypeptide.

ACE

The petite mutations in S. cerevisiae, was discovered by Boris Ephrussi and his colleagues in the late 1940s, result in much smaller colony size, reflecting the defect in the cellular growth rate (Figure 11.15). Most petite mutations are known to occur on mitochondrial DNA. Which of the following statements offer a logical explanation of the petite phenotype? Select all that apply. (Photo credit: [From Xin Jie Chen and G. Desmond Clark-Walker, Genetics 144: 1445-1454, Fig 1, 1996. © Genetics Society of America. Courtesy of Xin Jie Chen, Department of Biochemistry and Molecular Biology, SUNY Upstate Medical University.]) A) The defect in the cellular growth comes from an inability to generate enough ATP. B) The growth defect is known to come from having excessive copies of mitochondria, resulting in toxicity from excess ATP. C) The mutations on the mtDNA can result in deficiency of the enzymes involved in aerobic respiration. D) They have no means to make any ATP because of mtDNA defects that affect the normal mitochondrial functions. E) The petite mutants only have to rely on anaerobic processes such as fermentation and glycolysis.

The polymerase that synthesizes which of the following molecules uses DNA as a template and synthesizes new strands from 5 to 3? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

The presence of more than one variation of DNA in the organelles of a single cell is called: A) homoplasmy. B) heteroplasmy. C) hemiplasmy. D) pseudoplasmy. E) paraplasmy.

The proofreading function of DNA polymerases involves _____ activity. A) 5 3 exonuclease B) 3 5 exonuclease C) 5 3 telomerase D) 3 5 telomerase E) 5 3 gyrase

The radioactive labeling experiment similar to Meselson and Stahl's experiment was performed to determine what happens to histone proteins in eukaryotic DNA replication. Preexisting and newly synthesized histone proteins were labeled with radioactive isotopes of different atomic mass. Select the statement(s) that are consistent with the diagram shown. (Select all that apply.) A) The newly synthesized histone and preexisting histones exist separately and associate with a different pool of DNA. B) The newly synthesized histone and preexisting histones mix and form smeared bands, representing heterogeneous mixture. C) The newly synthesized histone only associates with newly synthesized DNA while the preexisting histone associates with the old DNA. D) The newly synthesized histone and preexisting histones tend to mix together and reassociate with DNA after each round of the replication. E) The preexisting histones tend to associate with newly synthesized DNA while the newly synthesized histone associates exclusively with the old DNA.

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it. B) The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site. C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site. D) Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site. E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 A) 5 ACUGGACAGUCGGCACCACG 3 B) 5 GUAAGAAUACAAC 3 C) 5 UGACCUGUCAGCCGUGGUGC 3 D) 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3 E) 5 AGAAUACAACACAGUCGGCACCACG 3

The spliceosome is a large, ribonucleoprotein complex located in the: A) cytoplasm. B) endoplasmic reticulum. C) Golgi aparatus. D) nucleus. E) nucleolus.

There are _____ different codons, which encode 20 amino acids and 3 stop codons. A) 16 B) 20 C) 23 D) 61 E) 64

There are some genomes that have been reported to be positively coiled instead of negatively supercoiled, which is the status of most genomes that we have studied. The genomes that are positively supercoiled seem to belong to viruses and cells that exist at very high temperatures. Why might positive supercoiling be an advantage at high temperatures? (Select all that apply.) A) Negative supercoiling makes it more difficult for strands to separate while positive supercoiling would allow the strands to separate more readily. B) At high temperatures, the condition is more conducive for the strands to denature. C) The high temperature would increase the formation of the hydrogen bonds between bases. D) Positive supercoiling would allow the DNA to maintain its double-stranded structure at higher temperature. E) Positive supercoiling would allow the DNA to readily separate for transcription and replication.

This sequence is RNA because: A) it is single stranded. B) it contains U (uracil) and no T (thymine). C) it runs in a 5 to 3 direction. D) it codes for amino acids E) it is a small molecule.

To which part on a tRNA would an amino acid attach during tRNA charging? A) 3 acceptor arm B) anticodon arm C) TC arm D) DHU arm E) extra arm

Translating an mRNA requires two other types of RNA: A) tRNA and mRNA. B) tRNA and miRNA. C) tRNA and rRNA. D) rRNA and siRNA. E) snRNA and snoRNA.

BCEGI

Translation in prokaryotes and eukaryotes has some similarities but differs in important ways. Which of the following statements about similarities and differences in prokaryotic and eukaryotic translation are TRUE? (Select all that apply.) A) Initiation in prokaryotes and eukaryotes begins with a formylmethionine. B) Prokaryotic and eukaryotic ribosomes are different sizes. C) Prokaryotic ribosomes are sensitive to antibiotics that do not affect eukaryotic ribosomes. D) Prokaryotic and eukaryotic large subunits contain two rRNAs. E) Prokaryotic mRNAs are short-lived. Eukaryotic mRNAs vary in their half-life. F) Recognition of the start codon in prokaryotes and eukaryotes involves the 5 cap, the 3 poly(A) tail, and the Kozak sequence near the start codon. G) Prokaryotic initiation, elongation, and termination factors are different from those in eukaryotes. H) Transcription and translation routinely occur simultaneously in prokaryotes and eukaryotes. I) Elongation involves the formation of a peptide bond between the amino acids that are attached to the tRNAs in the P and A sites of the ribosome in both prokaryotes and eukaryotes.

Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ to result in different denaturation temperatures? A) Fragment A has a higher C+C content than fragment B. B) Fragment B has a higher C+G content than fragment A. C) Fragment A has a secondary structure of B form, while fragment B is an A form. D) Fragment B is methylated more than fragment A.

Upon removal of bacteriophage coats from infected bacterial cells, where was the label for the DNA? A) in the cell pellet B) in the supernatant C) in bacteriophage coats D) in both the cell pellet and supernatant

What do group I and group II introns have in common? A) Both are found in mitochondrial genes. B) Both are found in bacteriophages. C) Both are known to be self-splicing introns. D) Both are found in protein-coding genes of chloroplasts. E) Both are frequently found in eukaryotic genes.

What is the RNA sequence transcribed from the DNA shown below? A) 5ʹ-CCGTATAATGA-3ʹ B) 3ʹ-GGCATATTACT-5ʹ C) 5ʹ-GGCAUAUUACA-3ʹ D) 5ʹ-CCGUAUAAUGA-3ʹ E) 3ʹ-GGCAUAUUACU-5ʹ

What is the difference in hydrogen bonding between A/T pairs versus G/C pairs? A) A/T pairs have one more hydrogen bond than G/C pairs. B) G/C pairs have one more hydrogen bond than A/T pairs. C) A/T pairs have two more hydrogen bonds than G/C pairs. D) G/C pairs have two more hydrogen bonds than A/T pairs. E) G/C pairs have three more hydrogen bonds than A/T pairs.

What is the function of DNA gyrase? A) connects Okazaki fragments by sealing nicks in the sugar-phosphate backbone B) unwinds the double helix by breaking the hydrogen bonding between the two strands at the replication fork C) reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding D) binds to oriC and causes a short section of DNA to unwind E) prevents the formation of secondary structures within single-stranded DNA

What is the function of DNA ligase? A) connects Okazaki fragments by sealing nicks in the sugar-phosphate backbone B) unwinds the double helix by breaking the hydrogen bonding between the two strands at the replication fork C) reduces the torsional strain that builds up ahead of the replication fork as a result of unwinding D) binds to oriC and causes a short section of DNA to unwind E) prevents the formation of secondary structures within single-stranded DNA

What is the function of eukaryotic RNA polymerase I? A) transcription of rRNA genes B) transcription of mRNA genes C) transcription of tRNA genes D) transcription of snRNAs E) initiation of transcription (but not elon

What is the function of general transcription factors? A) They are DNA sequences to which RNA polymerase binds. B) They direct nucleosome assembly. C) They bind to regulatory promoters to increase the rate of transcription. D) They bind to enhancers to allow minimal levels of transcription. E) They are a part of the basal transcription apparatus.

What is the function of peptidyl transferase activity? A) It charges tRNAs. B) It acetylates the end of a protein after translation. C) It cleaves the polypeptide from the last tRNA during termination. D) It moves ribosomes along mRNA during translation. E) It forms peptide bonds.

What is the function of single-strand-binding proteins? A) connect Okazaki fragments by sealing nicks in the sugar-phosphate backbone B) unwind the double helix by breaking the hydrogen bonding between the two strands at the replication fork C) reduce the torsional strain that builds up ahead of the replication fork as a result of unwinding D) bind to oriC and cause a short section of DNA to unwind E) prevent the formation of secondary structures within single-stranded DNA

What is the minimum number of different aminoacyl-tRNA synthetases required by a cell? A) 64, one for each codon B) 61, one for each sense codon C) 30, one for each different tRNA D) 50, one for each different tRNA E) 20, one for each amino acid

What is the similarity between miRNAs, siRNAs, and piRNAs? A) All three types originate from transposons or viruses and are found in all organisms. B) They all target and degrade the gene from which they were transcribed. C) All three are generated from a single-stranded RNA that gets cleaved. D) All three can influence chromatin structure, which, in turn, can influence gene expression. E) All three associate with Piwi proteins in order to mediate RNA degradation.

What kind of gene would NOT be found in a chloroplast genome? A) a tRNA gene B) a gene for a subunit of the photosynthesis enzyme RuBisCO C) a gene for a ribosomal protein D) a gene for ribosomal RNA E) a gene for a histone protein

What may be the consequence of a mutation in the gene that encodes eukaryotic Rat1 exonuclease for eukaryotic transcription mediated by RNA polymerase II? A) The transcription may end prematurely, resulting in shorter mRNA transcript. B) The transcription may not be properly terminated, and RNA polymerase II may not be released. C) The transcription may be delayed indefinitely, which may kill the cell. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may not terminate and result in much longer RNA.

What type of bonds does DNA ligase create between adjacent nucleotides? A) hydrogen B) phosphodiester C) ionic D) metallic E) ribonucleotide

What type of secondary structure is formed by the pairing of three strands of DNA? A) A-DNA B) B-DNA C) C-DNA D) H-DNA E) Z-DNA

What type of synthesis occurs on the leading strand? A) conservative B) dispersive C) continuous D) discontinuous E) recombinant

What types of bonds are created between nucleotides during the process of transcription? A) ionic B) oxygen C) phosphodiester D) hydrogen E) both phosphodiester and hydrogen

What would be a likely result of expressing telomerase in somatic cells? A) premature aging B) cancer C) lower rates of replication D) immortality of gametes E) early termination of replication

What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron? A) A shorter than normal protein would be produced. B) Replication would be inhibited. C) A longer than normal mRNA would be produced. D) A longer than normal DNA would be produced. E) Transcription would terminate prematurely.

What would be the consequence of a mutation in the gene that encodes sigma factor for bacterial transcription? A) The initiation of transcription may begin at random points of the DNA template. B) The RNA polymerase may not be released from the DNA template. C) Transcription may be delayed indefinitely, which may kill the cell. D) The RNA transcript may not be able to dissociate from the DNA template. E) The transcription may end prematurely, resulting in shorter mRNA transcript.

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene? A) The result would be no change in the protein, since deletions are very rare. B) A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal. C) Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made. D) Since exons are not coding regions, no changes in the protein would occur. E) No change in the reading frame would occur due to the degeneracy of the genetic code.

ADE

When chromatin from any eukaryote is digested with micrococcal nuclease (an endonuclease) and fractionated using electrophoresis, DNA fragments of approximately 200 base pairs in length are observed. Which of the following statements explain(s) the observation? (Select all that apply.) A) The 200-base-pair-long DNA fragments represent the approximate length of DNA wrapped around the histone core. B) The 200-base-pair-long DNA fragment is a characteristic behavior of micrococcal nuclease on any given free DNA strand. C) The eukaryotic DNA has an enormous number of repetitive sequences, and the nuclease is cleaving certain repetitive sequences, generating these fragments. D) The result reveals the conserved composition of the nucleosome, which is the repeating unit that makes up chromatin in all eukaryotes. E) The cleavage occurs at the exposed linker region between adjacent nucleosomes that does not directly interact with the histone core.

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing. A) 5 base B) middle base C) 3 base

When does sigma factor normally dissociate from RNA polymerase? A) after transcription has terminated B) after the process of initiation C) after the addition of nucleosomes D) after the binding of rho E) following the addition of nucleosomes

When studying a plant's protein production, a scientist found two different proteins. The first one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second one only contained amino acids from exons from 1, 2, and 3. Which of the following is MOST likely responsible for this difference? A) a mutation in the gene that encodes an miRNA B) posttranslational modification C) RNA editing D) alternative RNA processing E) a mutation in the gene that encodes a snoRNA

Where are promoters usually located? A) upstream of the start site B) downstream of the start site C) near nucleotide +25 D) near the hairpin loop E) downstream of the terminator

Where would you expect to find the variant histone CenH3? A) telomere B) euchromatin C) centromere D) mitochondria E) chloroplast

Whereas the nucleotide strand used for transcription is termed the _____, the nontranscribed strand is called the _____. A) promoter; terminator B) terminator; promoter C) transcription apparatus; TATA box D) template strand; nontemplate strand E) nontemplate strand; template strand

Which DNA modification is the addition of a -CH3 group? A) triple strand B) methylation C) looping D) cytosine substitution E) hydroxylation

Which amino acid is coded by the stop codons in most organisms? A) met B) pro C) trp D) cys E) none

Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile... B) pro-arg-ala-thr-stop C) met-asn-glu-leu... D) glu-leu-val-val-phe... E) leu-glu-gln-his-asn...

Which circle shows a bond that would also be found in an RNA transcribed from one strand of this DNA? A) circle a B) circle b C) circle c

Which circle shows a noncovalent bond? A) circle a B) circle b C) circle c D) circle d

Which circle shows a phosphodiester bond? A) circle a B) circle b C) circle c D) circle d

Which class of RNA is MOST abundant in cells? A) mRNA B) tRNA C) rRNA D) snRNA E) miRNA

Which diagram shows a nucleotide as it would appear in DNA? A) diagram A B) diagram B C) diagram C D) diagram D E) diagram E

Which diagram shows a nucleotide that would be used to make RNA? A) diagram A B) diagram B C) none of these diagrams D) diagram D E) diagram E

Which diagram shows a nucleotide with a purine base? A) diagram A B) diagram B C) diagram C D) diagram D E) diagram E

Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment? A) diagram A B) diagram B C) diagram C D) diagram D E) diagram E

Which hypothesis contributed to the mistaken idea that protein is the genetic material because, with its 20 different amino acids, protein structure could be more variable than that of DNA? A) tetranucleotide hypothesis B) central dogma hypothesis C) RNA world hypothesis D) one gene-one enzyme hypothesis E) adaptor hypothesis`

Which mechanism allows for more than one polypeptide to be encoded by a single gene? A) regulated transcription B) RNA interference C) alternative RNA processing D) self-splicing of introns E) RNA methylation

Which mechanism allows for the production of polypeptides that are not entirely encoded by DNA? A) regulated transcription B) RNA interference C) alternative RNA processing D) RNA editing E) colinearity

Which molecule allows the release of mRNA from a stalled ribosome? A) miRNA B) snoRNA C) incRNA D) tmRNA E) siRNA

Which of the following RNA molecules is required for the process of translation? A) crRNA B) tRNA C) snRNA D) snoRNA E) siRNA

Which of the following amino acids has a positive charge that helps to hold the DNA in contact with the histones? A) alanine B) arginine C) leucine D) valine E) serine

ABCD

Which of the following chemical or structural characteristics of RNA is different from those of DNA? (Select all that apply.) A) The RNA sugar is ribose instead of deoxyribose. B) RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA. C) The bases in RNA include uracil instead of thymine. D) RNA molecules are generally shorter in length than those of DNA macromolecules. E) The 2 carbon of ribose has an H, unlike the OH in that position of deoxyribose.

Which of the following classes of RNAs is unique to eukaryotes? A) messenger RNA (mRNA) B) ribosomal RNA (rRNA) C) transfer RNA (tRNA) D) small nuclear RNAs (snRNAs) E) CRISPR RNAs (crRNAs)

Which of the following consensus sequences are NOT found in nuclear introns? A) GU at the 5 splice site at the beginning of the intron B) AG at the 3 splice site at the end of the intron C) CCA at the 3 site downstream of the branch point D) a at the lariat branch point site E) 3 CAGG consensus sequence at the 3 splice site

Which of the following descriptions is NOT true of heterochromatin? A) It remains in a highly condensed state throughout the cell cycle. B) It makes up most chromosomal material and is where most transcription occurs. C) It exists at the centromeres and telomeres. D) It occurs along one entire X chromosome in female mammals when this X becomes inactivated. E) It is characterized by the absence of crossing over and replication late in the S phase.

Which of the following does NOT enhance the binding of the ribosome to the 5 ́ end of the mRNA? A) 5 ́ cap B) 3 ́ poly(A) tail C) cap-binding proteins D) poly(A) proteins E) enhancer

Which of the following does NOT fit the description of euchromatin? A) less condensed state B) transcriptionally inactive C) chromosomal arms D) common crossing over sites

Which of the following does NOT utilize bidirectional replication? A) theta model B) rolling-circle model C) linear model D) eukaryotes E) bacteria

Which of the following elements would NOT be found in an mRNA molecule? A) protein-coding region B) 3 untranslated region C) 5 untranslated region D) promoter E) start and stop codons

Which of the following enzyme and function pairs is INCORRECTLY matched? A) DNA gyrase; making and resealing the break to remove the torque as the DNA unwinds B) DNA ligase; sealing nicks in the sugar-phosphate backbone of newly synthesized DNA C) DNA helicase; rewinding and reforming the DNA double helix as the replication terminates D) DNA polymerase III; elongating a new nucleotide strand from the 3'-OH provided by the primers E) Initiator protein; binding to replication origin and separating DNA to initiate replication

Which of the following enzymes do NOT aid in the unwinding of DNA for replication? A) helicase B) single-stranded binding proteins C) primase D) gyrase E) topoisomerase

Which of the following eukaryotic DNA polymerases and their role is INCORRECTLY paired? A) (delta); lagging strand synthesis of nuclear DNA B) (epsilon); translesion DNA synthesis C) (eta); translesion DNA synthesis D) (gamma); replication and repair of mitochondrial DNA E) (theta); DNA repair

Which of the following events is NOT part of prokaryotic translation initiation? A) IF-3 separates ribosome subunits so that a small subunit can bind mRNA through base pairing of the 16S rRNA and the Shine-Dalgarno sequence on the mRNA. B) An initiator tRNAformylmet binds the initiation codon, with the help of IF-1 and IF-2 complexed with GTP. The tRNAformylmet is positioned in the P site. C) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site.D) IF-3 dissociates, allowing a large subunit to bind the 30S initiation complex.

Which of the following features of the rho protein is primarily responsible for its ability to cause termination of transcription? A) recognizing unstructured RNA B) helicase activity C) migrating behind RNA polymerase D) RNA-binding activity E) polymerase activity

Which of the following has/have repetitive DNA sequences in heterochromatin state? (Select all that apply.) A) telomere B) centromere C) mitochondria D) chloroplast

Which of the following intron types is present only in eukaryotes? A) nuclear pre-mRNA B) group I intron C) group II intron D) tRNA E) group III intron

Which of the following intron types requires spliceosomes for removal? A) group I intron B) group II intron C) group III intron D) nuclear pre-mRNA E) tRNA

Which of the following is NOT a key characteristic that genetic material must possess? A) Genetic material must contain complex information. B) Genetic material must replicate faithfully. C) Genetic material must encode the phenotype. D) Genetic material must have the capacity to vary. E) Genetic material must contain nitrogen but not sulfur.

Which of the following is NOT an example of secondary structure in nucleic acids? A) hairpin B) stem C) H-DNA D) B-DNA E) C-DNA

Which of the following is NOT characteristic of A-form DNA compared to B- or Z-form DNA? A) has right-handed helixes B) exists when less water is present C) is long and narrow D) has 50% purines, 50% pyrimidines

Which of the following is NOT required during the process of tRNA charging? A) amino acid B) tRNA C) GTP D) ATP E) aminoacyl-tRNA synthetase

Which of the following is NOT required for transcription? A) ribonucleotides B) RNA primers C) DNA template D) RNA polymerase E) promoter

Which of the following is a necessary step in the Holliday model of recombination? A) DNA primase generates an RNA primer. B) The RNA template of telomerase binds to the telomere. C) Topoisomerases aid in supercoiling. D) DNA polymerase initiates DNA synthesis. E) A single-strand break occurs in the DNA molecule.

Which of the following is a protein that facilitates the termination of replication in E. coli? A) telomerase B) DNA gyrase C) Tus D) primase E) topoisomerase

Which of the following is a sequence of DNA where transcription is initiated? A) hairpin loop B) TBP C) initiator D) sigma factor E) promoter

Which of the following is an example of an epigenetic change in eukaryotes? A) a loss of an AT base pair from a gene B) the addition of methyl groups to cytosines in the promoter region of a gene C) the substitution of an AT base pair by a GC base pair in a gene as a result of a mistake during DNA replication D) a deletion that simultaneously removes two genes from the genome E) None of these examples represents epigenetic changes.

Which of the following is found in the primary product of transcription but not in a mature mRNA molecule? A) start codon B) promoter C) exons D) introns E) stop codon

Which of the following is not necessary for RNA polymerase to recognize the promoter of a bacterial gene? A) sigma factor B) origin of replication C) -10 consensus sequence D) -35 consensus sequence

Which of the following is observed in prokaryotes but not in eukaryotes? A) UGG is an example of a stop codon only found in prokaryotes. B) An mRNA can be translated by only one ribosome at a time in prokaryotes. C) The 5 ́ end of a prokaryotic mRNA can be translated while the 3 ́ end is still being transcribed. D) Translation does not require any protein factors in prokaryotes. E) In prokaryotes, ribosomes move along an mRNA in the 3 ́ to 5 ́ direction.

Which of the following mRNA codons will bind to the tRNA anticodon 5 GCU 3, considering wobble-base pairing rules. A) 5 AGU 3 and 5 AGC 3 B) 5' UGA 3 and 5 CGA 3 C) 5 AGC 3 D) 5 CGA 3 E) 5 AGU 3, 5 AGC 3, 5 AGA 3, and 5 AGG 3

Which of the following mechanisms specifically allows detection and rapid degradation of mRNA containing a premature termination codon? A) RNA interference B) no-go decay C) nonsense-mediated mRNA decay D) transfer-messenger RNA mediated ribosomal removal E) nonstop mRNA decay

Which of the following molecules is made of nucleotides joined by phosphodiester bonds that connect the 2 OH to the 5 phosphate? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Which of the following molecules is synthesized using triphosphate nucleotides as a substrate for a polymerase enzyme that forms phosphodiester bonds? A) RNA only B) DNA only C) both RNA and DNA D) neither RNA nor DNA

Which of the following nitrogenous bases is frequently modified enzymatically to become a rare type of nitrogenous base in tRNA? A) adenine B) uracil C) thymine D) cytosine E) guanine

Which of the following observations supports the notion that the gene is simply a set of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide? A) Alternative splicing—a single gene can yield multiple mRNA and protein products. B) A single ribosomal RNA transcript can liberate several RNA molecules via further processing. C) RNAs can be the functional product of a gene without being translated into a protein product. D) Within a protein coding region, each codon represents a specific amino acid that will be linked to form a polypeptide. E) Regulatory elements are part of a gene that regulate timing, degree, and specificity of gene expression but are not transcribed.

Which of the following phenomena is NOT affected by the presence of alternative splicing? A) speciation B) development C) organismal complexity D) tissue specificity E) RNA interference

Which of the following processes does NOT support the observation that the amino acid sequence of a protein may not be the same as that encoded by its gene? A) RNA editing B) alternative splicing C) multiple 3 cleavage sites D) 5 capping E) errors that occurred during transcription

Which of the following rRNA components originates from a separate gene transcript rather than as a cleaved product of a long single precursor rRNA transcript? A) prokaryotic 16S rRNA B) prokaryotic 23S rRNA C) eukaryotic 18S rRNA D) eukaryotic 5.8S rRNA E) eukaryotic 5S rRNA

Which of the following regulatory RNA types is different from the rest in terms of its length? A) siRNA B) crRNA C) miRNA D) piRNA E) lncRNA

Which of the following small RNA types is unique to prokaryotes? A) siRNA B) crRNA C) miRNA D) piRNA E) lncRNA

Which of the following spliceosomal components specifically recognizes and binds to the branch point of the intron during pre-mRNA splicing? A) U1 B) U2 C) U5 D) U6 E) spliceosomal proteins

Which of the following statements BEST describes heteroduplex DNA? A) A single-stranded DNA molecule of one chromosome pairs with a single-stranded DNA molecule of another chromosome. B) A single-stranded DNA molecule of one chromosome pairs with a single-stranded RNA molecule of another chromosome. C) Heteroduplex DNA consists of sequences from two different species that are brought together through homologous recombination. D) Heteroduplex DNA consists of an RNA primer and newly synthesized DNA on the lagging strand. E) In heteroduplex DNA newly synthesized DNA has yet to be reassembled into nucleosomes.

Which of the following statements BEST explains why only pre-mRNA receives a 5 cap? A) The enzyme that initiates the capping step is known to associate with RNA polymerase II, which generates pre-mRNAs. B) Only pre-mRNAs contain proper sequences for the cap to be added on. C) The tail of the pre-mRNA can recruit the right combination of enzymes for capping. D) Nuclear pore complexes only recognize pre-mRNAs and allow them out to the cytoplasm for the capping process to begin. E) rRNA and tRNAs do not exit the nucleus to receive the cap via enzymes in the cytoplasm.

Which of the following statements CORRECTLY describes the concept of alternative splicing? A) Eukaryotic gene and protein sequences are precisely colinear. B) With the rare exception of RNA editing, every nucleotide contained in a processed mRNA molecule is derived from exon sequences. C) Every other intron is removed in an alternate manner to generate a functional mRNA transcript. D) Only a subset of the same mRNA transcripts is specifically selected for splicing in the nucleus. E) Multiple protein products are often produced from single eukaryotic genes.

Which of the following statements CORRECTLY describes the facts about introns and exons? A) The number of introns is always less than the number of exons in a gene. B) Introns are degraded in the cytoplasm. C) All eukaryotic genes contain an intron. D) Mitochondrial and chloroplast genes do not contain introns. E) Introns do not contain sequence-specific information.

Which of the following statements about RNA polymerase is NOT true? A) RNA polymerase adds a ribonucleotide to the 3ʹ end of a growing RNA molecule. B) RNA polymerase binds to a promoter to initiate transcription. C) During transcription of a gene, RNA polymerase reads only one strand of DNA. D) RNA polymerase reads a template strand of DNA 5ʹ to 3ʹ. E) RNA polymerase has many subunits.

Which of the following statements about bacterial mRNA transcripts is TRUE? A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain untranslated regions. B) The Shine-Dalgarno sequence associates with an RNA component in the small subunit of ribosomes. C) Transcription and translation take place sequentially in bacterial cells. D) Most of bacterial genes contain a large number of introns and small number of exons. E) The 5 end and 3 end of mRNA transcripts are modified in bacteria.

Which of the following statements about group I and group II introns is NOT true? A) Both group I and II introns form elaborate and characteristic secondary structures with loops. B) The splicing mechanism of group II introns is similar to that of spliceosome-mediated nuclear pre-mRNA splicing. C) The length of group I and group II introns is much longer than the exons within the structures. D) Group I and group II introns are exclusively found in mitochondrial and chloroplast encoded genes. E) Both group I and group II introns are both found in bacterial genes.

Which of the following statements about protein folding and posttranslational modifications of proteins is CORRECT? A) All nascent polypeptide chains have the intrinsic ability to fold into the active conformation based on the primary structure. B) Only eukaryotic proteins undergo alterations following translation. C) Amino acids within a protein may be modified by molecular chaperones. D) Signal sequence of a protein helps direct a protein to a specific location within the cell. E) Attachment of a protein called ubiquitin directs proteins to enter into the nucleus.

Which of the following statements about proteins is INCORRECT? A) All proteins are made up of some combination of 20 essential amino acids. B) Like nucleic acids, polypeptides have polarity. C) A single polypeptide has primary, secondary, and tertiary structures. D) -helix and -pleated sheets do not require a specific sequence of amino acids to form. E) Some proteins contain more than one polypeptide chain.

Which of the following statements about ribosomes and ribosomal RNA is NOT true? A) Ribosomes typically contain about 80% of the total cellular RNA. B) Ribosomal RNA is processed in both prokaryotes and eukaryotes. C) In eukaryotes, genes for rRNA are usually present within tandem repeats. D) Each ribosomal RNA component is encoded by a separate gene. E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the nucleus.

Which of the following statements about the formation of the peptide bond between amino acids is INCORRECT? A) The formation of peptide bonds results in the formation of a water molecule. B) The amino group of the first amino acid and the carboxyl group of the second amino acid are involved in forming a peptide bond. C) The carboxyl group of the first amino acid reacts with the amino group of the second amino group to form a peptide bond. D) A polypeptide formed by a series of peptide bonds will result in two distinct free ends, one with a free amino group and the other with a free carboxyl group. E) The number of peptide bonds formed in a polypeptide varies from protein to protein.

Which of the following statements about translation is CORRECT? A) A special tRNA that does not have an attached amino acid binds to stop codons to terminate translation. B) The first three bases at the 5 end of an mRNA are the AUG at which translation begins. C) The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end. D) In eukaryotes, the 5 cap and the 3 poly(A) tail are involved in translation initiation. E) Ribosomes move along an mRNA in the 3 to 5 direction.

Which of the following statements describes the "wobble" rules CORRECTLY? A) There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids. B) The number of the genetic code exceeds the number of amino acids available in the cell. C) There are multiple tRNAs that may bind to the same amino acids. D) There are multiple codons that may code for the same amino acids. E) The third base pairing between the tRNA and mRNA is relaxed.

Which of the following statements does NOT describe the events in prokaryotic translation elongation? A) The nucleotides in the Shine-Dalgarno sequence of the mRNA pair with their complementary nucleotides in the 16S rRNA. B) A ribosome with a growing peptide attached to a tRNA in the P site accepts a charged tRNA with the next amino acid into the A site. The charged tRNA enters as a complex with EF-Tu and GTP. C) If the anticodon of the charged tRNA matches the codon, GTP is cleaved and EF-Tu exits and is regenerated to EF-Tu-GTP by EF-Ts. D) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site.E) The ribosome translocates toward the 3 end of the mRNA with the aid of EF-G and GTP hydrolysis. The empty tRNA that was in the P site moves to the E site and exits. The tRNA with the polypeptide that was in the A site moves to the P site.

Which of the following statements explaining the mechanism of action of telomerase is correct? (Select all that apply.) A) The extension of telomeres via telomerase occurs at the 3ʹ overhang with a G-rich sequence. B) Telomerase carries a short single-stranded DNA component that is used as a template to extend the telomere. C) The extension of telomeres via telomerase occurs at the 5ʹ end, where DNA polymerase cannot add a new deoxynucldotide after the removal of the very last RNA primer. D) The extension at the 3ʹ overhang is followed by the extension of 5ʹ complementary strand via a currently unknown mechanism. E) Telomerase finishes complementary base pairing of the 5ʹ complementary strand.

Which of the following statements is FALSE regarding TFIID? A) It contains a TATA-binding protein. B) It aids in initiation of transcription. C) It binds to the core promoter. D) It binds to the TATA box. E) It is a transcriptional activator protein.

Which of the following statements is NOT true of bacterial DNA? A) Most bacterial genomes consist of a single circular DNA molecule. B) Bacterial DNA is not attached to any proteins that help to compact it. C) Bacterial DNA is confined to a region in the cell called the nucleoid. D) Many bacteria contain additional DNA in the form of small circular molecules called plasmids. E) About 3 to 4 million base pairs of DNA are found in a typical bacterial genome.

Which of the following statements is NOT true? A) Both DNA and RNA are synthesized in a 5 to 3 direction. B) During RNA synthesis, the DNA template strand is read in a 3 to 5 direction. C) During RNA synthesis, new nucleotides are added to the 3 end of the growing RNA molecule. D) RNA polymerase has 5 to 3 polymerase activity. E) RNA molecules have the same 5 to 3 orientation as the DNA template strands to which they are complementary.

Which of the following statements is NOT true? A) Both the mitochondria and the chloroplast generate ATP. B) A single eukaryotic cell may contain thousands of copies of the mitochondrial genome. C) According to the endosymbiotic theory, chloroplasts are thought to have evolved from cyanobacteria. D) The mutation rate of mitochondrial DNA is higher than the mutation rate of nuclear DNA. E) Oxidative phosphorylation capacity is constant throughout a person's lifetime.

Which of the following statements is TRUE of DNA polymerases of eukaryotic cells? A) The same DNA polymerase replicates mitochondrial, chloroplast, and nuclear DNA. B) There are only two different DNA polymerases that function in the process of replication. C) Some DNA polymerases have the ability to function in DNA repair mechanisms. D) All eukaryotic DNA polymerases have 3 5 exonuclease activity. E) Leading strand synthesis and lagging strand synthesis are performed by the same type of DNA polymerase.

Which of the following statements is TRUE regarding nucleosome formation during DNA replication? A) Nucleosomes are only reassembled on the lagging strand. B) Nucleosome assembly consists entirely of newly synthesized histones. C) Nucleosome assembly occurs at a faster rate in prokaryotes than in eukaryotes. D) The addition of newly synthesized histones is a part of nucleosome assembly. E) Nucleosome assembly does not occur during semiconservative replication.

Which of the following statements is TRUE regarding the termination of transcription? A) In some organisms, transcription terminates thousands of nucleotides past the coding sequence. B) Transcription typically terminates precisely at the hairpin loop terminator sequence. C) In prokaryotes, transcription terminates as soon as rho has bound to the RNA. D) In yeast, transcription terminates as soon as Rat1 has bound to the RNA.

Which of the following statements is TRUE regarding transcription in most organisms? A) All genes are transcribed from the same strand of DNA. B) Both DNA strands are used to transcribe a single gene. C) Different genes may be transcribed from different strands of DNA. D) The DNA template strand is used to encode double-stranded RNA. E) The DNA nontemplate strand is used to encode single-stranded RNA.

Which of the following statements is TRUE? A) Most proteins in the human mitochondrion are encoded by nuclear genes. B) One piece of evidence supporting the endosymbiotic theory is the extreme similarity between mitochondrial DNAs from different organisms. C) Heteroplasmy refers to the presence of different alleles in a single organelle. D) Plants contain chloroplasts, not mitochondria. E) cpDNA evolves faster than nuclear DNA.

Which of the following statements regarding gene structure is TRUE? A) The amino acid sequence of a polypeptide can be precisely predicted by the nucleotide sequence of the gene that encodes it. B) The number of introns found in organisms is species specific. C) The number of exons and introns generally correlates to the complexity of the organisms. D) Intron cleavage and exon splicing are both mediated exclusively by protein enzymes. E) The number of exons is always less than the number of introns in a gene.

ABCE

Which of the following terms describe the feature(s) of mtDNA and cpDNA that differ from the eukaryotic nuclear DNA? (Select all that apply.) A) uniparental inheritance B) circular C) heteroplasmy D) homoplasmy E) high copy number

Which of the following types of RNA gets translated? A) rRNA B) mRNA C) tRNA D) miRNA E) rRNA, mRNA, and tRNA all get translated

Which of the following typically only have one origin of replication? A) humans B) prokaryotes C) eukaryotes D) linear model of replication E) plants

Which of the following would NOT necessarily be true for a DNA molecule? A) A=T B) C=G C) A+G=C+T D) A+C=G+T E) A+T=G+C

Which of the results (A through F) would give a clear experimental clue for the conservative model? A) A and D B) B and E C) C and F D) D and E E) E and F

Which of the results (A through F) would give a clear experimental comparison to distinguish between the semiconservative model and dispersive model? A) A and D B) B and E C) C and F D) D and E E) E and F

Which of the results (A through F) would give a clear experimental conclusion for the semiconservative model? A) A and D B) B and E C) C and F D) D and E E) E and F

Which of these sequences could form a hairpin? A) 5-GGGGTTTTCCCC-3 B) 5-AAAAAAAAAAAA-3 C) 5- AAAAGGCCCCCC -3 D) 5-TTTTTTCCCCCC-3 E) 5-GGGTTTGGGTTT-3

Which one of the following codons codes for a different amino acid from the rest? A) CUU B) CUC C) UUA D) UUU E) CUA

Which one of the following statements is NOT true for all E. coli DNA polymerases? A) They require a primer to initiate synthesis. B) They use dNTPs to synthesize new DNA. C) They produce newly synthesized strands that are complementary and antiparallel to the template strands. D) They possess 5 3 exonuclease activity. E) They synthesize in the 5 3 direction by adding nucleotides to a 3 OH group.

Which one of the following statements regarding eukaryotic transcription is NOT true? A) Eukaryotic transcription involves a core promoter and a regulatory promoter. B) There is no one generic promoter. C) A group of genes is transcribed into a polycistronic RNA. D) Chromatin remodeling is necessary before certain genes are transcribed. E) There are several different types of RNA polymerase.

Which pair in the pedigree shares the same mitochondrial DNA? A) I-2 and III-1 B) II-2 and III-2 C) III-1 and III-2 D) II-2 and III-1 E) I-3 and II-6

Which process is illustrated in the diagram below? A) transcription B) translation C) RNA processing D) peplication E) nucleosome assembly

Which secondary structure of DNA is typically left-handed? A) A B) B C) Z D) H

Which secondary structure of DNA would MOST likely be seen in a dehydrated tissue sample? A) A B) B C) Z D) H

Which statement CORRECTLY describes why the DNA synthesis is discontinuous on one template strand while continuous on the other? (Select all that apply.) A) It is due to antiparallel nature of the DNA molecule. B) It is due to the fact that the DNA polymerase is not active enough. C) It is due to the nature of the DNA polymerase which can only add new nucleotide at the 3ʹ end. D) It is due to difficulty in unwinding the DNA template for replication. E) It is due to the semiconservative nature of DNA replication.

Which statement about mitochondrial genomes is NOT true? A) In most animals, the mitochondrial genome consists of a single circular DNA molecule. B) Plant mitochondrial genomes often include multiple circular DNA molecules. C) Each mitochondrion typically contains many copies of the mitochondrial genome. D) All copies of the mitochondrial genome within a cell are identical.

Which statement is NOT true of negatively supercoiled DNA? A) It eases the separation of nucleotide strands during replication and transcription. B) It allows DNA to be packed into small spaces. C) It has less than 10 bp per turn of its helix. D) It is more negatively charged due to additional phosphates per turn of the helix. E) It is found in most cells.

Which term CORRECTLY describes the molecule below? A) thymine base B) purine base C) pyrimidine base D) nucleotide E) amino acid

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. You wish to discover which of those three molecules could be the genetic material. The classic experiment of which of the following scientists would be the MOST appropriate to mimic? A) Hershey, Chase B) Avery, MacLeod, McCarty C) Franklin D) Griffith E) Fraenkel-Conrat, Singer

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. You wish to discover which of those three molecules could be the genetic material. You heat-kill some of the purple life form and subject three different homogenized samples to different enzymes: DNase, RNase, or protease. Which sample will NOT transform yellow into purple? A) DNase B) RNase C) protease D) All will cause transformation. E) None will cause transformation.

While investigating a gene that might be responsible for pathogen resistance in the plant Arabidopsis, you discover that many of the nucleotides in the gene sequence are methylated. Which nucleotide is MOST likely to be methylated? A) A B) T C) C D) G

While working on Drosophila, you find a new mutant strain with an abnormal histone H3 gene. This novel histone mutant is predicted to cause the nucleosomes to bind an extra 15 bp of DNA compared to wild type. If you digest isolated chromatin with a nuclease to release the core nucleosomes, what size DNA fragments would you expect from wild-type and mutant flies? A) Approximately 50 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~65 bp. B) Approximately 100 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~115 bp. C) Approximately 125 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~140 bp. D) Approximately 145 bp is known to bind to the normal core nucleosome, so the additional 15 bp binding to H3 would give a rise to ~160 bp. E) The size of the DNA fragments cannot be determined.

Why was the idea that genes are made of nucleic acids NOT widely accepted until after 1950? A) Proteins are more abundant than nucleic acids, so it seemed more logical that proteins would carry genetic information. B) Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear. C) Amino acids existed in the prebiotic environment, so they would have most likely been the first to carry genetic information for life. D) DNA was not chemically stable for long enough to be a good method of storing genetic information. E) Nothing was known about the chemistry of DNA until after 1950.

A E

Why were bacteriophages used in the Hershey-Chase experiment? (Select all that apply.) A) They had a protein coat and an internal DNA molecule. B) They had a DNA coat and an internal protein molecule. C) Their proteins and DNA were mixed together. D) They injected protein inside bacterial cells. E) They injected their genetic material into bacterial cells.

With respect to their 3 and 5 ends, the two polynucleotide chains of a double-stranded DNA molecule are: A) antiparallel. B) parallel. C) methylated. D) complementary. E) nitrogenous.

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. Which samples would be destroyed by a DNase? A) tubes 1 and 3 B) tubes 2 and 4 C) tubes 1 and 2 D) tubes 3 and 4 E) all the tubes

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. Which tube MOST likely contains mouse cytoplasm? A) tube 1 B) tube 2 C) tube 3 D) tube 4

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. Which tube MOST likely contains parvovirus? A) tube 1 B) tube 2 C) tube 3 D) tube 4

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. Which tube MOST likely contains rotavirus? A) tube 1 B) tube 2 C) tube 3 D) tube 4

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. Which tube MOST likely contains yeast nuclei? A) tube 1 B) tube 2 C) tube 3 D) tube 4

You are a researcher studying the genetic basis of colon cancer. You have been working with a colon cancer cell line to determine the expression levels of different genes that might contribute to cancer formation. You obtain the DNA methylation status of five genes of interest (the data are shown in the table below). The plus (+) sign indicates the level of DNA methylation; more plus signs correlates with increased methylation levels. Based on the information shown above, which gene would you predict to have the highest rate of transcription? A) gene 1 B) gene 2 C) gene 3 D) gene 4 E) gene 5

You are a researcher studying the genetic basis of colon cancer. You have been working with a colon cancer cell line to determine the expression levels of different genes that might contribute to cancer formation. You obtain the DNA methylation status of five genes of interest (the data are shown in the table below). The plus (+) sign indicates the level of DNA methylation; more plus signs correlates with increased methylation levels. Based on the information shown above, which gene would you predict to have the lowest rate of transcription? A) gene 1 B) gene 2 C) gene 3 D) gene 4 E) gene 5

You are studying a small eukaryotic gene of about 2000 bp in length. Estimate how many copies of histone H1 you would find along this region of the chromosome. A) 10B) 20 C) 40 D) 80 E) 100

You are studying a small eukaryotic gene of about 2000 bp in length. Estimate how many copies of histone H4 you would find along this region of the chromosome.

You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicate their DNA. Based on the following equilibrium density gradient centrifugation results, what type of replication would you propose for these new bacteria? A) conservative B) semiconservative C) dispersive D) semiconservative or dispersive E) conservative or dispersive

You rate of 400 nucleotides per second. If the virus uses rolling-circle replication, how long will it take to replicate its genome? A) 7.5 seconds B) 15 seconds C) 30 seconds D) 1 minute E) 2 minutes are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a

___ are tandemly repeated DNA sequences located at the ends of eukaryotic chromosomes. A) Replication bubbles B) Telomeres C) Nucleosomes D) Licensing factors E) Holliday junctions

_____ probably began the evolution of life on Earth. A) DNA B) RNA promoters C) DNA polymerases D) RNA polymerases E) Ribozymes

siRNAs and miRNAs function in which of the following processes? A) transcription B) translation C) RNA interference D) RNA editing E) RNA splicing

A molecule that consists of a nitrogenous base bonded to the 1 carbon of a ribose or deoxyribose is a(n):A) nucleoside.B) hairpin. C) isotope.D) polynucleotide. E) nucleotide.

BDE

A new Drosophila phenotype is investigated with a series of crosses. P (parental) organisms are true-breeding. The following is the first cross: Which of the following CORRECTLY predict(s) the F2 results, if the allele that causes the mutant phenotype is X-linked recessive? (Select all that apply.) A) 1/4 of the F2 will be wild type and 3/4 will be mutant. B) 2/3 of the wild type will be female and 1/3 will be male. C) 1/2 of the F2 will be mutant and all will be male. D) 1/4 of the F2 will be mutant and all will be male. E) 3/4 of the F2 will be wild type.

How many base pairs per turn of the helix would MOST likely correspond to a negatively supercoiled DNA molecule?A) 0B) 5 C) 10 D) 15 E) 100

In eukaryotic DNA, regions called "CpG islands" are often associated with unusual gene expression patterns, particularly decreased expression. What could be different about the DNA structure in these regions to account for decreased gene expression? A) methylated cytosine B) methylated guanine C) methylated phosphate D) a triple-stranded region

In eukaryotic cells, where does the basal transcription apparatus bind? A) core promoter B) regulatory promoter C) terminator D) enhancer E) ribozyme

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the: A) rho factor. B) TFIID. C) TBP. D) omega subunit. E) sigma factor.

Jack(MERRF) syndrome. His case includes frequent and disabling myclonic seizures (involuntary twitching of the muscles) along with hearing loss, exercise intolerance, and poor night vision. Like most cases of MERRF, his case is associated with a mitochondrial mutation that he inherited from his mother Jill. His mother doesn't know that she harbors the MERRF mutation among her mtDNA molecules, but she has experienced occasional mild muscle twitching throughout her life and she does not see very well at night. What is/are the MOST likely explanation(s) for the difference in the severity of MERRF between Jake and his mother? (Select all that apply.) A) Heteroplasmy for mtDNA molecules in the cells of his mother is responsible. B) Some random mutations took place in Jack's mitochondria, which caused MERFF syndrome as his mother does not have full symptoms. C) It is likely that Jake has a higher proportion of mutant mtDNA molecules in his cells compared to his mother. D) The expression pattern of the mutant gene may be different in males than in females.

Suppose that some cells are grown in culture in the presence of radioactive nucleotides for many generations so that both strands of every DNA molecule include radioactive nucleotides. The cells are then harvested and placed in new Moderate with nucleotides that are not radioactive so that newly synthesized DNA will not be radioactive. What proportion of DNA molecules will contain radioactivity after two rounds of replication? A) 0 B) 1/8 C) 1/4 D) 1/3 E) 1/2

The information needed during RNA editing comes MOST directly from: A) pre-mRNA. B) mRNA. C) rRNA. D) tRNA. E) guide RNA.

The sequence 5 ...GGAGCUCGUUGUAUU... 3 is changed to 5... GGAGACUCGUUGUAUU... 3. What would be the effect on the amino acid sequence? A) There would be no effect on the amino acid sequence. B) This is an insertion mutation so there would be a premature stop codon. C) The amino acid sequence would be asn-thr-thr-thr-leu. D) The amino acid sequence would be thr-ser-tyr-leu-asn. E) The amino acid sequence would be gly-asp-ser-leu-tyr.

Which activity is NOT associated with DNA polymerases? A) ability to attach a DNA nucleotide to the 3 end of previously incorporated DNA nucleotide B) ability to excise a newly incorporated nucleotide that does not match the template strand C) ability to "read" a template strand 3 to 5 and synthesize a complementary strand D) ability to synthesize a DNA from scratch without a primer E) ability to synthesize new DNA in a 5 to 3 direction

Which of the following terms CORRECTLY describe(s) the inheritance pattern of mtDNA and cpDNA in eukaryotic cells? (Select all that apply.) A) maternal inheritance B) circular C) heteroplasmy D) homoplasmy E) high copy number

While investigating a gene that might be responsible for pathogen resistance in the plant Arabidopsis, you discover that many of the nucleotides in the gene sequence are methylated. What might this methylation do to the expression of this gene? A) nothing B) increase C) decrease

GENETICS TEST 3

Related study sets

Mortgage

Chapter 19

Orientation to Education Final Exam Review

CS 170 CH 5-9

Simple Stains Mastering Microbiology Lab Homework

human nutrition chapter 6

Questions for State Examine

Chapter One Self Quiz

Chapter 3 Prep U

Chapter 16 Evolution of Populations

Chapter 2 review

Reading Quizzes 15-20

Chapter 4 - civil liberties (review)

Community Exam 2 Questions

ADJ 105 Chapter 5: you decide

Rad Review; Ethical And Legal Aspects

Ch. 5 Activity-Based Costing & Managing

Student Success

Consumer Behaivor Quiz 7

Coursepoint: Tracheostomy Care