KSU Modern Genetics Achieve Homework Study Questions for Final Exam

A plant of genotype 𝐴𝐵𝑎𝑏 is testcrossed with 𝑎𝑏𝑎𝑏. If the two loci are 10 map units apart, what percent of progeny are expected to inherit the genotype 𝐴𝐵𝑎𝑏?

percent of 𝐴𝐵𝑎𝑏 progeny= 45

Which description is the best definition of a single nucleotide polymorphism, or SNP?

when the nucleotide at a particular genomic position differs between two individuals

Suppose a study is being conducted to understand the potential heritability of artistic ability. Specifically, the study wants to recruit pairs of monozygotic and dizygotic twins raised in the same or different environments. Using the data collected from the study, what equation could be used to estimate the degree of phenotypic variability of artistic ability that is due to genetic factors?

𝐻2=2(𝑟MZ-𝑟DZ) , where 𝐻2 is broad-sense heritability

Which statement is the definition of a map unit (centimorgan)?

It is the percent chance of a crossover between two locations on a chromosome.

X‑linked, recessive diseases, such as hemophilia, are extremely rare in the population. However, many women are carriers and show no sign of the disease. The pedigree illustrates the inheritance of an X‑linked, recessive disease. Determine whether the unknown individuals are affected by the disease, unaffected by the disease, or carriers of the X‑linked recessive allele. Unaffected individuals are not carriers of the X‑linked recessive allele.

See picture

Suppose a group of researchers analyzed a new species of flowering plant. In this species, flower color is determined by two genes. They crossed a truebreeding red‑flowered stock with a truebreeding white‑flowered stock. They then crossed the F1 offspring together and analyzed the next generation. Upon examining the flower color, they found that the F2 generation contained 89 purple, 31 red, and 39 white flowers. What genetic term best describes the inheritance pattern of flower color for this species?

recessive epistasis

The descriptions pertain to either prokaryotic or eukaryotic transcription. Match each description to the appropriate category.

See picture

Rock pocket mice live in the desert of New Mexico and can be either tan or black. Tan mice tend to be more common in areas where the desert floor is covered with sand and gravel. Black mice are more common in areas covered with dark lava flows. Scientists believe that predation pressure results in this pattern. Fur color is determined by a dominant black allele B and a recessive tan allele b. Suppose a population of mice with a B allele frequency of 0.5 is relocated to a basalt flow. Selection occurs due to predation, and the resulting breeding population has now produced on average 29 from tan mice, 126 from heterozygous black mice, and 64 from homozygous black mice. Calculate the selection coefficient, 𝑠, of tan mice after selection has occurred. Express your answer to at least two decimal places.

𝑠𝑏𝑏= .77

A classic example of natural selection is the population‑level change in the color of peppered moths during the industrial revolution. Color in the peppered moth is autosomal recessive. The dark coloration is dominant, D, and the light coloration is recessive, d. Suppose a population of peppered moths produces on average 13 offspring from light‑colored moths, 49 offspring from heterozygous, dark‑colored moths, and 92 offspring from homozygous, dark‑colored moths. Calculate the fitness of the light‑colored moths, 𝑤𝑑𝑑. Express 𝑤 to the nearest thousandth.

𝑤𝑑𝑑 = .141

Imagine that two unlinked autosomal genes with simple dominance code in goats for size, where T is tall and t is short, and for color, where R is red and r is tan. If a short, tan male goat mates with a tall, red female goat of an unknown genotype, what is the probability that they would produce short, tan offspring?

.0625

Suppose both a group of people with a heritable disease and a control group without the disease are tested for their genotype at the disease locus and their genotype for a large number of different SNPs (single‑nucleotide polymorphisms). The disease locus is later determined to be in linkage disequilibrium with one SNP in particular. 1) At what frequency are the disease allele and a particular nucleotide variant of the SNP found together, compared to the frequency expected by chance? 2) When did the SNP arise on the chromosome, compared to the mutation responsible for the disease?

1) higher 2) before

Earwax type is a Mendelian human trait. Specifically, wet earwax (W) is a dominant allele, and dry earwax (w) is a recessive allele. Given parents with WW and Ww genotypes, what is the probability that their child will have a wet earwax phenotype? Enter your answer as a percentage.

100% probability

Tail length in the manx cat is a trait that displays incomplete dominance. There are two alleles for tail length, one for a long tail (TL) and one for no tail (TN). Cats that are homozygous for the long‑tail allele (TLTL) have long tails, whereas heterozygous (TLTN) cats are tailless. Cats with the genotype (TNTN) die during embryonic development. If a long‑tailed cat and a tailless cat have a litter of kittens, what are the predicted phenotype percentages of the offspring?

50% long tailed, 50% tailless

Suppose a diploid slime mold is completely heterozygous at all 12 of its chromosomes (2𝑛=12). How many different combinations of gametes can be produced by this slime mold, assuming no homologous recombination between chromosomes?

64

Suppose in a species of petunia, both locus A and locus B can independently determine petal color. At locus A, pink (A) is dominant over white (a). At locus B, pink (B) is also dominant over white (b). If there are dominant alleles at both loci, magenta petals are produced. If an AA BB plant is crossed to an aa bb plant, what is the ratio of magenta‑ to pink‑ to white‑flowered petunias expected in the F2 progeny?

9:6:1

Which of the events can result in sympatric speciation?

A diploid plant generates tetraploid offspring that live in the same habitat as, but cannot mate with, other diploid plants.

In sexually reproducing organisms, meiosis generates haploid (1n) gamete cells from diploid (2n) cells. The n represents the number of chromosomes in a cell's set of chromosomes. Haploid cells have one set of chromosomes, whereas diploid cells have two sets of chromosomes. How does a zygote form from gametes?

A diploid zygote that can develop into an embryo forms when two haploid gametes fuse.

Suppose a farmer is in the business of growing carnations for a local flower shop. He typically grows red, white, and pink flowers. In his carnations, flower color is determined by a single locus and two alleles. The flower color phenotype exhibits incomplete dominance, so all heterozygous flowers are pink. Homozygous flowers are either red or white. The farmer would like the plants to produce enough of each color flower to meet customer demand which is conveniently the standard mendelian ratio of 1:2:1 of white:pink:red flowers. He hypothesizes this ratio can be obtained by letting the flowers self-cross. The farmer plants 1000 total seed of 250 white flowers, 250 red flowers, and 500 pink flowers and lets the plants self-fertilize and perpetuate over three growing seasons. He predicts the ratio will remain the same each generation. Use a Chi-square critical values table to analyze the average collected data from the farmer's field trials and select the conclusion that best fits the farmer's results.

The farmer will not meet demand because the flowers will not reliably produce the 1:2:1 ratio of flower colors needed. The ratio differs significantly from 1:2:1.

The pedigree shows a family in which several family members have a rare hereditary liver cancer. DNA was isolated from normal tissue of each individual in generation III. DNA was also isolated from liver tumors of the affected individuals. The genomic region closely associated with this cancer was analyzed by PCR, and the data is shown in the gel. Based on the pedigree and DNA gel, select the correct statement about the gene associated with this cancer.

The gene is a tumor suppressor gene because the normal allele is missing in tumor cells.

As depicted in the table, certain plant genomes are significantly larger than mammal genomes, including the human genome. Why do these diploid plants have more DNA, but less organismal complexity compared with humans?

The majority of plant genomes consist of repetitive DNA from transposons.

What information about recombination frequencies enables scientists to create linkage maps?

The recombination frequency is proportional to the distance between the two genes.

Suppose Jennifer is a horticulturist that specializes in the cultivation of orchids. She houses the orchids in a temperature-controlled and humidity-controlled greenhouse. A salesperson approaches Jennifer and attempts to sell her a special fertilizer that promises to increase flower production. Jennifer, who dabbles in genetics, insists that the fertilizer will have no effect on flower production. She has calculated the narrow-sense heritability of flower production in her orchids and found it to be 0.98. Jennifer claims that a narrow-sense heritability of 0.98 indicates that 98% of the variance in flower production is determined by genetic differences, so a fertilizer would have little effect on flower production in the orchids. The salesperson disagrees with Jennifer and continues to assert that the fertilizer will increase flower production. Who is correct and why?

The salesperson is correct. High heritability of a trait within a population does not exclude new environmental factors from affecting the trait.

Which of the statements defines somatic gene therapy?

The transfer of recombinant DNA in people with disease to cure or decrease the symptoms of the disease.

In 1953, Francis Crick declared, "We have discovered the secret of life!" after solving the structure of DNA with his colleague James Watson. How did Watson and Crick use the width of DNA to determine the nucleotide pairing in DNA?

The width is explained by a purine base pairing with a pyrimidine base.

Imagine that a scientist studies two traits in cattle. The scientist noticed that oval is dominant over triangular with regard to snout shape. Additionally, long is dominant over short with regard to tail length. To determine if these traits are linked, two individuals that are heterozygous for both traits were crossed. The data in the table represent the number of offspring produced by this dybrid cross. Phenotypic ratios represents the predicted proportion of offspring with each set of traits that would be produced if the traits independently assort. What can be determined about these traits based on Chi-square analysis?

These traits do not assort independently.

What contribution did James Watson and Francis Crick make to our understanding of DNA?

They pieced together the available evidence and modeled the structure of DNA.

Researchers construct different types of genomic maps to gain information about genes and their locations in the genome. Why would a researcher choose to construct a physical map of genes rather than a genetic map?

To determine the locations of specific genes on a chromosome and the distance between them.

What is the most inclusive definition of a model organism (model system)?

an organism with a biological system that is representative of the same system in other organisms

Retrotransposons are a type of transposable element, or transposon. These segments of DNA can duplicate and insert themselves into new locations in the genome. For example, the Alu sequence is about 300 bases long, and it is the most abundant retrotransposon in primate genomes. In fact, it makes up approximately 15% of the human genome. Choose the description that best explains how the Alu sequence can affect the size of the human genome. The Alu sequence

can increase the size of the human genome because it adds 300 bases to the genome each time it is duplicated.

Sickle‑cell anemia is a disease that affects the type of hemoglobin (Hb) a person makes in his or her red blood cells. Consider the case of Martin and Cindy, who are the parents of Mary. Martin has sickle‑cell anemia with abnormal hemoglobin, and his genotype is HbS/HbS. Cindy has normal hemoglobin, and her genotype is HbA/HbA. Their child Mary carries the sickle‑cell trait and produces both normal hemoglobin and abnormal hemoglobin. Mary's genotype is HbS/HbA. What type of dominance pattern would result in Mary's blood producing both normal and abnormal hemoglobin?

codominance

Suppose virus C has a viral genome of 154,000 bp, and 10,000,000,000 viruses are replicated in an infected individual in a single day. Assume that a single mutation at a particular location in the virus C genome is needed for virus C to develop antiviral drug resistance to famciclovir. The mutation can be a transition or transversion mutation. If RNA polymerase introduces an error in 1 of every 10,000 bases synthesized, how long will it take for virus C to overcome famciclovir therapy and develop resistance? Round your answer up to a whole number of days.

days for virus to develop resistance: 1

Suppose the human trait for hair type is controlled by a simple dominant and recessive relationship at one locus. Curly hair, C, is the dominant allele, and straight hair, c, is the recessive allele. In a college genetics class, the professor takes a tally of students who have curly hair and of students with straight hair. In this class of 117 students, 37 have curly hair. Calculate the frequency of the dominant allele, C, and the heterozygous genotype, Cc. Express the frequencies in decimal form rounded to the nearest thousandth. Assume the class is in Hardy-Weinberg equilibrium for this trait.

frequency of C: .173 frequency of Cc: .286

Use the provided codon table to decode the mRNA sequence, GAAGGCUAU. What will be the amino acid sequence of the protein translated from this mRNA sequence?

glu, gly, tyr

Why can alternative splicing of messenger RNAs (mRNAs) be advantageous for eukaryotic organisms?

increases the variety of proteins that can be produced

Which type of DNA mutation results in a change in the reading frame of an mRNA?

insertion of a single nucleotide

Suppose there are five genes in pumpkins that work additively to affect pumpkin size. A homozygous lowercase allele pumpkin, aabbccddee, weighs 20 lb. Each capitalized allele additively affects the final phenotype by either adding or subtracting weight from the base pumpkin size. The effect of a single capitalized allele is listed in the table. What would the potential size range be for pumpkin offspring produced from the cross between a parent with genotype AaBBCcddEE and a parent with genotype AABbccDDEe?

largest pumpkin: 36 lb smallest pumpkin: 24 lb

The domestic cat, Felis catus, is a domesticated furry creature often kept as a pet in many countries. Suppose a volunteer at a local animal shelter wanted to find out a little more about the cats in her care. The volunteer carefully measured the height for the 10 fully grown adult cats at her shelter. The height measurements were taken from the base of the foreleg to the shoulder. The table shows the results of the measurements. Sample Height (in) 1 9 2 12.8 3 7.4 4 8 5 8.6 6 12.3 7 9.2 8 11.1 9 7.8 10 6.5 Calculate the mean, variance, and standard deviations for cat height for the sample of shelter cats. Report all your answers to two decimal points.

mean: 9.27 in variance: 4.50 in^2 standard deviation: 2.12 in

Consider the diagram. Use the diagram to select the correct statement regarding RNA splicing.

noncoding introns are edited out and removed

Suppose that the X‑linked recessive condition Duchenne muscular dystrophy affects 1 in 3600 males in the United States. Assume that the only two alleles present are normal and disease‑causing and that the population is in Hardy-Weinberg equilibrium. If the population of females in the United States is 160 million, how many females in the country do you expect to have the disease?

number of affected females: 12

Suppose a researcher performed an experiment to determine the number of genes affecting fruit size in tomatoes. She crossed the domestic tomato, Lycopersicon esculentum, and the wild species, Lycopersicon cheesmanii, for two generations to obtain F2 individuals. Consider the table, which reports the fruit diameter and number of offspring obtained by the researcher in the F2 generation. In the parental lines, L. cheesmanii had a fruit diameter of 9 cm and L. esculentum had a fruit diameter of 15 cm. Calculate the total number of genes involved in fruit diameter in tomatoes.

number of genes: 3

How can microRNAs (miRNAs) regulate gene expression?

prevent translation by binding to mRNA and degrading the mRNA strand

Which description applies to post‑translational gene regulation?

protein modifications such as addition of a functional group, or structural changes such as folding

Femur length and height were measured for five humans. The data collected for each trait are found in the table. Calculate the correlation between height and femur length.

r = .6595

Histone proteins

regulate transcription by changing their associations with DNA.

Suppose Sally grew a wild type E. coli culture in rich liquid media that contained all 20 amino acids until the culture was dividing exponentially, with one cell division approximately every 20 minutes. She then added the mutagen 5-bromouracil to the media. After the cells had grown for 20 more minutes, she washed the cells to remove the mutagen and resuspended the washed cells in sterile water. Next, Sally plated the resuspended cells on minimal media supplemented with tryptophan and obtained well-separated colonies, such that each colony arose from a single bacterial cell. She replica-plated these colonies on minimal media and selected a single colony that grew on the media supplemented with tryptophan, but not on minimal media. Sally inoculated 10 test tubes containing fresh minimal media supplemented with tryptophan with cells from this colony and grew the 10 cultures until the cells were dividing exponentially. She then plated 0.1 mL of each culture onto separate plates containing minimal media. No colonies grew on 3 of the 10 plates. Colonies grew on the remaining seven plates, with one plate containing about 100 colonies and the other plates each containing between 1 and 15 colonies. What type of mutation allowed colonies to grow on these seven plates?

spontaneous reverse mutation

In pea plants, the genes for plant height and flower color are located on different chromosomes and assort independently of one another. Consider that T=tall, t=short, P=purple flowers, and p=white flowers. According to the law of independent assortment, what are all the possible phenotypes for offspring of a self‑pollinated pea plant with a genotype of TtPp?

tall with purple flowers, tall with white flowers, short with purple flowers, short with white flowers

Color blindness occurs when an individual is unable or has diminished ability to see certain colors. Red‑green color blindness is an X‑linked recessive trait, and whether or not an individual is red-green color blind is influenced by three different alleles. XC codes for normal vision and is dominant to Xcp and Xcd. Xcp is the protan type, which produces insensitivity to red light. Xcd is the deutan type, which produces insensitivity to green light. However, heterozygous recessive individuals, who have the genotype XcpXcd, have normal vision. In a hypothetical scenario, a scientist evaluates 5000 males and 5000 females. Of the males, 4601 had normal vision, whereas 399 were red‑green color blind. Of the females, 4981 had normal vision, whereas 19 were red‑green color blind. When analyzed further, it was determined that 2 of the color blind females had the genotype XcpXcp, and 17 of the color blind females had the genotype XcdXcd. 1) What is the genotype frequency of males with deutan‑type color blindness? 2) What is the heterozygous recessive genotype frequency?

1) 0.058 2) 0.002

The kernel color in wheat is a continuous trait determined by two additive genes, each with two alleles, that equally contribute to kernel color determination. The red kernels are determined by two genes and two dominant alleles (R1R1R2R2), and white kernels are determined by two recessive alleles at the same two genes (r1r1r2r2). The duplicate dominant alleles R1 and R2 contribute equally to kernel color and cumulatively control the intensity of the red kernel phenotype. Both these alleles are dominant over the recessive white alleles r1 and r2. A true breeding red plant and true breeding white plant are crossed, and the resulting F1 progeny are selfed. 1) What is the expected phenotypic ratio of the kernel progeny of the F2 offspring? 2) Determine which statement best describes the relationship between the phenotypes of the R1R1R2r2 and R1r1R2R2 genotypes.

1) 1:4:6:4:1 2) The phenotypes of the R1R1R2r2 and R1r1R2R2 genotypes will be the same because the same number of dominant and recessive alleles are contributing in each genotype.

From several crosses of the general type A/A·B/B x a/a·b/b, the F1 individuals of type A/a·B/b were testcrossed with a/a·b/b. The results are as follows: Use the χ2 critical values table when needed. 1) What is the Χ2 value for cross 1? 2) Based on the Χ2 value calculated for cross 1, is there evidence of linkage? 3) What is the Χ2 value for cross 2? 4) Based on the Χ2 value calculated for cross 2, is there evidence of linkage? 5) What is the Χ2 value for cross 3? 6) Based on the Χ2 value calculated for cross 3, is there evidence of linkage? 7) What is the Χ2 value for cross 4? 8) Based on the Χ2 value calculated for cross 4, is there evidence of linkage?

1) 2.12 2) No, there is not sufficient evidence to support linkage between the genes. 3) 6.60 4) No, there is not sufficient evidence to support linkage between the genes. 5) 66 6) Yes, there is evidence that the genes are linked. 7) 11.5 8) Yes, there is evidence that the genes are linked.

Consider the diagram of the results from a DNA-RNA hybridization experiment for an unknown gene. For this experiment, a mixture of DNA and mRNA has been heated to a point of denaturation and cooled such that the RNA can hybridize, or form a double helix, with DNA that has a complementary nucleotide sequence. 1) Using the image, determine the total number of exons contained in the unknown gene. 2) Using the image, determine the total number of introns contained in the unknown gene.

1) 7 2) 6

Write all possible codons recognized by each of the given anticodons. 1) An anticodon strand reads 5'-UGA-3'. Fill in the missing base sequences for the possible codons recognized by the anticodon. 2) An anticodon strand reads 5'-CGA-3'. Fill in the missing base sequences for the possible codons recognized by the anticodon. 3) An anticodon strand reads 5'-IAG-3'. Fill in the missing base sequences for the possible codons recognized by the anticodon.

1) Codon: 5-UCA-3' Codon: 5'-UCG-3' 2) Codon: 5'-UCG-3' 3) Codon: 5'-CUU-3' Codon: 5'-CUA-3' Codon: 5'-CUC-3

Research pioneered in the nematode Caenorhabditis elegans identified a previously unknown mechanism of gene knockdown called RNA interference (Fire et al., 1998). By introducing double‑stranded RNA into a nematode, it is possible to significantly reduce homologous mRNA transcripts and thereby reduce the expression level of a specific gene of interest. The double‑stranded RNA is cleaved by a ribonuclease called Dicer, and the 20-22 base‑pair fragments then interact with the RNA‑induced silencing complex (RISC). Then, the complex binds to a homologous transcript and results in the degradation of the mRNA molecule. The nematode can then be analyzed for a phenotype using a variety of traditional approaches. RNAi is thus very useful to quickly perform reverse genetic analysis to study the function of a gene of interest. 1) What methods would be used to confirm that an RNAi knockdown experiment has worked? label the RNAi construct quantitative real‑time PCR verify phenotype presence genome sequencing 2) The RNAi treatment has been demonstrated to be effective using methods such as injection, feeding, and soaking of the animals (Fire et al., 1998; Tabara et al., 1998; Timmons and Fire, 1998). The relative ease of treatment methods and the short life cycle of the nematode means that large‑scale screens can be performed to assess entire chromosomes (Fraser et al., 2000) or even to conduct genome‑wide screens (Hanazawa et al., 2001; Kamath et al., 2003). What source would produce the most functional RNAi library for conducting genome‑wide screens?

1) Correct answers quantitative real‑time PCR verify phenotype presence 2) whole‑genome cDNA

In Florida, soapberry bugs (Jadera haematoloma) have historically fed upon balloon vines (Cardiospermum corindum), which produce large fruits year‑round. The insects that feed on these fruits have relatively long mouthparts. After a related plant, the goldenrain tree (Koelreuteria elegans), was introduced as an ornamental plant in Florida, some populations of soapberry bugs became specialists on goldenrain tree fruits, which produce small fruits seasonally. These specialized soapberry bug populations, on average, have shorter mouthparts (Carroll and Boyd, 1992) and mature more quickly than the populations that feed on balloon vines (Carroll et al., 2001). Natural selection requires variation in an inherited trait. 1) Select every example of variation in an inherited trait that enables soapberry bugs to use different host plants. location of soapberry bugs mouthpart length in soapberry bugs mouthpart color of soapberry bugs rate of maturation of soapberry bugs 2) Which outcome would you most expect to see if a population from a balloon vine were experimentally moved to a goldenrain tree? In other words, which would be consistent with evolution?

1) Correct answers mouthpart length in soapberry bugs rate of maturation of soapberry bugs 2) Over time, the proportion of individuals in the population with shorter mouthparts will increase.

1) Identify examples of reverse genetics. RNA interference mutation from wild‑type allele to mutant allele chromatin immunoprecipitation assay (ChIP) mutation from mutant allele to wild‑type allele gene knockout using site‑directed mutagenesis 2) Which statement represents the definition of a reversion (reverse mutation)?

1) Correct answers: RNA interference gene knockout using site‑directed mutagenesis 2) mutation from mutant allele to wild‑type allele

Dentatorubral‑pallidoluysian atrophy, DRPLA, is a trinucleotide‑repeat expansion disorder that is inherited in an autosomal dominant manner. The locus responsible for DRPLA is amplified by PCR in several young individuals who have a parent with the disease. The samples are analyzed by gel electrophoresis and the PCR product sizes are indicated in the image. 1) Which individuals are most likely to develop the disorder? 2) Which individual is likely to have the onset of DRPLA occur the earliest?

1) Correct answers: individual B individual D individual A 2) individual B

The mutated form of hemoglobin (hemoglobin S, or HbS) in sickle‑cell anemia results from the replacement of a glutamate residue by a valine residue at position 6 in the β chain of the protein. Normal hemoglobin is designated HbA. Under conditions of low [O2] , HbS aggregates and distorts the red blood cell into a sickle shape. See image of eight aggregated HbS molecules. Sickled red blood cells are relatively inflexible and may clog capillary beds, causing pain and tissue damage. The sickled red blood cells also have a shorter life span, leading to anemia. 1) Which amino acids would be expected to produce a similar sickling effect if substituted for Val at position phenylalanine arginine lysine leucine alanine 2) Sickling occurs in deoxyhemoglobin S but not in oxyhemoglobin S. Oxyhemoglobin has a small, hydrophobic pocket in a β chain region located in the interior of the protein. In deoxyhemoglobin, however, this pocket is located on the surface of the protein. In deoxyhemoglobin S, Val Choose two amino acids that would be reasonable candidates for the pocket-Val leucine phenylalanine glutamate arginine serine 3) How does HbS aggregation occur in sickle‑cell anemia? Place the steps in the correct order. Note that deoxyhemoglobin is in the T state; oxyhemoglobin is in the R state.

1) Correct answers: leucine alanine 2) Correct answers: leucine phenylalanine 3) See picture

In plants, an increase in ploidy is one common mechanism of evolution. 1) How does an increase in ploidy contribute to evolution? 2) Which statements address why polyploidy is more common in plants than in animals? Polyploid plants are always fertile, whereas polyploid animals are sterile. Behavioral isolation mechanisms prevent different animal species from interbreeding. Genome duplications, which result in polyploidy in plants, do not occur in animals. The developmental process for plants is less complex than animals. The process of cell division is more precise in animals than in plants.

1) New species can arise from crosses between two diploids followed by chromosome doubling. 2) Correct answers: Behavioral isolation mechanisms prevent different animal species from interbreeding. The developmental process for plants is less complex than animals.

Suppose a researcher investigates the pathway of synthesis of compound D. This compound is necessary for growth and survival in many fungi, including Neurospora species. He produces three mutants and places each mutant in each of four different growth supplements. The researcher records the production of compound D in this data table. 1) Based on this data set, what is the pathway that represents the synthesis of compound D? 2) Select every statement important in identifying the shape and order of the pathway. Mutant 3 synthesizes compound D in the presence of A but not B or C. B precedes C in the pathway for all of the mutants. Mutant 1 synthesizes compound D in the presence of B and C, but not A. Mutant 2 synthesizes compound D in the presence of B but not C.

1) See picture 2) Correct answers: Mutant 3 synthesizes compound D in the presence of A but not B or C. Mutant 1 synthesizes compound D in the presence of B and C, but not A.

In 1958, Meselson and Stahl conducted an experiment to determine which of the three proposed methods of DNA replication was correct. Identify the three proposed models for DNA replication. The Meselson and Stahl experiment starts with E. coli containing 15N/15N labeled DNA grown in 14N media. Which result did Meselson and Stahl observe by sedimentation equilibrium centrifugation to provide strong evidence for the semiconservative model of DNA replication?

1) See picture 2) The first generation has hybrid 15N/14N DNA and the second generation has both hybrid 15N/14N DNA and 14N/14N DNA. No 15N/15N DNA was observed.

1) Match each term to the correct definition. 2) Suppose the trait associated with additional fingers or toes, also called polydactyly, is present in an island population. Of those islanders with additional digits, 40% display fully‑formed additional digits and 60% display partially‑formed additional digits. After studying the entire island population, the researchers determine that only 80% of the islanders that carry one or more copies of the dominant polydactyly allele actually display any form of polydactyly.

1) See picture 2) The polydactyly allele has 80% penetrance and 40% expressivity.

The diagram, called a pictogram or sequence logo, is an alignment of nucleotide sequences from six species at 10 different positions. 1) Place the most highly conserved positions and the least conserved positions in an appropriate category. Some positions may not be placed. 2) A seventh species has the sequence ATGGAAGGTA for this region of the genome. Which of the six other species is the closest relative of the seventh species?

1) See picture 2) species 1

When the level of glucose in the environment is low, abundant cyclic adenosine monophosphate (cAMP) binds the catabolite activator protein (CAP) to form the CAP-cAMP complex, which binds DNA. When CAP-cAMP binds DNA, the efficiency of RNA polymerase binding is increased at the lac operon promoter, which increases transcription of the structural genes. However, when glucose levels are high, the CAP-cAMP complex does not form and RNA polymerase cannot bind to the promoter efficiently. 1) Is the lac operon inducible or repressible? 2) What type of protein regulates structural‑gene expression as a result of low glucose level? 3) What type of overall gene regulation occurs as a response to low glucose level?

1) inducible 2) activator 3) positive

Assume that the length of wheat leaves is controlled by three loci, each with two alleles: L and l, W and w, H and h. Determine the differences in leaf length between two homozygous strains of wheat. Assume each allele contributes equally to the length of the plant leaves. One homozygous strain, ll ww hh, has leaves that are 100 mm in length, and the other strain, LL WW HH, has 220 mm leaves. The two homozygous strains are crossed, and the resulting F1 are selfed to produce F2 progeny. 1) What length will the leaves of the ll WW HH genotype plant be? 2) What proportion of the F2 progeny will have the same phenotype as the ll WW HH genotype? Input answer as a decimal.

1) leaf length: 180mm 2) proportion: .2344

1) Select the post‑translational modifications of histones that are most commonly associated with changes in transcription levels in eukaryotes. 2) Which of the post‑translational modifications generally targets a protein for degradation in eukaryotes?

1) methylation and acetylation 2) ubiquitination

A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pk, bk, and op. pk is associated with pink eyes, bk is associated with a black body, and op is associated with opaque wings. A geneticist crosses this fly to a male pink, black, and opaque fly and obtains the 1000 progeny given in the table. 1) Based on the table, which genes are linked? 2) Calculate the distance between the linked genes.

1) pk and bk 2) 19

Certain amino acids are encoded by more than one codon. The table shows the number of different codons in the second column that encode a particular amino acid. The third column of the table shows the frequency of each amino acid in all protein‑coding regions of DNA for a hypothetical bacterial species. 1) What is the correlation between the number of different codons of an amino acid and the frequency of the amino acid in proteins for this bacteria? 2) What information would best further the understanding of the relationship between the number of amino acid codons and their frequency in proteins? the bacterial mRNA transcript sequences the frequencies of each individual codon the complete bacterial proteome the number of bacterial chromosomes

1) positive correlation 2) the bacterial mRNA transcript sequences the frequencies of each individual codon

Suppose a farmer is interested in developing a breeding program on his chicken farm. The farmer would like to artificially select for egg weight, egg shape, shell color, and shell thickness. In a large population of his chickens, the farmer has measured these four continuous egg traits of interest and calculated their variances, which are shown in the table. 1) Which trait would best respond to artificial selection by the farmer 2) Select all of the statements that identify how the farmer might utilize the information gained from his data. Identify quantitative trait loci correlated to each trait examined in the chicken population after obtaining genetic sequence data for his chicken population. Recommend a selective breeding program for a population of chickens from another country based on his results. Design an experiment to improve the weight trait in the current chicken population by changing the farm environment. Further inbreed the chickens on the farm with the largest egg weight to improve the overall phenotype.

1) shell color 2) Correct answers: Identify quantitative trait loci correlated to each trait examined in the chicken population after obtaining genetic sequence data for his chicken population. Design an experiment to improve the weight trait in the current chicken population by changing the farm environment.

Suppose a man is heterozygous for heterochromia, an autosomal dominant disorder which causes two different‑colored eyes in an individual, produced 25‑offspring with his normal‑eyed wife. Of their children, 14 were heterochromatic and 11 were‑normal. 1) Calculate the chi‑square value for this observation. 2) Identify the statement that best interprets the results of the chi‑square analysis. Refer to the chi‑square distribution table to identify the statement that best interprets the chi‑square results.

1) x^2 = 0.36 2) It is not unusal that a heterozygous man produced 14 out of 25 offspring with heterochromia.

Complete the transcription of the RNA sequence using the DNA template.

See picture

Determine all the possible modes of inheritance for the pedigrees.

See picture

Calculating probabilities is an important skill in genetics. It is used to determine an individual's chance of inheriting genetic diseases and to determine the chances of carrying a disease or genetic trait, as well as for a variety of other tasks, such as predicting the success of a cloning project. When you are trying to calculate the probability of two or more independent events occurring at the same time, use the product rule. An example of this would be the flipping of two coins simultaneously. If we want to calculate the probability of obtaining heads on both flipped coins, we simply take the probability of landing heads on the first coin (1/2) and multiply it by the probability of landing heads on the second coin (1/2). Thus, the probability of landing heads on both coins simultaneously is the product of the individual probabilities: 1/2×1/2=1/4 Whenever we are calculating the combined probability resulting from more than one independent event, we use the product rule. How many different DNA molecules 10 base pairs long are possible?

1048576

Enter the complementary sequence to the DNA strand shown. 5′- CGATGAGCC -3′

3' - GCTACTCGG - 5'

The inheritance pattern for sheep coat color exhibits incomplete dominance. A sheep that is homozygous for the black allele is crossed with a sheep that is homozygous for the white allele. What is the phenotypic outcome of the offspring that result from this cross?

All offspring have gray coats.

Charles II of Spain was born in 1661 and was the last member of the Hapsburg royal family to rule Spain. Charles's family was composed of numerous first cousin marriages and uncle and niece marriages for many generations. In the previous hundred years before his birth, outbreeding in his ancestral line had almost entirely stopped. As a likely result, Charles suffered from many physical, mental, and emotional disorders. He could not talk until age four and did not walk until age eight. He also had an enlarged tongue that made chewing and talking difficult. Despite two marriages, Charles was likely infertile and produced no heirs. The ancestry of Charles II of Spain is shown in the diagram. Suppose the two original ancestors, the Castiles, are not inbred and are unrelated. The coefficients of inbreeding (COI) have been determined for all of the common ancestors in the table, 𝐹𝑋, except for three. Use the individual COI calculations to determine the COI for Charles II of Spain using three significant figures.

COI of Charles II of Spain: .223

How does comparative genomics aid in the search for factors that contribute to complex human conditions?

Conserved genetic sequences likely influence similar phenotypic traits across species.

Select the examples of genetically modified organisms (GMOs). a farm‑raised chicken kept for laying eggs a farm‑raised pig engineered to digest food more efficiently a wild sunflower harvested for seeds a rice crop modified to contain more iron a wild fox hunted for fur

Correct Answers a farm‑raised pig engineered to digest food more efficiently a rice crop modified to contain more iron a wild fox hunted for fur

Which of the statements can be concluded from Gregor Mendel's experiments with pea plants? Alleles of different genes are inherited independently of each other. Offspring inherit two alleles per gene from each parent. A heterozygous phenotype is the same as a homozygous dominant phenotype. When a homozygous dominant parent is crossed with a homozygous recessive parent, 50% of the offspring have a dominant phenotype.

Correct Answers: Alleles of different genes are inherited independently of each other. A heterozygous phenotype is the same as a homozygous dominant phenotype.

In meiosis, a diploid cell divides into reproductive cells called gametes. The provided diagram shows chromosome separation during gamete production. Using the diagram, select the statements that are true about Mendel's law of segregation. Options: All gametes carry the same alleles. Each parent provides one allele for each gene. Each gamete carries one version of each gene. Both chromosomes in a pair are identical.

Correct Answers: Each parent provides one allele for each gene. Each gamete carries one version of each gene.

An analysis is performed to determine the proportions of each of the four nucleotide bases in the DNA of several tissue samples from various species. The results appear in the table. Which conclusions can be drawn from this data? The proportion of T is roughly equal to the proportion of A. The proportion of pyrimidines is roughly equal to the proportion of purines. The proportion of G is roughly equal to the proportion of C. The proportion of A-T base pairs is roughly equal to the proportion of G-C base pairs.

Correct Answers: The proportion of T is roughly equal to the proportion of A. The proportion of pyrimidines is roughly equal to the proportion of purines. The proportion of G is roughly equal to the proportion of C.

At the end of your biology class, your professor asks you to develop a project to determine the genotype of a plant with red flowers. Red petal color (R) is dominant to pink flower color (r). To accomplish this task, you cross the plant with the unknown genotype with heterozygous red‑flowered plants. A partially filled Punnett square is provided. Which ratios are valid predictions of flower colors in the offspring? all red flowers 3 red : 1 pink flowers all pink flowers 1 red : 3 pink flowers

Correct Answers: all red flowers 3 red : 1 pink flowers

Which of the statements are ways that modern geneticists are addressing medical, social, or industrial problems? developing genetic tests for conditions so that patients can receive appropriate preventive care studying viral genetics to learn how to control the spread of infectious diseases learning how to clone humans to obtain organs for replacing failing or damaged ones improving the nutritional value of agricultural crops through genetic modification

Correct Answers: developing genetic tests for conditions so that patients can receive appropriate preventive care studying viral genetics to learn how to control the spread of infectious diseases improving the nutritional value of agricultural crops through genetic modification

James Watson and Francis Crick used this X‑ray diffraction image taken by Rosalind Franklin to deduce structural properties of B‑form DNA. What findings did Watson and Crick make from this image? contains equal proportions of purines and pyrimidines includes 10 base pairs per repeat has genes that encode proteins shaped like a helix has a consistent diameter

Correct Answers: includes 10 base pairs per repeat shaped like a helix has a consistent diameter

Which of the statements are reasons why rhinoceroses would be a poor choice as model organisms for studying ovarian cancer? They are needlessly large when smaller, more easily handled organisms, such as mice, are available. They are inappropriate for experimental manipulation because they are an endangered species. They do not get ovarian cancer are thus inappropriate models for ovarian cancer research. They produce very few offspring at a time and thus require a lot of time to collect meaningful data.

Correct Answers: They are needlessly large when smaller, more easily handled organisms, such as mice, are available. They are inappropriate for experimental manipulation because they are an endangered species. They produce very few offspring at a time and thus require a lot of time to collect meaningful data.

During his experiments with pea plants, Gregor Mendel crossed plants that were heterozygous for two traits with one another in order to determine laws of inheritance. The Punnett square shows the results of this cross. Select the statements that are true about Mendel's law of independent assortment. A dihybrid cross between heterozygous individuals will result in exactly four phenotypes. A dihybrid cross between heterozygous individuals will result in exactly three genotypes. Dominant alleles will always segregate together during gamete formation. During gamete formation, alleles for each gene segregate independently of one another.

Correct answers: A dihybrid cross between heterozygous individuals will result in exactly four phenotypes. During gamete formation, alleles for each gene segregate independently of one another.

Which statements are true regarding how advancements in genetics have impacted society today? Animal model manipulation has expanded our understanding of human disease. Genetic testing has brought attention to our legislation on individual biological privacy. Industrial services have decreased their environmental footprint by using microbes to decrease waste products. Genetic testing has eliminated the need for traditional preventative medicine.

Correct answers: Animal model manipulation has expanded our understanding of human disease. Genetic testing has brought attention to our legislation on individual biological privacy. Industrial services have decreased their environmental footprint by using microbes to decrease waste products.

Which of the sequences listed are possible flanking sequences that could be generated by a transposon insertion after the first six base pairs of the target sequence GATCCTGGCATA? ATACGG CTAGGA GATTAG TCCTAG GATCCT

Correct answers: CTAGGA GATCCT

The codon table identifies the amino acid sequence that can be translated from a human mRNA sequence. This chart can also be used to identify amino acid sequences for other organisms. Select all of the organisms that use the codon assignments shown in the codon table. oak tree mouse Escherichia coli whale shark rattlesnake

Correct answers: oak tree mouse Escherichia coli whale shark rattlesnake

The Siamese cat breed has a light‑colored body and dark‑colored head, tail, and feet, all of which are called points. The Burmese cat breed has a dark‑colored body and points that are almost the same color as the body. Crossing Siamese with Burmese can produce the Tonkinese cat breed, which has coat and point color that is intermediate to the Siamese and Burmese parents. In all three breeds, a temperature‑sensitive enzyme is responsible for the dark coloration of the points. However, it is active only at the extremes of the body where it is coolest. Select the statements that are true regarding the evidence of incomplete dominance and incomplete penetrance in Siamese, Burmese, and Tonkinese breeds. Burmese with dark color at the head, tail, and feet demonstrates incomplete dominance. Development of points in Burmese demonstrates incomplete penetrance. Intermediate point color in Tonkinese demonstrates incomplete penetrance. Intermediate point color in Tonkinese demonstrates incomplete dominance.

Correct answers: Development of points in Burmese demonstrates incomplete penetrance. Intermediate point color in Tonkinese demonstrates incomplete dominance.

An experiment was conducted to determine the effects of a novel promoter on the transcription of a gene. The cloned promoter and coding regions were ligated to luciferase, a reporter gene. Several regions of DNA in the promoter region were deleted. Each construct was transformed into cells, and the luciferase activity was measured. The data from the experiment is listed in the table. Which conclusions can be drawn from the data? Region D does not contain any response elements. Silencers bind repressors and are located in region C. Expression of the gene is reduced when region C is deleted because enhancers are deleted. Transcription increases when region A is deleted because the promoter region is located in region A. Transcription binding sites are not found in region B.

Correct answers: Expression of the gene is reduced when region C is deleted because enhancers are deleted. Transcription binding sites are not found in region B.

The GAL gene system in yeast is a eukaryotic gene regulation model system. In this gene system, GAL1 is a structural gene. The regulatory gene GAL4 is required for transcription of GAL genes. Additionally, GAL80 is a negative regulator of GAL4, and GAL3 is required to disrupt the interference of GAL80 with GAL4 so transcription can proceed. In the figure, 80 represents Gal80p, which is the protein produced by GAL80, and 4 represents Gal4p, which is the protein produced by GAL4. Refer to the figure to determine what would inhibit transcription of GAL1 by preventing contact of the Gal4p activating domain and other proteins. GAL4 mutation that prevents encoding of amino acids 148‑768 GAL80 deletion GAL80 mutation that prevents disruption of the Gal80p-Gal4p complex GAL3 mutation that prevents interaction with Gal80p

Correct answers: GAL80 mutation that prevents disruption of the Gal80p-Gal4p complex GAL3 mutation that prevents interaction with Gal80p

Identify the statements that are features of a promoter. In eukaryotes, the promoter recruits the preinitiation complex, which includes the TATA‑binding protein. In both prokaryotes and eukaryotes, the promoter is located in the 5′ direction, upstream from the transcription start site. In eukaryotes, the promoter attracts the small and large ribosomal subunits with the help of initiation factors. In prokaryotes, the promoter is recognized by general transcription factors (GTF), which recruit the RNA polymerase holoenzyme. In prokaryotes, the promoter contains a -35 and -10 region upstream of the transcription start site.

Correct answers: In eukaryotes, the promoter recruits the preinitiation complex, which includes the TATA‑binding protein. In both prokaryotes and eukaryotes, the promoter is located in the 5′ direction, upstream from the transcription start site. In prokaryotes, the promoter contains a -35 and -10 region upstream of the transcription start site.

Which of the statements describe how inducers cause changes in gene expression? Inducers bind to repressor proteins and prevent the repressor from inhibiting transcription. Inducers enhance transcription of all genes. Inducers are proteins that bind to DNA to enhance transcription of target genes. Inducers are ions that are essential for the function of RNA polymerase. Inducers allow transcription of specific genes.

Correct answers: Inducers bind to repressor proteins and prevent the repressor from inhibiting transcription. Inducers allow transcription of specific genes.

In eukaryotes, extranuclear inheritance occurs when genetic information is transmitted by mechanisms other than through nuclear DNA. Mitochondrial DNA (mtDNA) is an example of one mechanism by which extranuclear inheritance can occur. Select the statements that correctly describe mtDNA. mtDNA is typically inherited from both parents. Mitochondrial chromosomes contain genes that are involved in oxidative phosphorylation. Mitochondrial chromosome size and gene content are identical in all organisms. mtDNA organization is more similar to that of prokaryotes than eukaryotes.

Correct answers: Mitochondrial chromosomes contain genes that are involved in oxidative phosphorylation. mtDNA organization is more similar to that of prokaryotes than eukaryotes.

Meiosis and mitosis are both forms of cell division. However, the outcomes of these processes differ. Consider a diploid organism with two sexes. Select the reasons why meiosis typically produces genetic variation, whereas mitosis does not. Mitosis produces two identical diploid daughter cells. 1n gametes produced in mitosis fuse to produce 2n cells in meiosis. Gametic chromosomes have a different combination of alleles than parental chromosomes as a result of independent assortment. Sister chromatids are not genetically identical as a result of crossing over during meiosis.

Correct answers: Mitosis produces two identical diploid daughter cells. Gametic chromosomes have a different combination of alleles than parental chromosomes as a result of independent assortment. Sister chromatids are not genetically identical as a result of crossing over during meiosis.

Select the statements that describe the effect of copy number variation on human phenotypes. An increase in copy number can cause gene function loss due to chromosome breaks. Oncogene overexpression due to a gain in copy number can cause cancer. Increase in the copy number of immunity genes can result in increased pathogen resistance. Copy number variations are associated with complex disorders such as autism. A decrease in copy number can cause Mendelian autosomal disorders due to point mutations.

Correct answers: Oncogene overexpression due to a gain in copy number can cause cancer. Increase in the copy number of immunity genes can result in increased pathogen resistance. Copy number variations are associated with complex disorders such as autism.

Suppose a researcher conducts a genome‑wide association study (GWAS) protocol. Phenotypic data for a number of traits, including milk production, are collected from a large population of 1,526 cows, including a case and control group. Over 2 million single‑nucleotide polymorphisms (SNPs) are genotyped for each cow sample. After an initial analysis, the data suggest that the milk production trait evolved differently in different groups of the cow population, and, therefore, it appears there is some bias in the sample for another trait, coat color. The results of the GWAS for milk production show the SNPs are also associated with coat color and have a very strong 𝑝 ‑value. Select the methods that the researcher may use to determine if the causal mutation of the coat color trait is in the same region as the marker for the milk production trait or if the association is a result of the inherent bias in the data. Remove the genetic data associated with coat color because eliminating data should remove the effect of coat color on the results for milk production. Collect additional individual samples and rerun the analysis. Perform an analysis of linkage disequilibrium (LD) on the genetic data, and determine whether the associated SNPs are in LD. Run the association analysis again, including coat color as a covariate of milk production, which should remove the effect of coat color on the results. Identify population structure using a program such as STRUCTURE to determine if population structure should be included as a covariate to remove bias in the results.

Correct answers: Perform an analysis of linkage disequilibrium (LD) on the genetic data, and determine whether the associated SNPs are in LD. Run the association analysis again, including coat color as a covariate of milk production, which should remove the effect of coat color on the results. Identify population structure using a program such as STRUCTURE to determine if population structure should be included as a covariate to remove bias in the results.

The HbS allele causes sickle‑cell anemia in the homozygous state and protects against malarial parasites in the heterozygous state. The frequency of the HbS allele exceeds 10% in some regions of central Africa. The HbS allele frequencies are higher in most regions in Africa than in Europe. Malaria is more common in Africa than in Asia. There are more cases of sickle‑cell anemia South America than in North America. The HbS allele is not found in Greenland.

Correct answers: The frequency of the HbS allele exceeds 10% in some regions of central Africa. The HbS allele frequencies are higher in most regions in Africa than in Europe.

Consider the information presented in the phylogenetic tree. Choose the true statements using the information presented in the phylogenetic tree. The mountain zebra is more closely related to the wild ass than to the half ass. The Przewalski horse is the ancestor of the Grevy zebra. The horses and zebras share approximately 93% of their genomic sequence. The percentage similarity between two species can be calculated by tracing the branch length. The Przewalski horse is more closely related to any zebra than to the wild ass.

Correct answers: The mountain zebra is more closely related to the wild ass than to the half ass. The horses and zebras share approximately 93% of their genomic sequence. The percentage similarity between two species can be calculated by tracing the branch length.

Consider the amino acid sequence. Serine−Alanine−Proline−Aspartic acid Use the codon table to answer the question. Identify the mRNA codon sequences that would be translated into this amino acid sequence. UCC-GCA-CCA-GAC UCU-GCU-CCU-GAC UCA-GUA-CCA-AAU UCA-GCG-CCC-GAU CCA-GCA-UCC-GAC

Correct answers: UCC-GCA-CCA-GAC UCU-GCU-CCU-GAC UCA-GCG-CCC-GAU

Cotyledon orbiculata, or pig's ear, is a succulent fynbos plant from South Africa whose juice is used as a treatment for epilepsy. Suppose three South African populations of C. orbiculata were collected and characterized by DNA sequencing across a sequential 8‑kb interval of the nuclear genome. The data was summarized into haplotype data for each of the three populations and shows the number of individuals with each haplotype in each population and the SNPs at each collected loci. Select all of the haplotypes that are unique to a single population of C. orbiculata. West_SA‑1 West_SA‑4 Central_SA‑3 East_SA‑4 East_SA-3

Correct answers: West_SA‑4 Central_SA‑3 East_SA-3

Which of the mutations described have the potential to cause cancer? a gain‑of‑function mutation in a proto‑oncogene a gain‑of‑function mutation in a tumor suppressor gene a loss‑of‑function mutation in a proto‑oncogene a loss‑of‑function mutation in a tumor suppressor gene

Correct answers: a gain‑of‑function mutation in a proto‑oncogene a loss‑of‑function mutation in a tumor suppressor gene

How are proteins regulated after translation? fewer mRNA molecules can be transcribed to produce fewer proteins active proteins can be inactivated by feedback inhibition proteins can be tagged with ubiquitin molecules and subsequently degraded proteins that are no longer required can be transported out of the cell inactive proteins can be activated by covalent modification

Correct answers: active proteins can be inactivated by feedback inhibition proteins can be tagged with ubiquitin molecules and subsequently degraded inactive proteins can be activated by covalent modification

How are single nucleotide polymorphisms (SNPs) used to add to the understanding of human evolution? compare alleles in protein‑coding regions that differ between groups of humans show how variation among humans compares to variation among great apes identify ways in which humans are evolving at the present time estimate the points in time when human evolutionary changes took place

Correct answers: compare alleles in protein‑coding regions that differ between groups of humans show how variation among humans compares to variation among great apes estimate the points in time when human evolutionary changes took place

Transposons are movable elements of DNA that insert into new positions within the genome. A transposon may disrupt normal gene function, confer an evolutionary advantage, or have no effect on the organism. Select all scenarios in which a transposon has positively contributed to the evolution of the host's genome. insertion of a transposon encoding a heat shock protein into the genome of a plant acquisition of a transposon carrying a gene resistant to penicillin into a bacterium aquisition of a transposon carrying an adhesin gene into the Lactobacillus casei genome acquisition of a transposon that disrupts the promoter element of a breast cancer tumor‑suppressor gene insertion of a transposon into the gene encoding for dystrophin, a protein involved in skeletal movement and cardiac function

Correct answers: insertion of a transposon encoding a heat shock protein into the genome of a plant acquisition of a transposon carrying a gene resistant to penicillin into a bacterium aquisition of a transposon carrying an adhesin gene into the Lactobacillus casei genome

Select the typical features of a typical retrovirus. single‑stranded DNA RNA polymerase transposase integrase single‑stranded RNA reverse transcriptase

Correct answers: integrase single‑stranded RNA reverse transcriptase

The speckled rattlesnake is a non‑model organism with no reference genome sequence. How could the speckled rattlesnake genome be characterized to perform future studies? perform fluorescence in situ hybridization using expressed sequence tags perform exome sequencing using next‑generation sequencing methods use short‑read next‑generation sequencing methods to characterize the genome use long‑read next‑generation sequencing methods to characterize the genome

Correct answers: perform fluorescence in situ hybridization using expressed sequence tags use long‑read next‑generation sequencing methods to characterize the genome

The trp operon contains five genes: trpE, trpD, trpC, trpB, and trpA. These five genes code for components that produce three enzymes that catalyze the biosynthesis of tryptophan. The trpL region is the leader region, which helps regulate transcription once RNA polymerase has initiated transcription. The trp operon also undergoes negative regulation by a repressor. Tryptophan is the signal molecule (effector molecule) that binds to the repressor. Determine which events lead to an increase in transcription. The trp operon is transcribed when tryptophan is present at low concentrations inside the cell. tryptophan binds to the repressor. the trp repressor is active. the trp repressor is bound to the operator. the trp repressor dissociates from DNA.

Correct answers: tryptophan is present at low concentrations inside the cell. the trp repressor dissociates from DNA.

Select which examples are induced mutations. Errors in DNA replication cause the formation of point mutations. Ionizing radiation causes chromosomal fragmentation. Transposition causes the formation of deletions. Nitrous acid causes the deamination of cytosine to uracil.

Correct answers: Ionizing radiation causes chromosomal fragmentation. Nitrous acid causes the deamination of cytosine to uracil.

Choose the correct statements about proteins and evolution. The tertiary structure of a protein is less conserved than the primary structure. Paralogs are derived from a common ancestor but often have different functions. Lupine leghemoglobin and human α‑hemoglobin are only about 16% identical. This is an example of convergent evolution. Percent identity for a random alignment of two nucleic acids is likely to be higher than the percent identity for an equal‑length random alignment of two polypeptide segments. Two proteins that have similar tertiary structures are said to be homologous.

Correct answers: Paralogs are derived from a common ancestor but often have different functions. Percent identity for a random alignment of two nucleic acids is likely to be higher than the percent identity for an equal‑length random alignment of two polypeptide segments.

Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start codon is position +1. a transition at position +6 in the sense strand a single nucleotide deletion at position +12 in the antisense strand a G nucleotide insertion at position +2 in the sense strand a substitution of a U nucleotide at position +9 in the antisense strand a transversion of A in the histidine codon of the antisense strand a substitution from G to T in the arginine codon of the antisense stand

Correct answers: a transition at position +6 in the sense strand a substitution from G to T in the arginine codon of the antisense stand

Select the causes for potential errors in DNA replication. mismatching due to wobble pairing of bases cleavage of chromosomes due to gamma radiation replication slippage due to looping out of bases during replication of repetitive DNA alkylation of bases due to nitrosoguanidine exposure

Correct answers: mismatching due to wobble pairing of bases replication slippage due to looping out of bases during replication of repetitive DNA

Select the examples of how fragile sites can be responsible for phenotypic abnormalities. reduction in gene expression due to DNA structure constriction Mendelian autosomal disorders caused by point mutations duplication of genomic region increases gene expression loss of gene function due to centromere loss increase in incidence of cancer due to disruption of tumor suppressor genes

Correct answers: reduction in gene expression due to DNA structure constriction loss of gene function due to centromere loss increase in incidence of cancer due to disruption of tumor suppressor genes

A cell with mutated DNA may not be able to produce proteins accurately. Which situations can lead to mutations in the DNA? ultraviolet radiation exposure mistakes in mRNA splicing chemicals in some pesticides excess pyruvate from glycolysis uncorrected DNA replication errors

Correct answers: ultraviolet radiation exposure chemicals in some pesticides uncorrected DNA replication errors

Most scientists consider the Human Genome Project (HGP) to be the most significant scientific project of the 21st century. Choose the statements that describe the key findings of the Human Genome Project. The human genome contains approximately 25000 genes. The genetic information of a cell is stored in the form of DNA. DNA exists in a double helical form. There are 23 pairs of chromosomes that make up the human genome. There are approximately three billion base pairs in the human genome.

Correct answers: The human genome contains approximately 25000 genes. There are approximately three billion base pairs in the human genome.

Which of the statements describe an aspect of a distribution? the occurrence of cystic fibrosis in three family members the mean weight of channel catfish in the Mississippi River the color of a bullfrog's skin the variance of the number of vertebrae in the eelpout fish the weight of a mature cocker spaniel

Correct answers: (have to do with populations) the mean weight of channel catfish in the Mississippi River the variance of the number of vertebrae in the eelpout fish

Suppose a team of researchers sequences the genome and measures the proteome of a human skin cell and a human kidney cell. Will there be a greater difference between the genome or the proteome between these two cells?

Differences in gene expression and post-transcriptional mRNA processing lead to a greater difference in the proteome than the genome between the two cells.

DNA damage can occur as a result of exposure to chemicals or ultraviolet radiation. What happens during nucleotide excision repair of damaged DNA?

Enzymes unwind the DNA, cut out a section on one stand that contains the DNA damage, and resynthesize the section with the correct DNA sequence.

Human ABO blood groups are controlled by a single gene with three alleles 𝐼𝐴, 𝐼𝐵, and 𝑖. The three alleles contribute to four blood group phenotypes. In addition to the ABO blood groups, there are two other loci that control blood phenotypes, the MN blood group locus and the Rh factor locus. The MN blood group has two codominant alleles, 𝐿𝑀 and 𝐿𝑁. The Rh factor locus also has two alleles, 𝑅ℎ+ and 𝑅ℎ−, where 𝑅ℎ+ is dominant. The two phenotypes at the Rh factor locus are 𝑅ℎ+ and 𝑅ℎ−. Suppose in a population, the frequency of the ABO allele 𝐼𝐴 is 0.36, and the 𝐼𝐵 allele frequency is 0.26. In the same population, the frequency of the 𝐿𝑀 allele is 0.47, and the frequency of the 𝑅ℎ+ is 0.62. What is the frequency of the genotype 𝑖𝑖 𝐿𝑀𝐿𝑁 𝑅ℎ+𝑅ℎ− if the population is in Hardy-Weinberg equilibrium?

Frequency: .038

Which statement explains why the recombination frequency between two genes is always less than 50%?

Genes with a recombination frequency near 50% are unlinked and have an equal likelihood of being inherited together or separately.

Which of the following statements describes the function of the sigma factor in prokaryotic transcription?

It guides RNA polymerase to the promoter to initiate transcription.

Use the natural selection interactive to answer the question. Suppose that the predator (the bird) saw no difference between the colors gray and light brown. What would the most likely effect be on the light brown background trial?

Light brown and gray subpopulations would rise more than the dark brown subpopulation.

The phylogenetic tree shows the evolutionary relationships of three hypothetical species of rats, with mice as the outgroup. In a region of the genome, the nucleotides at positions 2 and 5, shown in orange, vary among these four species of rats. Identify the ancestral and derived alleles for the two loci.

Locus 2: C, ancestral; T, derivedlocus 5: T, ancestral; A, derived

How does cancer differ from most other genetic disorders?

Most genetic disorders are inherited through germ cells from parents. Most cancers are, to some extent, the result of mutations in somatic cells that occur during an organism's lifetime.

Suppose scientists studying pigmentation in Arabidopsis attempted to alter expression of a pigment gene. Using transgenic techniques, multiple copies of the pigment gene were inserted into homozygous and heterozygous individuals. This was expected to darken the pigmentation of the plants. Instead of increased pigment production, the additional gene copies often reduced or completely inhibited the pigment gene expression. One explanation for this unexpected result is that high concentrations of mRNA are produced. This, in turn, increases the likelihood of homologous regions of mRNA binding with one another and forming double stranded molecules. Double stranded RNA is often unstable and rapidly degraded by enzymes in the cell. Choose a term that describes this mechanism of reduced gene expression.

RNA interference

The color distribution for a specific population of lizards is 170 red, 50 orange, and 30 yellow. The allele for the color red is represented by RR, whereas the allele for the color yellow is represented by RY. Both alleles demonstrate incomplete dominance. What are the genotype frequencies in the population? Calculate to at least two decimal places.

RRRR : .68 RRRY : .20 RYRY : .12 What is the allele frequency of RR in this population? Calculate to at least two decimal places. = .78

What evidence from the Hershey-Chase experiment demonstrated that DNA, not protein, is the genetic material?

Radio-labeled DNA persisted through generations of phage after infection, whereas labeled protein did not persist.

A manhattan plot is generated from a genome‑wide association study, GWAS, of the rolling trait in Caenorhabditis elegans. Order the significance of the labeled single nucleotide polymorphisms, SNPs, in order from the highest significance to the lowest significance for the manhattan plot.

See picture

A pedigree chart uses specific symbols to indicate presence or absence of a genetic trait in members of a family. Use the labels to identify the family member or pair of family members in this pedigree that match each description.

See picture

An operon is a group of genes under the control of a single promoter. Match each type of operon with the descriptions.

See picture

Ann's family has a history of cystic fibrosis, a recessive genetic disease. In the pedigree, family members who are afflicted with the disease are shown in red. Members who are unafflicted may or may not be carriers. Which of the given family members can be identified definitively as unafflicted carriers of cystic fibrosis?

See picture

Classify each action as belonging to genetics, genomics, or both.

See picture

Classify each example or definition as applying to either genotype or phenotype.

See picture

Classify each mutation example as definitely positive, definitely negative, or most likely neutral. Each category has two examples.

See picture

Classify each of the characteristics as pertaining to gene regulation in either prokaryotes or eukaryotes.

See picture

Classify each statement about the heritability of a phenotype according to the narrow‑sense heritability value it describes.

See picture

Classify the given examples of prokaryotic gene expression as positive or negative gene regulation.

See picture

Complete the table by matching each RNA type and abbreviation with the appropriate function.

See picture

Due to their unique shapes, bird bills can be used to help distinguish between different species. Bird bills are adapted to the food and feeding behavior of a particular species. Match the features of different bills to the appropriate image.

See picture

Each statement describes a characteristic of translation. Translation is a process that differs in prokaryotic and eukaryotic cells. Classify each statement according to whether it occurs in eukaryotic cells, prokaryotic cells, or both.

See picture

Gene therapy can potentially correct medical conditions resulting from a nonfunctioning gene within a cell. Arrange the steps of the procedure for using a virus as a vector in gene therapy in the correct order.

See picture

Gene therapy requires the transfer of a gene of interest into target cells using a vector. In gene therapy, there are different types of vectors being explored and customized as a means of gene transfer to treat different disorders. Order the steps of gene transfer methods for gene therapy using the nonviral vector approach. All steps will be placed.

See picture

Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs from right to left for gene C, as in the diagram.

See picture

Identify which statements apply to the ribosome, RNA polymerase II, or both in eukaryotic cells.

See picture

In eukaryotes, transcription factors and enhancer sequences are used to regulate transcription. Classify the statements as true or false.

See picture

In the fruit fly Drosophila melanogaster, a transposable element, called a P element, encodes its own tranposase and a protein that represses transposition. Provided the given crosses, determine if the progeny will be fertile or infertile.

See picture

In the replication fork, label the leading and lagging strands and the 5′ and 3′ ends of the DNA and RNA molecules. The 5′ and 3′ labels are used multiple times.

See picture

Label each element involved in bacterial transcription in the figure.

See picture

Label the indicated components of the DNA double helix.

See picture

Leigh's disease is a mitochondrially inherited disease with symptoms that include seizures, fatigue, impaired reflexes, breathing problems, and ataxia. The pedigree shows the presence of Leigh's disease in three generations. Individual 4 had two daughters and one son, and individual 6 had one daughter and two sons. Which of the individuals indicated are affected by Leigh's disease? Place the correct symbols on the pedigree showing affected and unaffected individuals.

See picture

Match each definition and example to the type of transposon.

See picture

Match each definition to the appropriate term.

See picture

Match each definition to the level of protein structure. Match each example to the level of protein structure.

See picture

Match each definition with the corresponding term concerning genes involved in tumor formation.

See picture

Match each description to the term it defines.

See picture

Match each term with its definition.

See picture

Match the statements with the correct types of DNA repair systems. Not all statements will be used.

See picture

MicroRNA (miRNA) production occurs in several steps. Arrange the statements describing the production and function of miRNAs in the order in which they occur.

See picture

Modifications to chromatin can affect transcriptional activity by changing the accessibility of DNA to the transcription machinery. The given descriptions are examples of various processes that may or may not cause remodeling of chromatin. Match each description to the effect it has on transcriptional activity caused by chromatin remodeling.

See picture

Multiple proteins are involved in DNA replication, and each protein has a unique role. Use the image to visualize some of these proteins. Note that DNA topoisomerase and DNA polymerase I are not shown. Match each protein to its role in DNA replication.

See picture

Petal color for the foxglove flower exhibits dominant epistasis. The red pigment and pigment localization are controlled by different and unlinked genes. The D gene controls the intensity of the pigment and the W gene controls how the pigment is dispersed throughout the petal. For each foxglove flower, select the genotype that could result in the petal color.

See picture

Place each step of retrotransposition in the order in which it occurs.

See picture

Place the events that take place during translation and protein synthesis in the correct order.

See picture

Place the steps of chromatin immuno‑precipitation (ChIP) in order from first to last.

See picture

Place the steps of eukaryotic DNA replication in order, from when a germ cell enters gap 1 (G1) phase to the cell cycle termination.

See picture

Place the steps of the double-strand break model of recombination in order.

See picture

Sequence the steps of DNA transposon replication to a target sequence in a circular piece of DNA.

See picture

Some characteristics of DNA are shared between all living organisms, whereas other characteristics of DNA differ between organisms. Classify DNA characteristics as either being a universal attribute of DNA or an attribute of DNA that is unique to particular individuals or species.

See picture

Suppose Melissa started growing four o'clock plants, Mirabilis jalapa, in her garden. She noticed that the plants have white, green, or patchy white and green (variegated) leaves. Melissa would like to have only four o'clock plants with variegated leaves, so she crosses a few of her plants to see which crosses produce offspring with variegated leaves. She knows that leaf color is determined by the color of the chloroplasts. For each cross, determine the offspring phenotypes that could be observed. Each cross may produce plants with one or more different phenotypes.

See picture

Suppose a study is being conducted to understand the potential heritability of artistic ability. Specifically, the study wants to recruit pairs of monozygotic and dizygotic twins raised in the same or different environments. For each scenario, what is the theoretical genetic variance and environmental variance?

See picture

Suppose a study is being conducted to understand the potential heritability of artistic ability. Specifically, the study wants to recruit pairs of monozygotic and dizygotic twins raised in the same or in different environments. For each scenario, what is the theoretical genetic variance and environmental variance?

See picture

Suppose that during an experiment examining how transposable elements (TEs) function in maize, several mechanisms of transposition are identified. It is determined that Ac encodes the transposase enzyme necessary for transposition, and Ds is the transposable element itself. Purebreeding maize stock that contains the TE and the dominant purple kernel gene, C, is crossed with purebreeding maize stock that does not contain the TE, but contains recessive yellow kernels, c.

See picture

Suppose that you are studying an inducible operon that contains two genes required for the metabolism of compound xyz. Gene A encodes enzyme A, and gene B encodes enzyme B. When compound xyz is absent, the operon is repressed, but when compound xyz is present, the operon is induced. You have isolated four distinct mutants, numbered 1, 2, 3, and 4, which have the effects shown in the table, where + indicates that the enzyme is synthesized and − indicates that the enzyme is not synthesized. Identify the component of the operon that is mutated in each mutant.

See picture

Suppose that, to determine the role of various enzymes in the tryptophan pathway, a research scientist created three mutant bacteria strains, wherein each mutant strain corresponds to an inactivated enzyme. Mutant 1 has an inactivated enzyme 1, mutant 2 has an inactivated enzyme 2, and mutant 3 has an inactivated enzyme 3. The scientist then attempted to grow these strains on media with different supplements. Use the depicted biochemical pathway to complete the predicted growth table for each mutant on minimal media plus the specified added supplement, where + indicates growth and 0 indicates no growth.

See picture

Suppose there are two alleles for gene C, C1 and C2. C1C1, C1C2, and C2C2 are the three possible genotypes. The fitness for genotype C1C1 is represented by W11, C1C2 is represented by W12 and C2C2 is represented by W22. Match the correct change in fitness to each natural selection event.

See picture

The APC gene and the CTNNB1 gene interact to affect the likelihood of colon cancer. Beta‑catenin, the product of the CTNNB1 gene promotes mitosis, and the APC protein blocks beta‑catenin to prevent mitosis from occurring too often. Classify the genotypes into categories that describe the likelihood of colon cancer in individuals with each genotype. A plus (+) indicates a wild type allele, and a minus (−) indicates that the gene has been deleted.

See picture

The Ames test determines the frequency with which a chemical causes mutations in DNA. The results of the Ames test for the substances A, B, and C are provided. Label the carcinogenic potential of each of these substances based on the production of his+ revertants in the presence or absence of liver extract (± LE).

See picture

The bacteria Streptococcus pneumoniae has a virulent S strain and a nonvirulent R strain. The S strain is lethal to mice. The S strain contains a chemical factor that can transform the R strain to be virulent. The diagram shows a series of experiments conducted by injecting combinations of these strains into mice to identify the transforming factor. If DNA is the transforming factor, match the expected results of each experiment by placing the appropriate mouse image.

See picture

The diagram depicts DNA that is undergoing replication. Identify the components of the replication process.

See picture

The diagram depicts the general structure of DNA, with a single nucleotide circled. Label the diagram with the names of the three components of a nucleotide.

See picture

The dominance pattern of a gene can be determined from the phenotypes of the parents and offspring. In the examples below, assume that each parent is homozygous for the specific allele and that the progeny are heterozygous. Classify each example as either complete dominance, incomplete dominance, or codominance.

See picture

The genetic map shows the location of three genes on a chromosome. Order the gene pairs based on their likelihood of recombining from most likely to least likely to recombine.

See picture

The given DNA non‑template sequence (coding sequence) is transcribed from 5' to 3'. Use the sequence to determine the type of mutation and the type of base substitutions that apply to each scenario. Place only one statement for each scenario. 5' A T G T T A C G C C C A A G C 3'

See picture

The lac operon consists of a promoter that initiates transcription of the gene i, which encodes a repressor protein. A separate promoter, p, within the operon initiates transcription of z, which encodes β‑galactosidase, and y, which encodes permease. The operator, o, where the repressor protein binds to inhibit transcription, is positioned between the promoter and the permease and β‑galactosidase genes. The superscript u denotes uninducible mutations, whereas superscript c denotes a constitutively active mutant. The table describes the activity of β‑galactosidase and permease for haploid and diploid mutant strains. Match the dominant type of regulation controlling permease expression to each mutant strain.

See picture

The lac operon contains three genes: lacZ, lacY, and lacA for β‑galactosidase, galactoside permease, and thiogalactoside transacetylase, respectively. The operon also contains a promoter site and an operator site. The regulatory gene includes the I gene for the Lac repressor protein and a promoter for that gene. The lac operon undergoes negative regulation. In the normal condition, the Lac repressor protein is active. Allolactose, an isomer of lactose, is the signal molecule that binds to the Lac repressor. Determine which events will increase the concentration of lac gene products and which will decrease the concentration of lac gene products.

See picture

The scatterplots show the relationship between forearm length and nose length for four groups of students. Match each description of a correlation with the appropriate scatterplot.

See picture

The trp operon is composed of the structural genes, the promoter (P), and the operator (O). The trp repressor binds to the operator and blocks transcription. Select the image that correctly orders the three components of the trp operon and identifies, with an arrow, the component to which the trp repressor binds.

See picture

The yeast Saccharomyces cerevisiae has several genes encoding enzymes that function in the importation and metabolism of galactose. The genes are located on several chromosomes, and are transcribed separately. The GAL genes have similar promoters, and gene transcription is under regulation by the proteins Gal3p, Gal4p, and Gal80p. Place the statements about GAL gene regulation in the correct order, starting from conditions with an absence of galactose through conditions with abundant galactose. Only five statements will be placed.

See picture

Tissue‑specific microarray analysis facilitates the comparison of gene expression in different tissues. In order to prepare a sample for microarray analysis, messenger RNA (mRNA) is extracted from a particular tissue, reverse transcribed to generate complementary DNA (cDNA), and labeled with a fluorescent probe. The microarray shows comparison of gene expression in stomach and intestinal tissues. The cDNA from stomach tissue was labeled with red fluorescent probes, whereas the cDNA from the intestinal tissue was labeled with green fluorescent probes. Gene B is primarily expressed only in stomach tissue, whereas gene C is primarily expressed in intestinal tissues. Genes D and A are responsible for basic cellular functions and are equally expressed in stomach and intestinal tissues. Match the spots on the microarray with the appropriate genes based on the information provided. If there are multiple possible answers for a particular gene, choose any of the possible options.

See picture

What transformation occurs during each of these processes? Translation: Transcription: Replication:

See picture

When there is damage to DNA, there are several mechanisms by which the damage can be repaired. Match the repair system with the type of damage it can repair.

See picture

Whole‑genome shotgun sequencing is a method used to sequence genomic DNA. Arrange the steps of whole‑genome shotgun sequencing in order from first to last.

See picture

Complete the passage to describe sickle cell trait and sickle cell anemia.

Sickle cell anemia is a serious disease in which red blood cells become misshapen. The cells lose their normal shape because of a mutation in the structure of hemoglobin. People with sickle cell trait have one mutated copy and one normal copy of the gene for this protein. These people are better able to combat infection by malaria and their cells do not sickle under normal conditions.

The three‑spined stickleback is a fish often found in freshwater lakes with or without larger, predatory fish. In lakes with predatory fish, nearly all three‑spined sticklebacks have a complete pelvis with sharp spines. In lakes that lack predatory fish, there is wide phenotypic variation in skeletal structure, ranging from a fully intact pelvis with typical spines to the complete loss of the pelvis. Intermediates occur with a partial pelvis and no spines. Numerous nonsynonymous polymorphisms affecting pelvic development are responsible for phenotypic variation in lakes lacking predatory fish. Choose a likely explanation for differences in the prevalence of polymorphisms in each environment.

Spines, which deter fish predators, offer an evolutionary advantage in lakes with predatory fish, resulting in purifying selection. Conversely, sticklebacks in lakes lacking fish predators undergo positive adaptive selection because the lack of a pelvis conserves energy.

DNA has unique properties that allow it to accurately retain genetic information, even after multiple rounds of replication. One aspect of DNA that allows it to accurately store genetic information is the base pairing from Chargaff's first rule of the four nucleotide bases. If the A content of a DNA molecule is 22%, what are the percentages of the remaining bases?

T= 22% G= 28% C= 28%

John and Sue are expecting a child, but are concerned about a rare autosomal recessive disease that is present in both of their families. In the pedigree, John is represented as individual III‑11 and Sue is represented as individual III‑12; both are unaffected. John's sister, III‑10, and Sue's brother, III‑13, both do not show evidence of the disease, but John's paternal grandmother and Sue's maternal grandfather both had the disease. Assign the appropriate symbol to each individual in the pedigree. What is the probability that John is a carrier? What is the probability that both John and Sue are carriers?

What is the probability that John is a carrier? 66.7 What is the probability that both John and Sue are carriers? ???

What is a short interspersed nuclear element (SINE)?

a DNA sequence less than 500 base pairs long that is reverse transcribed into the genome

Which description best defines a haplotype?

a group of alleles closely associated within a chromosome that are likely to be inherited together

Many molecules, including transcription factors, work together to transcribe genes and translate the information taken from the genes into proteins. What is a transcription factor?

a protein that binds to a specific DNA sequence to regulate transcription

Which of the statements describes a polygenic trait?

a trait that is influenced by two or more genes

Queen Victoria was a prominent member of Britain's royal family and had nine children. Her children and their offspring would include members of several different European houses, including the royal families of Spain, Germany, Prussia, and Russia. One of Queen Victoria's nine children was Alice, who became the Grand Duchess of Hesse. A partial family tree of Alice is shown. Calculate the coefficient of inbreeding of Alice using four decimal places.

coefficient of inbreeding: .0625

Tryptophan is an amino acid necessary for E. coli survival and growth. E. coli contain genes coding for enzymes that synthesize tryptophan. These genes are grouped together on a segment of DNA called the tryptophan (trp) operon. Cells can use these enzymes to synthesize tryptophan when it is not present in the environment. However, when tryptophan is already present in the environment, cellular resources are shifted away from manufacturing the enzymes for tryptophan synthesis. Tryptophan binds with and activates the trp repressor, which then binds to the trp promoter and blocks RNA polymerase. Blocking RNA polymerase decreases the normal transcription rate of the operon. What type of regulation does the trp operon exhibit?

negative regulation

A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode a chemokine receptor gene. The scientist is examining the sequence to identify potential open reading frames (ORFs), which contain both a start and stop codon. Using the partial sequence of chimpanzee DNA, identify the total number of ORFs. 5′−CCATGCACCAGATCGCTTATTAAAT−3′ 3′−GGTACGTGGTCTAGCGAATAATTTA−5′

number of ORFs: 1

Suppose two independently assorting genes are involved in the pathway that determines fruit color in squash. These genes interact with each other to produce the squash colors seen in the grocery store. At the first locus, the W allele codes for a dominant white phenotype, whereas the w allele codes for a colored squash. At the second locus, the allele Y codes for a dominant yellow phenotype, and the allele y codes for a recessive green phenotype. The phenotypes from the first locus will always mask the phenotype produced by the second locus if the dominant allele (W) is present at the first locus. This masking pattern is known as dominant epistasis. A dihybrid squash, Ww Yy, is selfed and produces 128 offspring. How many offspring are expected to have the white, yellow, and green phenotypes?

number of white offspring: 96 number of yellow offspring: 24 number of green offspring: 8

George Beadle and Edward Tatum used mutant strains of Neurospora to formulate the one-gene-one-enzyme hypothesis. Researchers later updated this hypothesis to propose that one gene encodes one polypeptide because proteins can have multiple subunits. Consider a homodimeric protein. How many genes are required to form this protein?

one

Which of the given ideas was developed to explain the physical basis of Mendel's finding that hereditary factors undergo segregation and independent assortment?

the chromosomal theory of inheritance

The results of genome-wide association studies are represented frequently in Manhattan plots. What does each dot represent on the plot?

the p‑value for an association test between a SNP and a specific trait

Suppose you identified a new human gene called A. The rat and newt genomes also have a single copy of this gene, denoted by R and N, respectively. You sequenced the open reading frame from all of the genes and calculated the number of differences in the base pairs between genes. The results are listed in the table. If the rate of evolution for this gene family is constant, and humans and rats diverged 80 million years ago, how long ago did rats and newts diverge?

time since rats and newts diverged: 320 million years

Suppose the genetic distances were calculated between four species of grass from the Paspalum genus: P. bakeri, P. notatum, P. nicorae, and P. peckii. The genetic distances are summarized in the matrix. Which of the phylogenetic trees best fits the Paspalum genetic distance data?

tree B

In a species of bird, the allele for the striped trait is recessive to the allele for the speckled trait. Suppose that a coastal bird population has a striped phenotype frequency of 0.22 and an inland population has a striped phenotype frequency of 0.43. The two populations are isolated and in Hardy-Weinberg equilibrium. Let 𝑞coastal represent the allele frequency of the coastal population and 𝑞inland represent the allele frequency of the inland population. Calculate the allele frequency for the striped allele for each population. Round your answers to the nearest hundredth. After an exceptionally rainy spring, there is no longer a barrier between the populations, and some individuals migrate inland from the coast. Consequently, 20% of individuals in the new inland population are originally from the coastal population. Calculate the striped allele frequency for the inland population after migration, 𝑞combined. Round the answer to the nearest hundredth.

𝑞coastal = .469 𝑞inland= .656 𝑞combined= .619