Microbiology Exam 2

Which of these organisms is likely to have the largest genome? an extremophile Archaean due to the demands of surviving in harsh environments an autotrophic bacterium a yeast cell a chloroplast

a yeast cell

The host DNA is usually degraded during which stage? a. Biosynthesis b. Attachment c. Assembly d. Release e. Penetration

a. Biosynthesis

ow is generalized transduction different from specialized transduction? a. Generalized transduction is initiated during lytic cycle of a virulent bacteriophage; specialized transduction is initiated during the lysogenic cycle of a temperate bacteriophage. b. Only one specific host gene is transferred in both specialized transduction and generalized transduction. c. Generalized transduction is initiated by a lysogenic bacteriophage; specialized transduction is initiated by a lytic phage. d. Specialized transduction uses animal viruses instead of bacteriophage.

a. Generalized transduction is initiated during lytic cycle of a virulent bacteriophage; specialized transduction is initiated during the lysogenic cycle of a temperate bacteriophage.

Which operons are never transcribed unless activated? a. Inducible operons b. Repressible operons c. Inducible and repressible operons

a. Inducible operons

The Ames test is commonly used to test whether a particular chemical is mutagenic. When you conduct an Ames test, you need two groups of plates. One group of plates contains bacteria that are exposed to the chemical of interest, while the other plates contain bacteria that are not exposed to the chemical. Why is the latter group needed if you are just interested in the rate of mutation caused by the chemical? a. It is important to compare the rate of mutations with the chemical to the normal background mutation rate. Mutations occur spontaneously even without the presence of a mutagen. b. Having two groups allows researchers to compare the effects of different environments on the mutation rate c. The second group is used as a control to make sure that the replica plating technique is done correctly. d. The group without the chemical can be exposed to mammalian liver extract to see the effects of liver enzymes on the bacteria

a. It is important to compare the rate of mutations with the chemical to the normal background mutation rate. Mutations occur spontaneously even without the presence of a mutagen.

How is penetration different in animal viruses as compared to bacterial viruses? a. The entire viral particle can penetrate an animal cell, while only the viral genome can penetrate a bacterial cell. b. The viral genome can penetrate an animal cell, while the entire viral particle penetrates a bacterial cell. c. There is no difference; the entire viral particle penetrates both cell types. d. There is no difference; only the viral genome penetrates both cell types.

a. The entire viral particle can penetrate an animal cell, while only the viral genome can penetrate a bacterial cell.

where on the DNA strand does a repressor bind? a. The operator b. The inducer c. The promoter d. The structural genes

a. The operator

Which statement best explains why positively controlled genes have weak promoters and need an activator protein to help the RNA polymerase bind? a. The organism wants transcription to occur only when the substrate (the activator protein) of the gene product is present. b. The organism only wants translation to stop when the substrate (the activator protein) of the gene product is present. c. The organism wants transcription to stop when the substrate (the activator protein) of the gene product is present. d. The organism only wants translation to occur when the substrate (the activator protein) of the gene product is present.

a. The organism wants transcription to occur only when the substrate (the activator protein) of the gene product is present.

How does specialized transduction differ from regular lysogeny? a. The prophage in specialized transduction carries with it pieces of the host chromosomal DNA. b. The resulting bacteriophage from specialized transduction does not contain any viral DNA. c. The prophage is not excised during specialized transduction. d. The resulting bacteriophage from specialized transduction cannot infect a new host cell.

a. The prophage in specialized transduction carries with it pieces of the host chromosomal DNA.

Which of the following is NOT included in the genome? genes that encode RNAs proteins coding regions of DNA noncoding regions of DNA

proteins

Steps of the Replication of Retrovirus

1. Entry and uncoating of the retrovirus. 2. Reverse transcriptase activity (two steps) 3. Viral DNA enters nucleus and integrates into the host genome. 4. Transcription by host RNA polymerase forms viral mRNA and genome copies. 5. Translation of mRNA forms viral proteins; new nucleocapsids assambled and released by building.

Restriction endonucleases are found in nature. They are extremely useful for genetic engineering. Why do organisms produce them? They are involved in DNA replication in prokaryotes. They are part of the viral life cycle and help in the assembly of new viruses. Organisms produce them as a way of allowing new genetic material to be inserted. Because they cut only at specific sequences in DNA, they are useful in cutting harmful DNA (such as viral DNA) without harming the organism that produces them (which can protect those sequences in its own DNA).

Because they cut only at specific sequences in DNA, they are useful in cutting harmful DNA (such as viral DNA) without harming the organism that produces them (which can protect those sequences in its own DNA).

In which stage does formation of mature viruses occur? a. Biosynthesis b. Attachment c. Assembly d. Release e. Penetration

C. Assembly

Which of the following groups contains some representatives with genomes that are so small that they may have as few as two genes? a. eukaryotes b. bacteria c. DNA viruses d. RNA viruses

D

Electrophoresis can be used to separate molecules by size, shape, and charge. When DNA samples are run in an electrophoresis gel, the different bands produced generally represent fragments of different sizes. Why is the size of the fragment the most critical factor in determining how far it migrates on a gel when DNA fragments are compared? a. The shape of the DNA fragments has an even greater effect on movement than size or charge, so charge is relatively unimportant. b. The charge on DNA is so small that it has a minimal effect on movement in the gel. c. A special type of gel is used for DNA electrophoresis to minimize the effects of charge. d. DNA moves toward a positive charge due to the negative charge on its phosphate groups. The charge is consistent because all DNA nucleotides have a single phosphate group rather than having more diverse patterns of charges. Because the charge is relatively consistent, size is the most important factor determining how far fragments move.

DNA moves toward a positive charge due to the negative charge on its phosphate groups. The charge is consistent because all DNA nucleotides have a single phosphate group rather than having more diverse patterns of charges. Because the charge is relatively consistent, size is the most important factor determining how far fragments move.

Automated sequencing techniques require only one lane on an electrophoresis gel rather than four. What is one method that makes this possible? The different bases are recognized by their depth in the electrophoresis gel. The fragments of different lengths have different charges, meaning that they travel different distances in the electrophoresis gel. Computers are able to recognize the different bases by their structure. Each base is identified with a different fluorescent color.

Each base is identified with a different fluorescent color.

Determine why some prokaryotes have less DNA but more genes than eukaryotes. Eukaryotes have more introns in their chromosomes. Eukaryotes have more exons in their chromosomes. Prokaryotes have more introns in their chromosomes. Eukaryotes do not have introns in their chromosomes.

Eukaryotes have more introns in their chromosomes.

Horizontal gene transfer refers to the transfer of genes from one organism to another, as occurs during conjugation between bacteria. How does this differ from vertical gene transfer? Hints In vertical gene transfer, genes are transferred by a vector such as a bacteriophage. In horizontal gene transfer, genes are transferred from one mature adult organism to another. In vertical gene transfer, genes are transferred from adults to offspring. In horizontal gene transfer, genes are transferred between two organisms of the same species. In vertical gene transfer, genes are transferred between two organisms of different species. Conjugation can involve horizontal or vertical gene transfer, depending on the physical orientation of the bacteria involved.

In horizontal gene transfer, genes are transferred from one mature adult organism to another. In vertical gene transfer, genes are transferred from adults to offspring.

Which of the following is an application that uses PCR? Diagnosing a disease Providing enough DNA for cloning into another organism Sequencing a gene, diagnosing a disease, and providing enough DNA for cloning into another organism Sequencing a gene

Sequencing a gene, diagnosing a disease, and providing enough DNA for cloning into another organism

Why is a special polymerase, such as Taq polymerase, required for PCR? Hints Taq polymerase can add complementary bases in an extremely accurate way, resulting in a very low error rate. Taq polymerase is produced by an extremophile prokaryote and is able to work at relatively high temperatures. Taq polymerase can add DNA or RNA, allowing amplification of DNA or RNA. Taq polymerase adds bases more rapidly than other polymerases, allowing very rapid amplification.

Taq polymerase is produced by an extremophile prokaryote and is able to work at relatively high temperatures.

Functional analysis of the genome of a prokaryote shows that 20% of the genome is for metabolism, 1 % for biosynthesis of amino acids, 8% for peptide ABC transporters, and 2% for replication. What can you determine about the environment in which this organism lives? The organism lives in an environment rich in sugars. The organism lives in an environment rich in hydrocarbons. The organism lives in an environment rich in organic material, particularly amino acids and proteins. The organism lives in an environment rich in lipids.

The organism lives in an environment rich in organic material, particularly amino acids and proteins.

What is the end goal of PCR? To increase the pool of different DNA sequences To allow cells to make DNA faster, thereby growing faster To quickly increase the number of copies of a specific DNA sequence

To quickly increase the number of copies of a specific DNA sequence

When a DNA gel is run, a standard sample with fragments of known size is often run in one well. Why is it important to use a standard sample? The standard sample is used to make sure that the electrical current is working properly. When an electrophoresis gel is run, small differences in the environment (e.g., the gel composition and current) can influence how far the fragments travel. Having a standard sample allows one to compare the test fragments with fragments of known size that have been run under the same conditions. The standard sample is used to demonstrate that the apparatus is working properly; it is a control. The standard sample helps to make the other samples more visible.

When an electrophoresis gel is run, small differences in the environment (e.g., the gel composition and current) can influence how far the fragments travel. Having a standard sample allows one to compare the test fragments with fragments of known size that have been run under the same conditions.

Many restriction enzymes produce sticky ends, which are very useful for genetic engineering. What makes the ends sticky? When the restriction enzyme cuts, it separates the two strands of DNA in a similar manner to the way that the strands separate in a replication bubble. Whenever the two strands of a DNA molecule are pulled apart, complementary bases are separated that can easily come back together again. After the restriction enzyme cuts the DNA strands, additional steps are used to add nucleotides to the ends of each strand. These newly added nucleotides can form hydrogen bonds to join with other strands. Restriction enzymes cut the phosphodiester backbone of the DNA molecule. The broken bonds can easily re-form, rejoining the separated fragments. When the restriction enzyme cuts, it cuts the two strands of a double-stranded DNA molecule unevenly. This produces overhanging DNA nucleotides on each fragment. These overhanging fragments are complementary to each other or to other fragments produced using the same restriction enzyme.

When the restriction enzyme cuts, it cuts the two strands of a double-stranded DNA molecule unevenly. This produces overhanging DNA nucleotides on each fragment. These overhanging fragments are complementary to each other or to other fragments produced using the same restriction enzyme.

How can specialized transduction contribute to the transfer of antibiotic resistance genes in a bacterial population? a. The prophage takes an antibiotic resistance gene with it and is packaged with the newly synthesized viral DNA. b. The phage causes the destruction of any antibiotic present during the specialized transduction process. c. The phage lyses the bacterium and releases resistance genes into the local environment, which can then be taken up by recipient cells.

a. The prophage takes an antibiotic resistance gene with it and is packaged with the newly synthesized viral DNA.

What is the basic function of the lac operon? a. To code for enzymes involved in catabolizing lactose. b. To produce glucose when none is available c. To code for enzymes involved in synthesizing lactose. d. To produce lactose when none is present

a. To code for enzymes involved in catabolizing lactose.

What is the overall function of the trp operon? a. To ensure that the cell has a supply of tryptophan at all times b. To block RNA polymerase from the structural genes c. To always make sure the operator is being bound to repressor proteins d. To control the production of repressor proteins

a. To ensure that the cell has a supply of tryptophan at all times

What is unique about transduction compared to normal bacteriophage infection? a. Transduction transfers DNA from the chromosome of one cell to another. b. The bacteriophage takes fragments of the cell with it during transduction. c. The bacteriophage does not erupt from an infected cell during transduction.

a. Transduction transfers DNA from the chromosome of one cell to another.

Frameshift mutations can be very severe. What is one reason why they are often so serious? a. When a frameshift mutation occurs, it causes changes in many bases downstream and can affect many of the amino acids in the protein. b. When a frameshift mutation occurs, it causes transition mutations to occur. These are particularly severe. c. Frameshift mutations always occur in the regulatory region, so they cause a gene to be turned off and then the protein is not produced at all. d. When a frameshift mutation occurs, it causes changes in many bases upstream and can affect many of the amino acids in the protein.

a. When a frameshift mutation occurs, it causes changes in many bases downstream and can affect many of the amino acids in the protein.

One group of chemical mutagens includes the base analogs. How do these lead to mutations? a. When replication occurs, complementary base pairing may fail because the base analog may not be treated in the same way as the base that it replaced. b. They lead to the formation of pyrimidine dimers. c. Base analogs push apart and distort the double helix. This distortion can lead to insertions and deletions (including frameshift mutations). d. They lead to alkylation, which can lead to substitutions.

a. When replication occurs, complementary base pairing may fail because the base analog may not be treated in the same way as the base that it replaced.

A change in the nucleotide sequence of DNA that is passed on to daughter cells is referred to as __________. a. a mutation b. lethal c. a mistake d. of no consequence

a. a mutation

To determine if you have identified a functional open reading frame (ORF), you should have found __________ within the sequence. a. a start codon and a ribosomal binding site (RBS) b. a start codon c. a ribosomal binding site (RBS) d. < 300 nucleotides

a. a start codon and a ribosomal binding site (RBS)

An organism that cannot synthesize methionine is an example of __________. a. an auxotroph b. a mutant c. a prototroph d. an autotroph

a. an auxotroph

Which of the following are viable methods of release of newly assembled viral particles? a. budding or lysis of host cell b. lysis of host cell c. budding d. lysogeny

a. budding or lysis of host cell

Which choice below lists the steps necessary for genetic cloning in the correct order? a. isolate DNA of interest; fragment the DNA; insert DNA into vector; insert vector into host; host replication of recombinant vector b. isolate DNA of interest; fragment the DNA; insert vector into host; insert DNA into vector; host replication of recombinant vector c. isolate DNA of interest; fragment the DNA; host replication of recombinant vector; insert DNA into vector; insert vector into host d. fragment the DNA; insert DNA into vector; insert vector into host; host replication of recombinant vector; isolate DNA of interest

a. isolate DNA of interest; fragment the DNA; insert DNA into vector; insert vector into host; host replication of recombinant vector

Thymine dimers result from: a. nonionizing radiation. b. nucleoside analogs. c. mistakes by DNA polymerase. d. ionizing radiation.

a. nonionizing radiation.

In certain circumstances, a single regulatory protein controls multiple operons. This situation would be called a(n) __________. a. regulon b. multiple operon c. genetic regulation d. catabolite regulation

a. regulon

A retrovirus has a genome that consists of __________. a. ssRNA b. dsRNA c. dsDNA d. ssDNA

a. ssRNA

What might be a reason that a researcher would decide to use Northern blotting instead of Southern blotting? a. to determine the extent to which a gene is being transcribed in a particular tissue b. to determine whether gene amplification was used to increase transcription of a gene in a particular organism c. to compare the proteins present in different cells d. to determine the extent to which a gene is being translated in a particular tissue

a. to determine the extent to which a gene is being transcribed in a particular tissue

Steps in the Bacteriophage replication cycle

attachment, penetration of viral nucleic acid, synthesis of viral nucleic acid and proteins, assembly and packaginf of new viruses, cell lysis and release of new virions.

The polymerase chain reaction, PCR, has revolutionized molecular genetics. Despite all of the advantages of PCR, it does have limitations. Which of the following is NOT a limitation of PCR? a. It is necessary to know something about the sequence of the DNA sample prior to amplifying a specific region. b. It requires very pure and high-quality DNA samples. c. It is more error prone than most DNA replication. d. PCR is so sensitive that contamination can easily occur.

b. It requires very pure and high-quality DNA samples.

Why does the structure of plant and bacterial cells illustrate the reason for having few enveloped viruses that infect these cells? a. Plant and bacterial cells contain cell walls that prevent viruses from being released from the cell. b. Plant and bacterial cells contain cell walls that limit the virus from budding out and obtaining the envelope. c. Plant and bacterial cells contain cell walls that prevent viral infection. d. Plant and bacterial cells contain cell walls that prevent attachment of viruses.

b. Plant and bacterial cells contain cell walls that limit the virus from budding out and obtaining the envelope.

In gene cloning, a fragment of interest is placed into an appropriate vector and then replicates within the host cell. Which of the following is NOT an advantage to using a plasmid inserted into an E. coli bacterium for cloning? a. E. coli is susceptible to a variety of antibiotics. b. Plasmids can hold large inserts of DNA. c. Plasmids can be easily inserted into E. coli and it maintains plasmids quite well. d. E. coli has been well studied and its genetics are very well known.

b. Plasmids can hold large inserts of DNA.

Which operons are always transcribed unless deactivated? a. Inducible operons b. Repressible operons c. Inducible and repressible operons

b. Repressible operons

Which of the following would result in a frameshift mutation? a. The deletion of three nucleotides in a codon b. The deletion of two nucleotides in a codon c. The addition of three nucleotides between two existing codon. d. The deletion of one nucleotide from one codon and two nucleotides from the adjacent codon

b. The deletion of two nucleotides in a codon

Which of the following genetic elements is transcribed into a single mRNA? a. The inducer b. The structural genes c. The repressor d. The promoter e. The operator

b. The structural genes

Why is the tryptophan operon turned off in the presence of tryptophan? a. Tryptophan is not an important amino acid for cells. b. Tryptophan binds to and activates the repressor proteins; the repressor proteins, in turn, bind to the operator, preventing transcription. c. Tryptophan can be used over and over again in the cell.

b. Tryptophan binds to and activates the repressor proteins; the repressor proteins, in turn, bind to the operator, preventing transcription.

Which of the following is true about viral infection? a. Viruses can infect any cells within a large group, but they are not more specific than that. For example, there are plant viruses that can affect many types of plants, bacteriophages that affect many types of bacteria, and animal viruses that affect a range of viruses. b. Viruses are very specific in which cells they infect. For a virus to be taken up by a cell, it must find a cell with appropriate receptors on the surface; it cannot be taken up by cells without the appropriate receptors. c. Viruses have what is needed to infect a host cell; they do not need anything specific from the host cell in order to cause infection and therefore can infect a wide range of cells. d. Viruses can infect any cell in a particular species; it does not matter which tissue they infect as long as the species (or group of similar species) is correct.

b. Viruses are very specific in which cells they infect. For a virus to be taken up by a cell, it must find a cell with appropriate receptors on the surface; it cannot be taken up by cells without the appropriate receptors.

A nucleotide-altering chemical: a. can slip in between stacked bases, causing bulges in the DNA structure. b. can alter nitrogenous bases of DNA, resulting in incorrect base pairing. c. can cause double-stranded breaks in the DNA. d. can be incorporated into the DNA, to cause a mispairing of bases.

b. can alter nitrogenous bases of DNA, resulting in incorrect base pairing.

Mutagens: a. come in two basic forms: ionizing and nonionizing radiation. b. increase the likelihood of mutations in DNA. c. are the sole cause of mutations in DNA. d. decrease the likelihood of mutations in DNA.

b. increase the likelihood of mutations in DNA.

Viral structural proteins and proteins involved in the release of new viral particles that are synthesized after genomic replication begins would be considered __________. a. early proteins b. middle and late proteins c. late proteins d. middle proteins

b. middle and late proteins

There are several different types of mutations possible in the base sequence of DNA. If a GGC (glycine) codon were changed to UGC (cysteine), it would be termed a __________. a. wild type b. missense mutation c. nonsense mutation d. silent mutation

b. missense mutation

The addition of two bases to the genome of a prokaryote would be most damaging if located __________. a. in the middle of the coding region of a protein b. near the beginning of the coding region of a protein c. anywhere within the coding region of a protein d. at the very end of the coding region of a protein

b. near the beginning of the coding region of a protein

When a transducing phage interacts with a new host cell, a. it will cause the new cell to produce more transducing phage. b. the DNA from the previous host can recombine with the new host chromosome. c. the new host cell will be lysed.

b. the DNA from the previous host can recombine with the new host chromosome.

One reason that regulation of gene expression is important is that it saves energy and materials from being used when they are not needed. Although most genes have more than one form of regulation acting upon them, at which point would regulation be most efficient in conserving energy and materials if the product of a gene is not needed? a. regulation of translation b. transcriptional regulation (regulation of whether transcription occurs) c. post-transcriptional regulation d. post-translational regulation

b. transcriptional regulation (regulation of whether transcription occurs)

hromosomal islands are similar to plasmids __________. Hints because both elements replicate independently of the chromosome because both elements are found separate from the chromosome because both elements contain nonessential genes because both elements contain inverted repeats

because both elements contain nonessential genes

some viruses have plus sense RNA genomes. Which of the following could describe one of those viruses? a. a virus that has single-stranded DNA with the same nucleotide sequence as the functional mRNA that its host cell will translate to produce viral products. b. a virus that has single-stranded DNA with the complementary nucleotide sequence to the functional mRNA that its host cell will translate to produce viral products. c. a virus that contains RNA with the same nucleotide sequence as the functional mRNA that its host cell will translate to produce viral products. d. a virus that contains RNA with the complementary nucleotide sequence to the functional mRNA that its host cells will translate to produce viral products.

c

The genetic code has many important characteristics. For example, a specific codon always means the same thing in a particular species. Codons mean the same thing in most species (even though there are some exceptions). In some cases, a particular amino acid can be specified by more than one codon (the genetic code is degenerate). Which of the following answers describes an example of the degenerate nature of the code? a. The sequence "AUGCCGAUU" is read as three codons, AUG, then CCG, then AUU. b. AUU codes for Ile in a wide variety of species c. AUU, AUC, and AUA all code for Ile d. There are no pauses or commas in the code.

c. AUU, AUC, and AUA all code for Ile

Which of the following might result in a frameshift mutation? a. 5-bromouracil b. Nitrous acid c. Benzopyrene

c. Benzopyrene

Some viruses, especially animal viruses, have an envelope surrounding their nucleocapsid. This envelope may have viral proteins embedded in it. Why are the viral proteins more readily recognized and targeted by the immune system than the envelope? a. The envelope is not capable of stimulating an immune response because of its makeup. b. Only proteins can stimulate the immune system, so the phospholipids and glycoproteins of the envelope are not immunogenic. c. Enveloped viruses are often coated with animal cell membrane as they leave the cell. This membrane is a major component of the viral envelope. The viral proteins are more readily recognized by the immune system, as they are more distinct from the materials normally found in and on the cells. However, the envelope can contain several types of viral components as well. d. Viral proteins are highly immunogenic in order to facilitate uptake by host cells, while the envelope is not important in uptake by host cells.

c. Enveloped viruses are often coated with animal cell membrane as they leave the cell. This membrane is a major component of the viral envelope. The viral proteins are more readily recognized by the immune system, as they are more distinct from the materials normally found in and on the cells. However, the envelope can contain several types of viral components as well.

Differentiate between persistent and latent animal virus infections. a. Persistent infections can cause transformation of the host cell, which can lead to the development of cancer. Latent infections do not cause transformation. b. Persistent infections always lead to cell lysis, while latent infections never lead to cell lysis. c. In a persistent infection, the host cell is continually releasing new viral particles slowly. In a latent infection, there are periods of time where the virus is not replicating and creating new viral particles. d. In a latent infection, the host cell is continually releasing new viral particles slowly. In a persistent infection, there are periods of time where the virus is not replicating and creating new viral particles.

c. In a persistent infection, the host cell is continually releasing new viral particles slowly. In a latent infection, there are periods of time where the virus is not replicating and creating new viral particles.

Which of the following describes how 5-bromouracil might create a mutation? a. It causes double-stranded breaks of the DNA. b. It creates bulges in the DNA that must be repaired. c. It can replace the base thymine, and can base pair with guanine rather than adenine. d. It can form thymine dimers.

c. It can replace the base thymine, and can base pair with guanine rather than adenine.

When is the repressor protein transcribed? a. Only in the presence of tryptophan b. Only in the absence of tryptophan c. It is always transcribed.

c. It is always transcribed.

If an electrophoresis gel is run with RNA and then a DNA probe is used to identify the fragments of interest, what is the process called? a. Eastern blotting b. Southern blotting c. Northern blotting d. Western blotting

c. Northern blotting

Viruses rely on the host cell machinery to make new viruses, but they sometimes provide their own enzymes (such as reverse transcriptase, which is an RNA-dependent DNA polymerase). Which of the following types of enzymes would a virus need to provide in order to replicate within a cell? In other words, which of these enzymes would not normally be found in a cell unless a virus provided it? a. DNA-dependent RNA polymerases for RNA viruses b. DNA-dependent RNA polymerases for DNA viruses c. RNA replicases (RNA-dependent RNA polymerases) for RNA viruses d. DNA-dependent DNA polymerases for DNA viruses

c. RNA replicases (RNA-dependent RNA polymerases) for RNA viruses

What happens to the packaged DNA of a specialized transduced phage when it infects a new recipient cell? a. The DNA is chewed up by enzymes found in the recipient cell. b. The DNA begins to replicate without integrating into the host chromosome. c. The host DNA integrates, with the prophage, into the new recipient chromosome.

c. The host DNA integrates, with the prophage, into the new recipient chromosome.

With which genetic region does the repressor protein interact? a. The regulatory gene b. lacY c. The operator region d. lacZ e. The promoter region

c. The operator region

to what genetic element does the RNA polymerase bind? a. The repressor mRNA b. The repressor protein c. The promoter d. The operator

c. The promoter

What would be the fate of a lytic bacteriophage if the host cell died prior to the assembly stage? a. The virus would infect new hosts. b. The cell could still be revived by the virus. c. The virus would not be able to infect new hosts.

c. The virus would not be able to infect new hosts.

In a culture of bacteria, there are some individuals that are unable to synthesize histidine. What is the best and most likely description of how these individuals differ from the other bacteria in the culture? a. They differ in their genotype but not in their phenotype. b. They differ in their phenotype but not in their genotype. c. They differ in their genotype and in their phenotype. d. They don't differ in genotype or phenotype.

c. They differ in their genotype and in their phenotype.

What is the function of the structural elements of a virus? a. To use all of the cell proteins b. To provide a source of energy for the virus c. To package and protect the viral genome

c. To package and protect the viral genome

A chemical that removes the amine groups from certain nucleotides would be classified as __________. a. a base analog mutagen b. a dimer-forming mutagen c. a chemical-modifying mutagen d. a intercalating mutagen

c. a chemical-modifying mutagen

What method of mutagenesis would be best to determine if a gene is essential for a prokaryote? a. knock-out mutagenesis b. gene disruption c. cassette mutagenesis d. site-specific mutagenesis

c. cassette mutagenesis

A transducing phage a. has a viral coat made of host proteins. b. cannot infect new host cells. is a lysogenic bacteriophage. c. contains fragments of the host chromosome instead of the viral genome.

c. contains fragments of the host chromosome instead of the viral genome.

When a known single-stranded DNA probe is mixed with unknown nucleic acid sequences to look for similarity, it is called __________. a. replica plating b. a blot c. hybridization d. recombination

c. hybridization

The synthesis of -galactosidase is regulated by __________. induction a. catabolite repression b. repression c. induction and catabolite repression

c. induction and catabolite repression

In DNA cloning, fragments of DNA need to be joined together (e.g., to add a fragment into a vector). What common enzyme is used for this process? a. helicases b. RNA polymerase c. ligase d. DNA polymerase

c. ligase

The appearance of an abundance of colonies close to the test disk after an Ames test would suggest __________. a. the test organism is an auxotroph b. the medium used is appropriate for the test organism c. the chemical tested is a mutagen d. the test chemical is not a mutagen

c. the chemical tested is a mutagen

Increasing genetic variability by the uptake of DNA from the environment is __________. a. conjugation b. a mutation c. transformation d. transduction

c. transformation

The field of study that can reveal how genes function, reveal how organisms interact with the environment, and show evolutionary relationships is __________. proteomics comparative genomics transcriptomics genomics

comparative genomics

which of the following is NOT a way in which viruses are different from living organisms? a. Viruses are acellular and all living thibgs are made up of cells b. Viruses have DNA or RNA, not both. c. Viruses depend on their host to synthesize the components of new viruses, while living organisms are capable of synthesizing these components even if they require a host for food, shelter, or other necessities. d. Viruses are obligate parasites and no living organisms are obligate parasites

d

Reporter genes can be used to __________. a. detect the absence of a genetic element. b. detect if DNA was inserted in a vector c. detect the presence of a genetic element d. All of the listed responses are correct

d. All of the listed responses are correct

How can DNA binding proteins (DBP) regulate transcription? a. DNA-binding proteins can catalyze transcription. b. DNA-binding proteins can block transcription. c. DNA binding proteins can activate transcription. d. All of the listed responses are correct.

d. All of the listed responses are correct.

What structure can the viral genome take? a. ds-RNA b. ss-DNA c. ds-DNA d. All of the listed responses are incorrect

d. All of the listed responses are incorrect

What is the inducer molecule in the lac operon? a. Repressor proteins b. Galactose c. Lactose d. Allolactose e. Glucose

d. Allolactose

Cells can regulate their metabolism by regulating enzyme activity or by regulating enzyme synthesis (i.e., by regulating whether they produce the enzyme that catalyzes a reaction). Which of the following examples would be the best form of regulation when an enzyme needs to be available very rapidly? a. When the enzyme is needed, the relevant operon that contains its gene is activated. b. When the enzyme is needed, the relevant operon that contains its gene is repressed. c. Until the enzyme is needed, mRNA transcripts are produced but not translated. d. An enzyme is activated by the binding of a molecule to its allosteric site.

d. An enzyme is activated by the binding of a molecule to its allosteric site.

The major site of protein binding in DNA is the major groove. Why is this a good site for binding? a. The major groove has a more heavily methylated base composition, which aids in the binding of proteins. b. Because the minor groove is wider, it is more accessible to binding proteins. c. The major groove has lower frequencies of inverted repeats; this lower frequency of inverted repeats makes binding easier. d. Because the major groove is wider, it is more accessible to binding proteins.

d. Because the major groove is wider, it is more accessible to binding proteins.

Which of the following is true about hybridization? a. When used as probes, DNA can hybridize only with DNA, and RNA can hybridize only with RNA. b. DNA strands must be completely complementary in order to hybridize, although RNA strands can hybridize with DNA or RNA even if there are some differences in the base sequences. c. RNA strands must be entirely complementary in order to hybridize, although DNA strands can hybridize with DNA or RNA even if there are some differences in the base sequences. d. DNA strands that differ in a few bases may still be able to hybridize

d. DNA strands that differ in a few bases may still be able to hybridize

how do the repressor proteins block the transcription of the structural genes? a. It binds to the repressor gene when deactivated. b. It binds to the repressor gene when activated. c. It binds to the promoter when activated. d. It binds to the operator when activated. e. It binds to the promoter when deactivated. f. It binds to the repressor when deactivated.

d. It binds to the operator when activated.

When the cell is NOT in the presence of tryptophan, a. the repressor proteins bind to the operator. b. the repressor proteins are active. c. structural genes are not transcribed. d. RNA polymerase can transcribe mRNA.

d. RNA polymerase can transcribe mRNA.

A single base substitution happens to cause a nonsense mutation early in the gene for a protein. What will be the result? a. The protein will be truncated a great deal, but is likely to function normally. b. The protein will be truncated a small amount, but is likely to function normally. c. The protein will be truncated a small amount, but is unlikely to function normally. d. The protein will be truncated so much that it is unlikely to function normally.

d. The protein will be truncated so much that it is unlikely to function normally.

Some bacteria have unusually high mutation rates. Is there an adaptive reason why they might have such high mutation rates? a. The high mutation rate may be associated with a more rapid metabolism and life cycle, allowing the bacteria to reproduce more rapidly. b. The high mutation rate may result from a high recombination rate, meaning that there is a great deal of horizontal gene exchange creating a great deal of diversity. c. The bacteria may have a deleterious mutation that causes such a high mutation rate. d. These bacteria may be able to adapt rapidly to a new environment (e.g., an environment with an antibiotic).

d. These bacteria may be able to adapt rapidly to a new environment (e.g., an environment with an antibiotic).

How are viruses different from cells? a. They do not contain genetic material. b. They do not contain protein. c. They do not contain enzymes. d. They require a host in order to reproduce.

d. They require a host in order to reproduce.

Which of the following examples describes a type of catabolite repression? a. The presence of abundant tryptophan inhibits the trp operon. b. A mutation in the promoter of the lac operon prevents the expression of the genes needed for the bacterium to utilize lactose. c. Allolactose binds to a repressor, preventing it from binding to the operator of the lac operon. d. When glucose is present, the lac operon is inhibited.

d. When glucose is present, the lac operon is inhibited.

What component(s) make up the structure of a virion? a. capsid b. genome and envelope c. capsid, genome, envelope d. capsid and genome

d. capsid and genome

When the cell is not in the presence of lactose, a. the repressor proteins are inactivated. b. transcription of the structural genes occurs. c. no transcription of the regulatory genes occurs. d. the repressor proteins bind to the operator.

d. the repressor proteins bind to the operator.

In which stage is the viral DNA introduced into the cell? a. Biosynthesis b. Attachment c. Assembly d. Release e. Penetration

e. Penetration

Comparing the different generations of DNA sequencing, which would be most appropriate for a 10 Mbp piece of DNA that could not be fragmented? second generation first generation fourth generation third generation

fourth generation

The genome sequence of an organism can provide information about the organism's __________. genes, function, and evolutionary history genes, size, and function function, size, and evolutionary history function, evolutionary history, and morphology

genes, function, and evolutionary history

Arrange the following genetic components in the correct order. genome, transcriptome, proteome, metabolome genome, transcriptome, metabolome, proteome genome, metabolome, transcriptome, proteome genome, proteome, transcriptome, metabolome

genome, transcriptome, proteome, metabolome

If a restriction enzyme that recognizes GGCAT and cuts between the two guanine residues is mixed with DNA that has the sequence CCGATTATAATCCCGCGGCATATTAGGGCGG, how many pieces would the resulting product be? three one two four

two