Molecular Genetics - Exam 2

When the base composition of DNA from a grasshopper was determined, 26% of the bases were found to be adenine. What is the [G] + [C] content? a.) 26% b.) 24% c.) 48% d.) Unable to determine from this information. e.) 52% f.) 12%

c.) 48%

Which of the following is NOT a way that RNA normally interacts with itself to form a secondary structure? a.) bulge b.) hairpin c.) internal loop d.) GU base pairing e.) B from RNA

e.) B from RNA

Sanger DNA sequencing is similar to PCR in many of the components required. List 3 components necessary for both and 1 only necessary for Sanger DNA sequencing. (Make sure to label which components are for both and which is only for sequencing.)

Both: 1. DNA polymerase 2. Template 3. Nucleotides Sanger Squencing: ???

T/F: In recombinant DNA technology, a YAC is an enzyme isolated from a large South American, four-legged mammal.

False

T/F: The function of a ddNTP in DNA sequencing is to methylate guanine.

False

Given the DNA sequence ATGCGCTAGTCCGTAGGTTCAGGGTCAAATTCAGTGC Provide a forward and a reverse primer consisting of 6nt each to amplify the entire dsDNA molecule with the indicated sequence.

Forward primer: 5' ATGCGC 3' Reverse primer: 5' GCACTG 3'

Why was the discovery of CRISPR/Cas systems so important?

It is the most effective way to genome edit and can work on any DNA.

What is the role of the CRISPR/Cas system in bacteria naturally?

Its main function is to eliminate viral DNA that has entered the cell.

Name the type of molecule labeled A.______ Name the type of protein required and the procedure performed in B.______ and ________ Name the type of protein required and the procedure performed in C.______ and ______ Name the process (D) of inserting the molecule produced following C into a bacterial cell.______ Name the process performed in E.________ Which colonies would contain the desired molecules (blue or white)?______

Name the type of molecule labeled A. (vector) Name the type of protein required and the procedure performed in B. (restriction endonuclease) and (restriction digest) Name the type of protein required and the procedure performed in C. (DNA ligase) and (ligation reaction) Name the process (D) of inserting the molecule produced following C into a bacterial cell. (transformation) Name the process performed in E. (cloning) Which colonies would contain the desired molecules (blue or white)? (white)

Match the correct terms to the eight blanks in the figure. _____ C-G base pair _____ deoxyribose _____ purine base _____ 5' end _____ pyrimidine base _____ phosphodiester bond _____ T-A base pair _____ 3' end

__1__ C-G base pair __4__ deoxyribose __2__ purine base __8__ 5' end __3__ pyrimidine base __5__ phosphodiester bond __7__ T-A base pair __6__ 3' end

Match the technique to the appropriate application. Each will only be used once. Choose the best for each. _____ Use a fluorescently labeled antibody to visualize localization of a protein in fixed cells. _____ Measure RNA levels _____ Mutation of targeted DNA sequence, to determine protein function by its absence. _____ Measure protein-protein interactions to help determine possible unknown protein function. _____ Determine whether or not a protein is present/translated at all. _____ Determine localization of a protein in a living cell. 1. Immunoprecipitation 2. Immunofluorescence 3. GFP fusion protein 4. Western Blot 5. Zinc finger nuclease 6. Quantitative real-time PCR (Q-PCR)

__2__ Use a fluorescently labeled antibody to visualize localization of a protein in fixed cells. __6__ Measure RNA levels __5__ Mutation of targeted DNA sequence, to determine protein function by its absence. __1__ Measure protein-protein interactions to help determine possible unknown protein function. __4__ Determine whether or not a protein is present/translated at all. __3__ Determine localization of a protein in a living cell.

Which ribose ring position bears a different substituent when comparing DNA and RNA? a.) 2' b.) 3' c.) 4' d.) 5'

a.) 2'

What is the genetic sequence of the template DNA sequenced using the Sanger method? a.) 5'TTACAGTCGGAA3' b.) 5'AAGGCTGACATT3' c.) 5'GGCCCTTTTAAA3' d.) 5'AATGTCAGCCTT3' e.) 5'TTCCGACTGTAA3'

a.) 5'TTACAGTCGGAA3'

What is a probe in molecular biology? a.) A DNA or an RNA molecule used in hybridization reactions b.) A type of vector system c.) Probes are not used in molecular biology. d.) An instrument used to manipulate cells in culture

a.) A DNA or an RNA molecule used in hybridization reactions

Which of the following is an essential component in a cloning vector? a.) All of these b.) Origin of replication c.) Easily recovered from host cell d.) Selectable marker gene e.) Unique restriction enzyme sites

a.) All of these

The predominant form of DNA in vivo is a.) B-DNA b.) C-DNA c.) Z-DNA d.) A-DNA

a.) B-DNA

When two strands of DNA from different sources are hybridized in the lab, what provides the chemical stability for holding the two strands of DNA in a double helix structure?Select ALL that apply. a.) Base stacking b.) Peptide bonds c.) Hydrophobic interactions d.) Phosphodiester bonds e.) Hydrogen bonding

a.) Base stacking c.) Hydrophobic interactions e.) Hydrogen bonding

DNA genotyping by analyzing short tandem repeats has been used do all the following EXCEPT: a.) determine a newborn's chance for genetic disease. b.) identify the father of a child. c.) identify criminals using blood samples. d.) acquit an accused rapist.

a.) determine a newborn's chance for genetic disease.

Base-paired stems in RNA a.) form an A-type double helix b.) do not form a double helix c.) form a Z-type double helix e.) form a B-type double helix

a.) form an A-type double helix

Use the figure to answer the question regarding the CRISPR/Cas9 system. 1. Number 1 on the figure labels the endonuclease, what is this called? a.) guide RNA b.) Cas9 c.) tracrRNA d.) crRNA e.) PAM

b.) Cas9

Which technique would you use to detect genome-wide changes in transcription? a.) PCR b.) DNA Microarrays c.) Restriction enzyme digestion d.) Dideoxy chain-termination sequencing

b.) DNA Microarrays

The purpose of the primer sequence in PCR is to: a.) Provide a promoter sequence for DNA polymerase b.) Provide a free 3'-OH end required for covalent extension c.) Allow for efficient denaturation of the double stranded DNA d.) Keep the DNA denatured after the temperature is reduced e.) All of these

b.) Provide a free 3'-OH end required for covalent extension

Why is it possible to join a piece of DNA from a human that has been digested using EcoR1 and a piece of DNA from a bacterium that has been digested using EcoR1? a.) Bacteria and humans exist in a symbiotic relationship and therefore share DNA and can be joined together. b.) They have been cut with the same restriction enzyme therefore the staggered ends are the same and are complementary. c.) They can join together only in the presence of high heat and pressure, such as is found in an autoclave. d.) They cannot join together because the DNA has come from two different species and even though they are digested with the same restriction enzyme the cuts are at different locations.

b.) They have been cut with the same restriction enzyme therefore the staggered ends are the same and are complementary.

Which red arrow points to a glycosidic bond? a.) A b.) B c.) C d.) D e.) E

c.) C

In sequential order, what are the three steps of PCR? a.) Anneal Primers, Extend DNA, Denature DNA b.) Denature DNA, Extend DNA, Anneal Primers c.) Denature DNA, Anneal Primers, Extend DNA d.) Extend DNA, Anneal Primers, Denature DNA

c.) Denature DNA, Anneal Primers, Extend DNA

Which is true of DNA in comparison to RNA? a.) It can adopt many more different types of secondary structures b.) It often acts as a catalyst in cellular biochemical reactions c.) It is generally more stable d.) It is most often found as a single-stranded form in cells

c.) It is generally more stable

DNA and RNA have a _____________ charge due to the ___________________ in the molecule. a.) Positive; Phosphate b.) Positive; Deoxyribose c.) Negative; Phosphate d.) Trick question, there is no charge e.) Negative; Deoxyribose

c.) Negative; Phosphate

A researcher is using gel electrophoresis to separate very small DNA fragments and resolve very small difference between fragments. What type of gel should the researcher use to perform this separation? a.) Agarose b.) Blood agar c.) Polyacrylamide d.) Agarose or Blood agar e.) All three of these are appropriate

c.) Polyacrylamide

What does the enzyme reverse transcriptase do? a.) Degrades foreign DNA b.) Adds nucleotides to the end of DNA molecules c.) Synthesizes DNA complementary to an RNA template to generate a cDNA molecule d.) Inactivates restriction endonucleases e.) Synthesizes RNA complementary to a DNA template to generate a gDNA molecule

c.) Synthesizes DNA complementary to an RNA template to generate a cDNA molecule

When an RNA molecule interacts with a protein to attain the correct folding pattern and the RNA and protein work together this is called a.) something that doesn't exist b.) puckering c.) a ribonucleoprotein d.) a chaperone e.) alternative splicing

c.) a ribonucleoprotein

A bacterial artificial chromosome (BAC) is different from a plasmid vector because it: a.) lacks an origin for replication in bacteria. b.) has a higher copy number than the plasmid vector. c.) accommodates much larger fragments. d.) has only selectable markers with which to detect its presence in cells.

c.) accommodates much larger fragments.

When double stranded DNA is heated to near boiling temperatures, it is denatured. When the temperature is reduced the single stranded DNA molecules reanneal. This phenomenon is a result of: a.) 3' hydroxyl group located on the ribose ring of DNA b.) semiconservative replication c.) base pairing within DNA d.) DNA major and minor grooves e.) none of the above

c.) base pairing within DNA

Which of the following is NOT a method of DNA sequencing? a.) 454 pyrosequencing b.) ion torrent sequencing c.) single-base ligation sequencing d.) single-molecule, real-time sequencing

c.) single-base ligation sequencing

Which of the following is NOT a feature of restriction endonucleases? a.) They are named after the species in which the enzyme is produced b.) Most recognize palindromic sequences c.) Some make staggered cuts d.) They always cut at random sites

d.) They always cut at random sites

Overexpression of proteins using bacteria: a.) makes subsequent purification of the recombinant DNA harder. b.) always results in a properly folded, active protein. c.) does not require an origin of replication be present in the bacterial vector. d.) requires bacterial promoters to be present in the bacterial vector.

d.) requires bacterial promoters to be present in the bacterial vector.

There is a tremendous versatility of functional RNA products involved in a wide range of cellular processes. One of the key contributing factors to this versatility is a.) the ability of RNA to cleave phosphodiester bonds in other nucleic acids b.) the ability of RNA to serve as a messenger during protein synthesis c.) the ability of RNA to be copied into DNA d.) the ability of RNA to form unique 3D structures that act similarly to proteins

d.) the ability of RNA to form unique 3D structures that act similarly to proteins

What is the appropriate complementary sequence to the following DNA strand: 5' -TTTCAGCTTAAGGC-3' a.) 3'-ATTCCGGATCAGGG-5' b.) 3'-UAAGGCCUAGUCCC-5' c.) None of these answers includes the complementary sequence. d.) 5'-ATTCCGGATCAGGG-3' e.) 5'-GCCTTAAGCTGAAA-3'

e.) 5'-GCCTTAAGCTGAAA-3'

Southern blotting detects: a.) protein using a DNA probe. b.) RNA using an RNA probe c.) RNA using a DNA probe. d.) protein using an antibody probe. e.) DNA using a DNA probe.

e.) DNA using a DNA probe.

Which of the following is NOT true of genomic and cDNA libraries? a.) Genomic libraries usually contain large fragments and are likely to be constructed in YAC or BAC vectors. b.) Genomic libraries contain fragments of genomic DNA that are generated by partial digests with restriction enzymes. c.) cDNA libraries contain cDNAs made from mRNA. d.) cDNA libraries only contain sequences from transcribed genes. e.) Genes represented in cDNA libraries contain control sequences that direct transcription.

e.) Genes represented in cDNA libraries contain control sequences that direct transcription.

Which of the following is NOT an additional role for nucleosides and nucleotides? a.) methyl group donor (S-adenosylmethionine) b.) regulatory molecule (cAMP) c.) primary energy currency of the cell (ATP) d.) electron carrier (NAD+) e.) catalyst for splicing reactions (dUTP)

e.) catalyst for splicing reactions (dUTP)