XL 7C W5 PEQs & CQs; W6 PEQs & CQs; W7 PEQs & CQs; W8 PEQs & CQs; W9 PEQs & CQs; W10 PEQs & CQs
Countercurrent mechanisms of ion transport depend on continuous concentration gradients across secretory cells. Which direction must salt secretions flow? A or B?
A
If salt moves across secretory cells by passive transport mechanisms, which side of the secretory cell must contain a higher concentration of salt ions? A or B?
A
Secretion means excretion from the body. If excess salt ions need to be removed from the body, which direction must blood flow? A or B?
A
During a typical cardiac cycle, the atria of the heart contract ______ the ventricles contract. A. Before B. After C. At the same time as
A. Before
Consider the figure below. Around point F, the extracellular fluid surrounding the nephron is _______ compared to the fluid in the lumen of the nephron. A. Hypertonic B. Hypotonic C. Isotonic
A. Hypertonic
A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. When brainstem senses hypoxic conditions, the rate of ventilation will... A. Increase B. Decrease C. Not change
A. Increase
Which of the statements explains why there is an elastic layer found in arteries but not veins? (a) Blood pressure is higher in arteries than veins, and the elastic layer helps maintain the structure of the artery. (b) The total length of arteries in the body is more than the total length of veins, and the elastic layer in arteries helps push the blood over the longer length. (C) Valves present in veins provide a mechanism for withstanding high blood pressure flow going through veins. (d) Arteries are thicker than veins, and the elastic layer is necessary to support the additional weight of arteries.
(a) Blood pressure is higher in arteries than veins, and the elastic layer helps maintain the structure of the artery. With each heartbeat, there is a volume of blood pushed through the arteries at high pressure. The elastic layer helps to absorb the increase in pressure with some distention of the artery, and the artery is able to return to its normal shape.
Shown below is part of a coding region within the first exon of a gene. Where will Cas9 cause a double stranded DNA break? (a) D (b) A (c) B (d) C
(a) D
You are designing your first template for homologous recombination (HR) to insert a mutation (A→C) into Exon 1 of a gene using the CRISPR/Cas9 system. You realize that your HR template DNA is likely to be cut by Cas9. Which of the HR templates below would be a better option for this experiment? (a) C (b) D (c) A (d) B (e) E
(b) D
What are desirable characteristics for a gas exchange surface, such as the endothelial cells lining the inside of a lung? Select all that apply. (a) a small surface area (b) a large surface area (c) a thickness under 10 micrometers (d) a thickness of 100 micrometers
(b) a large surface area (c) a thickness under 10 micrometers
During certain stressful moments, some individuals will begin to hyperventilate—that is, their breathing will be very shallow and quick. A by-product of hyperventilation is much lower levels of CO2 in the blood. Which effect would you also expect to find? Select all that apply. (a) a decreased blood pH, less than 7.2 (b) decreased stimulation of chemoreceptors in the brainstem (c) increased stimulation of chemoreceptors in the brainstem (d) increased blood pH, greater than 7.2
(b) decreased stimulation of chemoreceptors in the brainstem (d) increased blood pH, greater than 7.2
Shown below is the start of a coding region within the first exon of a gene. What is the PAM sequence of the bottom strand of DNA? 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' (a) 3'-GGT-5' (b) 5'-AGG-3' (c) 5'-CGG-3' (d) 3'-AGG-5'
(a) 3'-GGT-5'
Shown below is the start of a coding region within the first exon of a gene. Which sequence could you use for your sgRNA? 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3'3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' (a) 5' CAAGAGAAGTACAGTAATGA 3' (b) 3' CAAGAGAAGTACAGTAATGA 5' (c) 5' GTTCTCTTCATGTCATTACT 3' (d) 3' GTTCTCTTCATGTCATTACT 5'
(a) 5' CAAGAGAAGTACAGTAATGA 3'
You discover a new type of marine organism that has the kidneys of a fish but no gills. Based on what you know about other aquatic organisms, the newly discovered organism is ____________ compared to the surrounding water. (a) isotonic (b) hypotonic (c) hypertonic
(b) hypotonic This organism likely produces ammonia as its nitrogenous waste. This requires a lot of water for excretion. Because the fish is hypotonic, it will constantly take on water from its environment. The kidneys are able to produce copious amounts of dilute urine quickly to deal with the constant absorption of water.
Shown below is the start of a coding region within the first exon of a gene. How many Cas9 PAM sequences are present? 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' (a) 0 (b) 3 (c) 2 (d) 4 (e) 1
(c) 2
Shown below is the start of a coding region within the first exon of a gene. Which sequence could you use for your sgRNA? 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' (a) 3' CGACACAGCATGTCAAGAGA 5' (b) 5' CGACACAGCATGTCAAGAGA 3' (c) 3' GCTGTGTCGTACAGTTCTCT 5' (d) 5' GCTGTGTCGTACAGTTCTCT 3'
(c) 3' GCTGTGTCGTACAGTTCTCT 5'
The duct that connects the pancreas to the duodenum can sometimes become blocked. What is the result? (a) The digestive enzymes produced by the pancreas with enter the duodenum because they travel by the blood to reach the duodenum, not by a duct (b) The digestive enzymes produced by the pancreas enter the large intestine instead, and digestion proceeds as normal (c) The digestive enzymes back up into the pancreas and may start to digest the pancreas (d) The digestive enzymes are not affected because they are stored in the gallbladder until they are needed in the duodenum (e) Nothing happens, because the pancreas does not produce digestive enzymes
(c) The digestive enzymes back up into the pancreas and may start to digest the pancreas
The primary function of the loop of Henle is: (a) active secretion of other wastes from the bloodstream (b) to concentrate the filtrate passing through the loop (c) to generate a concentration gradient between the inner medulla and outer cortex (d) to dilute the filtrate passing through the loop (e) selective reabsorption of glucose and other solutes into the bloodstream
(c) to generate a concentration gradient between the inner medulla and outer cortex
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. (T/F) 3. The sympathetic nervous system stimulates the adrenal glands.
3. True When blood pressure decreases, the juxtaglomerular apparatus releases renin. Renin converts angiotensinogen to angiotensin I. ACE (angiotensin converting enzyme) from the lungs converts angiotensin I to angiotensin II. The presence of angiotensin II causes the release of aldosterone from the adrenal glands and stimulates the distal convoluted tubule to take up more salt and water. The increased uptake of salt and water increases blood volume and blood pressure.
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. (T/F) 4. Water absorption by the distal convoluted tubule will decrease
4. False When blood pressure decreases, the juxtaglomerular apparatus releases renin. Renin converts angiotensinogen to angiotensin I. ACE (angiotensin converting enzyme) from the lungs converts angiotensin I to angiotensin II. The presence of angiotensin II causes the release of aldosterone from the adrenal glands and stimulates the distal convoluted tubule to take up more salt and water. The increased uptake of salt and water increases blood volume and blood pressure.
The three DNA fragments above are about to be sequenced. Which primers could be used to sequence the following DNA fragments? Select all that apply. 5'-GGCCC-3' 5'-CCATT-3' 5'-AATGG-3' 5'-CCGGG-3'
5'-AATGG-3' 5'-CCGGG-3'
The three DNA fragments above are about to be sequenced. What is the nucleotide sequence that will be recorded from this synthesis reaction for the bottom (3rd) DNA fragment? 5'-AATGGTGACTATTGCCCGG-3' 5'-CCGGGATCAGGACGCCATT-3' 5'-CCGGGCAATAGTCACCATT-3' 5'-AATGGCGTCCTGATCCCGG-3'
5'-AATGGCGTCCTGATCCCGG-3'
Your computer records the raw sequencing data shown below. Which of the following sequences is (are) represented in this dataset? (Mark all that apply) 5'-CCGGAA-3' 5'-TAGGCC-3' 5'-CCGGAT-3' 5'-TAAGCC-3'
5'-CCGGAA-3' 5'-CCGGAT-3'
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. (T/F) 5. Circulating levels of angiotensin II will increase
5. True When blood pressure decreases, the juxtaglomerular apparatus releases renin. Renin converts angiotensinogen to angiotensin I. ACE (angiotensin converting enzyme) from the lungs converts angiotensin I to angiotensin II. The presence of angiotensin II causes the release of aldosterone from the adrenal glands and stimulates the distal convoluted tubule to take up more salt and water. The increased uptake of salt and water increases blood volume and blood pressure.
At the beginning of ventricular diastole, blood pressure in atria is _______ blood pressure in the ventricles A. Higher than B. Lower than C. The same as D. No way to know!
A. Higher than Blood flows down pressure gradients from high to low pressure
Signals from the sympathetic nervous system cause arteriole B to constrict. As a result, the amount of blood flowing through the other three arterioles will ____________. A. Increase B. Decrease C. Not change
A. Increase
Decreased Na+ in body fluids (Na+ depletion) __________ renin secretion A. Increases B. Decreases C. Has no effect on
A. Increases
Increased osmolarity of body fluids__________ ADH secretion A. Increases B. Decreases C. Has no effect on
A. Increases
The lungs are highly branched. What is the primary purpose of this branching? A. It increases the surface area of the lungs B. It increases the volume of the lungs C. A and B are correct D. None of the above
A. It increases the surface area of the lungs
At the time that the ventricles begin to empty, blood pressure in aorta is _______ blood pressure in the ventricles. A. Higher than B. Lower than C. The same as D. No way to know!
A. Lower than
Part 1: Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement
A. Net movement to the right
Part 3: Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement
A. Net movement to the right
Fish deal with similar issues. If a saltwater fish were unable to regulate chloride - what would happen? A. The fish would swell with water. B. Nothing, sodium would still be secreted. C. The fish would find fresh water to live. D. The fish would loose water and shrivel up.
A. The fish would swell with water. Reduced sodium/chloride (salt) excretion will make the fish more concentrated inside reducing the osmotic flow of water out of the body
The runner begins to experience a headache, and their body temperature has risen slightly. The first aid station gives them water thinking they have heat stroke The runner's headache will get: A. Worse B. Better C. Stay the same
A. Worse
The ventricles begin to empty at which region of the cardiac cycle?
C
Insects, reptiles, and birds excrete uric acid as their form of nitrogenous waste. Uric acid is much less water-soluble than urea. Why does this allow these organisms to conserve more water than a mammal with extensive kidney tubules for water reabsorption? A. The high solubility of uric acid allows the excretory system to reabsorb water. B. Uric acid levels stay high in the blood maintaining a strong osmotic gradient, which allows water to be reabsorbed. C. After precipitation*, uric acid no longer influences osmolarity; water returns to the hypertonic tissues. D. After precipitation*, uric acid no longer influences osmolarity; water leaves the hypertonic tissues. **Precipitation is the process by which solutes come out of solution. If you're not part of the solution, you're part of the precipitation.
C. After precipitation, uric acid no longer influences osmolarity; water returns to the hypertonic tissues.
Part 2: Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement
C. No net movement
When do the atria repolarize? A. P wave B. PR segment C. QRS complex D. ST segment E. T wave
C. QRS complex
When do the ventricles depolarize? A. P wave B. PR segment C. QRS complex D. ST segment E. T wave
C. QRS complex
What does the ST interval represent? A. The heart is relaxing B. The ventricles are filling C. The atria are filling
C. The atria are filling
At high altitudes, the percentage of oxygen is ___________ the percentage of oxygen at sea level. A. Higher than B. Lower than C. The same as
C. The same as Sea level O2 is 21% Total Pressure = 760 mm/Hg Partial pressure of oxygen is 160 mm/Hg At 10,000 feet O2 is 21% Total Pressure = 523 mm/Hg Partial pressure of oxygen 110 mm/Hg
The same red blood cell leaves the heart again, but this time instead of traveling to the liver, it travels to a skeletal muscle that is actively respiring. At each point on its journey (A-D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell. What is the approximate O2 saturation at point D? A. 75% B. 25% C. 40% D. 10% E. None of the above
D. 10%
Which region on the EKG corresponds to number 2 on the figure? A. P wave B. PR Segment C. QRS Complex D. ST Segment E. T Wave
D. ST Segment The ST Segment represents the interval between ventricular depolarization and repolarization.
Which of the following correctly represents the order in which blood flows through structures of the heart? A. Right ventricle, left atrium, pulmonary artery B. Left atrium, pulmonary artery, right atrium C. Pulmonary artery, aorta, left ventricle D. Superior vena cava, pulmonary vein, aorta
D. Superior vena cava, pulmonary vein, aorta
In the proximal convoluted tubule, which of the following molecules is being secreted? A. Sodium B. Potassium C. Glucose D. Urea E. All of the above
D. Urea
How many cell membranes does a carbon dioxide molecule diffuse through to move from the cytosol of a red blood cell to the inside of an alveolus in the lungs? A. 1 B. 2 C. 3 D. 4 E. 5 or more
E. 5 or more
(T/F) Consider the figure shown of an electrocardiogram (EKG) trace and the typical action potential of cells in the left ventricle. Indicate whether the statement is true or false. Ventricular diastole occurs at the interval labeled 2 on the action potential figure.
False
(T/F) Patient A's blood will likely exhibit difficulty clotting.
False
Consider the figure below. (T/F) The cells around region B use more ATP than those in region G.
False
You are looking at DNA-protein binding data in a 14 kb region of the genome. (T/F) This data provides biochemical and evolutionary evidence of functionality for a non-coding region of the genome.
False
(T/F) The pulmonary vein carries deoxygenated blood.
False Arteries carry blood away from the heart and veins carry blood back to the heart. The pulmonary vein carries oxygenated blood from the pulmonary circuit back to the heart.
(T/F) The marathon runner's muscles aren't working well, you determine it is not due to fatigue. They have been drink water at each watering station. They are still dehydrated and should drink water.
False Q: How might this effect Na+ concentrations? A: Na+ concentrations decrease
(T/F) Patient B likely exhibits some swelling of the body tissues ("edema") due to an osmotic imbalance in his blood.
True
(T/F) Patient B's blood pH is buffered by the appropriate amount of bicarbonate
True
You are looking at DNA-protein binding data in a 14 kb region of the genome. (T/F) This data provides evidence of cis-regulatory elements.
True
One of the roles of the kidneys is to help buffer body fluids so that they are not too acidic or too basic. The cells of the renal tubule secrete H+ into the tubule lumen, and absorb bicarbonate (HCO3-), passing it into the tissue fluid. Consider the reaction catalyzed by the enzyme carbonic anhydrase, shown in the accompanying figure and below. ((Given)) (T/F) During heavy exercise, the reaction shifts to the right in tubule lumen of the nephron.
True Carbon dioxide coming from the body moves into the cells of the tubule and is converted to bicarbonate to help buffer tissue surrounding the tubules and excrete hydrogen ions. The movement of hydrogen ions into the lumen drives the reaction to the right, with CO2 and H2O.
(T/F) Consider the figure shown of an electrocardiogram (EKG) trace and the typical action potential of cells in the left ventricle. Indicate whether the statement is true or false. Atria are emptying at the interval labeled 4 on the action potential figure.
True The plateau phase on the action potential figure helps inhibit tetanus in the heart. Diastole is when the heart is filling and ventricles are relaxed. Notice that the graph wave shown in the EKG figure represents ventricular contraction and systole of the cardiac cycle. At point 4 on the action potential figure, the atria are emptying into the ventricles, which are relaxed, and readying the ventricles for contraction.
Consider the figure below. (T/F) The osmolarity of tissue fluids surrounding the nephron is higher at point D than at point G.
True At point D, the extracellular fluid surrounding the nephron is about 1000 miliosmoles. At point G, the extracellular fluid is about 300 miliosmoles.
From the information provided, mutations in this breast cancer-associated gene tend to be primarily synonymous substitutions. False True
false
Sequences that are conserved (i.e., similar in many different organisms) are unlikely to be functionally important. False True
false
Using current DNA-sequencing technology, it is possible to sequence an entire chromosome (e.g., human chromosome 1, which contains approximately 250 million nucleotides) as one long molecule. False True
false
How many different sequences are represented in this dataset? 1 3 5 or more 4 2
3
Freshwater fish are in a hypotonic environment. How do their gill chloride cells function in this environment? (a) Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions following (b) Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions moving in the opposite direction (c) Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions moving in the opposite direction. (d) Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions following
(a) Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions following To keep ion balance, freshwater fish pump chloride ions, with sodium ions following, into the body through chloride cells on the gills. This also compensates for the water freshwater fish take in from living in a hypotonic environment. As well, freshwater fish produce large volumes of urine to remove excess water.
Glucose enters the epithelial cells of the small intestine against its concentration gradient. Select the BEST explanation from the following. (a) Glucose is co-transported with Na+, which moves down its concentration gradient into the cell (b) Glucose is transported through a glucose pump in the apical membrane that hydrolyzes ATP to ADP and Pi (c) Glucose is co-transported in the Na+/K+ pump (d) Glucose enters by diffusion (e) Glucose follows the water that is pumped into the cell
(a) Glucose is co-transported with Na+, which moves down its concentration gradient into the cell
Many mutations in receptor kinases that lead to cancer allow the receptor to dimerize and become activated, even in the absence of signaling molecules. An example is a mutant form of the EGF receptor kinase called Her2/neu. An antibody that prevents dimerization of Her2/neu receptor kinases is being tested for its effectiveness in preventing cancer. At which stage does this drug work? (a) It prevents the receptor from becoming activated. (b) It prevents the signaling cell from producing the signal. (c) It prevents the termination of the signal. (d) It prevents the receptor from bonding to the signal.
(a) It prevents the receptor from becoming activated.
In systemic tissue fluids, the enzyme carbonic anhydrase catalyzes the reaction CO2 + H2O → H2CO3 (which then can dissociate into H+ and HCO3-). In fact, CO2 released from cells is converted to HCO3- ions and travels in that form in the bloodstream. HCO3- is reconverted to CO2 + H2O in the pulmonary capillaries by the same enzyme, and there the CO2 is exhaled. How is it possible for the same enzyme to catalyze reverse reactions? (a) The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O. (b) The lungs contain an allosteric inhibitor that prevents the formation of carbonic acid. (c) There must be two forms of carbonic anhydrase. One form catalyzes the forward reaction CO2 + H2O → H2CO3 and the other catalyzes the reverse reaction H2CO3 → CO2 + H2O.
(a) The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O. The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O.
Sometimes while traveling, people are infected with a protist parasite, Giardia. One of the side effects of Giardia infection is diarrhea. When someone has diarrhea, they lose excessive water and salt from the body. The result is loss of Na+, dehydration that leads to decreased extracellular volume and plasma volume, and decreased arterial blood pressure. Given this, would the vasopressin secretion of a person infected with Giardia: (a) increases (b) decreases (c) stay the same
(a) increases When a person has diarrhea, they fail to reabsorb ions from the small intestine, and fluids entering the large intestine have high solute concentrations. This keeps higher volumes of water in the large intestine. In order to compensate for water loss through the digestive system, vasopressin is released. The presence of vasopressin increases the permeability of the collecting ducts to water, so water is returned to the interstitial fluid. This decreases the amount of water lost through urination.
The random thermal motion of molecules results in movement from a region of higher concentration to a region of lower concentration, and this is called diffusion. The rate of diffusion across a barrier is defined by Fick's law of diffusion: Rate of diffusion = k X A X (C2 - C1) Lk = diffusion coefficient, which depends on solubility and temperature A = surface area for exchange C2 - C1 = difference in partial pressure of gas on either side of the barrie rL = thickness of the barrier to diffusion Consider the structure and function of respiratory membranes. Respiratory membranes 1 and 2 represent membrane barriers between the outside medium and the inside of the organism.Which would have the higher rate of diffusion, respiratory membrane 1 or respiratory membrane 2? (a) respiratory membrane 2 (b) respiratory membrane 1
(a) respiratory membrane 2 The larger the surface area to volume ratio, the faster the rate of diffusion across the surface.
Shown below is the start of a coding region within the first exon of a gene. You design two sgRNAs that will allow you to model a deletion mutation that has been found in cancer cells. What size DNA fragment do you expect to delete using 2 sgRNAs? 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' (a) 28 bp (b) 27 bp (c) 26 bp (d) 29 bp (e) You cannot model deletion mutations using 2 sgRNAs
(b) 27 bp
Shown below is part of a coding region within the first exon of a gene. Where will Cas9 cause a double stranded DNA break? (a) B (b) A (c) D (d) C
(b) A
The random thermal motion of molecules results in movement from a region of higher concentration to a region of lower concentration, and this is called diffusion. The rate of diffusion across a barrier is defined by Fick's law of diffusion: Rate of diffusion = k x A x (C2 - C1) Lk = diffusion coefficient, which depends on solubility and temperature A = surface area for exchange C2 - C1 = difference in partial pressure of gas on either side of the barrier L = thickness of the barrier to diffusion Consider the structure and function of respiratory membranes. Respiratory membranes 1 and 2 represent membrane barriers between the outside medium and the inside of the organism.Which term in the equation is different between respiratory membranes 1 and 2? (a) C2 - C1 (b) A (c) L (d) k
(b) A
What happens during the P wave? A. Atria depolarize B. Atria repolarize C. Ventricles depolarize D. Ventricles repolarize
A. Atria depolarize
Chemoreceptors in the circulatory system detect changes in circulating pCO2. If CO2 concentrations get too high, the rate of ventilation increases. Why does this make sense? (a) It makes sense because hemoglobin carries CO2 and, therefore, blocks oxygen binding to the heme site, creating an oxygen deficiency. (b) Actually, it does not make sense. There is no relationship between CO2 and ventilation rate. (c) It makes sense because CO2 is formed from O2 and, therefore, CO2 is a sign that oxygen is being consumed. (d) It makes sense because tissues that are more actively working produce more CO2 and, therefore, need more O2.
(d) It makes sense because tissues that are more actively working produce more CO2 and, therefore, need more O2. During cellular respiration, carbon dioxide is produced as sugars are oxidized.
One of the effects of the hormone secretin is to stimulate the release of bicarbonate ions into the duodenum, which neutralizes the acid that enters the duodenum with food from the stomach. One consequence of neutralizing the pH in the intestine is that: (a) enzymes that catalyze the hydrolysis of carbohydrates are denatured (b) carbohydrates are not as easily broken down in this neutral environment (c) the enzymatically catalyzed hydrolysis of carbohydrates that began in the stomach is halted in the duodenum (d) enzymes that catalyze the hydrolysis of carbohydrates are active
(d) enzymes that catalyze the hydrolysis of carbohydrates are active
The figure shown is of tubes illustrating O2 uptake at the fish gill. The values shown in the tubes indicate percent fluid saturation of O2. Which answer choice identifies the fluid and the direction of flow correctly? Posterior-----Anterior 20----40----60----80 (Tube 1) 15----35-----55----75 (Tube 2) Fish movement ----> (a) 1 = Blood --> 2 = Water <-- (b) 1 = Water <-- 2 = Blood <-- (c) 1 = Water --> 2 = Blood <-- (d) 1 = Blood <-- 2 = Water --> (e) 1 = Water <-- 2 = Blood -->
(e) 1 = Water <-- 2 = Blood --> Water always has a slightly higher concentration of oxygen than the blood. Water flows over the gill lamellae in the opposite direction of blood flow in the gill lamellae. This maintains a concentration gradient where the water is always at slightly higher concentrations of oxygen than the blood, so that oxygen will move down its concentration gradient into the blood of the fish across the gill lamellae.
Referring to Figure shown, identify which type of cell-cell interaction is most likely to force the products of digestion to be absorbed across microvilli of intestinal cells rather than allowing them to leak between cells. (a) plasmodesmata (b) desmosomes (c) gap junctions (d) hemidesmosomes (e) tight junctions
(e) Tight Junctions
During heavy exercise, the pO2 in muscle may drop to 20 mmHg. Considering the oxygen-hemoglobin dissociation curve shown, what is the approximate percent O2 saturation of hemoglobin in venous blood returning from skeletal muscles during heavy exercise? (a) approximately 100% (b) approximately 50% (c) approximately 75% (d) nearly 0% (e) approximately 20%
(e) approximately 20% Start at the x-axis and find 20 mmHg. From there, draw a line up to the curve. From the point where that line intersects the curve, draw a straight line to the y-axis to determine percent saturation.
Bisphosphoglyceric acid (BPG) is a byproduct of glycolysis released into the bloodstream when an animal's supply of oxygen is low. Like protons, it decreases hemoglobin's affinity for O2. The effect of high BPG levels would be that: (a) hemoglobin picks up more O2 in the lungs than it would without BPG. (b) hemoglobin loses its cooperative binding of oxygen. (c) hemoglobin now binds more oxygen at low partial pressures than at high partial pressures. (d) hemoglobin holds on to more of its O2 than it would without BPG. (e) hemoglobin releases more of its bound O2 than it would without BPG.
(e) hemoglobin releases more of its bound O2 than it would without BPG. BPG causes the same response as increased proton concentrations. BPG would cause the affinity of hemoglobin to oxygen to decrease and shift the oxygen binding curve to the right. This results in release of more oxygen at the tissues.
You are a medical student working in a cancer research laboratory. Your boss has given you samples of cancer cells and blood from a patient. She has told you that the cells have no mutations in any of their signaling molecule proteins (that is, all the proteins are normal), but that the cells' signaling transduction properties are hyperactive, causing them to divide too rapidly. Which answer choices could account for the increased cell proliferation in the patient? Select all that apply. - None of the other answer options are correct. - The concentration of a signaling molecule in the patient is higher than usual. - The cells taken from the patient exhibit a reduced level of signal amplification. - The cells taken from the patient have more growth factor receptors than normal.
- The concentration of a signaling molecule in the patient is higher than usual. - The cells taken from the patient have more growth factor receptors than normal.
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. (T/F) 1. Circulating levels of aldosterone will increase.
1. True When blood pressure decreases, the juxtaglomerular apparatus releases renin. Renin converts angiotensinogen to angiotensin I. ACE (angiotensin converting enzyme) from the lungs converts angiotensin I to angiotensin II. The presence of angiotensin II causes the release of aldosterone from the adrenal glands and stimulates the distal convoluted tubule to take up more salt and water. The increased uptake of salt and water increases blood volume and blood pressure.
A retrotransposon known as Alu1 is about 300 base pairs in length and is present in the human genome in about 1 million copies. Approximately what percentage of the human genome is accounted for by this transposon? 30% 1% 0.03% 0.1% 10%
10% The size of the human genome 3.1 × 109 base pairs (bp). 106 copies of 300 bp retrotransposon comprise 3 × 108 bp, or 10%.
A retrotranspon known as LINE1 is about 1000 base pairs in length and is present in the human genome in about 516,000 copies. Approximately what percentage of the human genome is accounted for by this transposon? 1.7% 17% 0.0017% 0.17% 0.017%
17% The total amount of DNA of all copies of the retrotransposon is 103 bp x 516 x 103 = 516 x106 bp. The size of the human genome is 3100 Mp, or 3 x 109 bp. Then (516 x 106x 100)/ 3.1 x 109 = 0.165, or ~17%.
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. (T/F) 2. Circulating levels of renin will decrease.
2. False When blood pressure decreases, the juxtaglomerular apparatus releases renin. Renin converts angiotensinogen to angiotensin I. ACE (angiotensin converting enzyme) from the lungs converts angiotensin I to angiotensin II. The presence of angiotensin II causes the release of aldosterone from the adrenal glands and stimulates the distal convoluted tubule to take up more salt and water. The increased uptake of salt and water increases blood volume and blood pressure.
One of the functions of the cardiovascular and respiratory systems is to rid the body of CO2. Where does the CO2 come from? A. CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration. B. CO2 is a breakdown product of the carbohydrates reduced in cellular respiration. C. CO2 is produced when inhaled oxygen combines with carbon atoms from carbohydrates. D. CO2 is produced when the oxygen atoms of water combine with carbon atoms.
A. CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration.
Patient A received a complete blood count while Patient B received a chemistry panel. Based on the results, which test analyzes the composition of the cellular portion of the blood? A. Complete blood count B. Chemistry panel C. No way to know
A. Complete blood count
A red blood cell travels to the lungs and back to the heartA red blood cell has just left the right ventricle of the heart. It travels to the lungs, back to the heart, to the liver, and then back to the heart again. At each point on its journey (A-D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell. (You may assume the pH of the blood is 7.4.) What is the approximate O2 saturation at point D? A. 75% B. 30% C. 40% D. 10% E. None of the above
A. 75%
A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. Chemoreceptors on the ________ sense oxygen levels in the blood and relay this information to respiratory control centers in the brain. A. Aorta B. Pulmonary trunk C. Pulmonary vein D. Superior vena cava
A. Aorta
The ventricles finish filling with blood after the _______. A. Atria depolarize B. Atria repolarize C. Ventricles depolarize D. Ventricles repolarize
A. Atria depolarize
How does blood pH at muscle tissue compare to blood pH at the lungs? A. Blood pH is higher at the muscle B. Blood pH is lower at the muscle C. Blood pH is the same at the muscle
B. Blood pH is lower at the muscle
A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. What is acting as the homeostatic sensor? A. Oxygen B. Carbon Dioxide C. Heart D. Brainstem E. Diaphragm
B. Carbon Dioxide
During a typical cardiac cycle, cell depolarization triggers muscle _______ and repolarization triggers muscle ________. A. Contraction; contraction B. Contraction; relaxation C. Relaxation; contraction D. Relaxation; relaxation
B. Contraction; relaxation
ACE inhibitors are drugs that inhibit an enzyme called ACE that converts angiotensin I into angiotensin II. Treatment with an ACE inhibitor will cause blood pressure to _________. A. Increase B. Decrease C. Stay the same
B. Decrease
If carbonic anhydrase stopped working, the amount of oxygen delivered to systemic tissues would _________. A. Increase B. Decrease C. Not change
B. Decrease
When the volume of blood passing through the kidney increases, renin production by the kidney will most likely _________. A. Increase B. Decrease C. Stay the same
B. Decrease
A climber is scaling Mt. Everest. As her elevation increases, the average amount of oxygen bound to the hemoglobin in her red blood cells ________. A. Increases B. Decreases C. Does not change
B. Decreases
Increased ADH secretion__________ urine output A. Increases B. Decreases C. Has no effect on
B. Decreases
When the diaphragm contracts, the volume of the lungs _____ and the pressure in the lungs ______ A. Increases; increases B. Increases; decreases C. Decreases; increases D. Decreases; decreases
B. Increases; decreases
At high altitudes, the partial pressure of oxygen is ______ the partial pressure of oxygen at sea level. A. Higher than B. Lower than C. The same as
B. Lower than
Signals from the sympathetic nervous system cause arteriole B to constrict. Arteriole B is most likely carrying blood to ________ (Hint: fight or flight). A. The brain B. The small intestine C. A leg muscle D. The heart
B. The small intestine
Which one of the following is a feature of DNA that could allow you to distinguish between a DNA sequence that is protein coding and a DNA sequence that is not? Protein-coding DNA sequences contain U (Uracil), and nontranscribed sequences contain T (Thymine). Protein-coding regions frequently contain long open reading frames; others rarely do. All of these choices are correct. Protein-coding sequences are sets of amino acids; others are sets of nucleotides. Protein-coding sequences are single stranded; others sequences are double stranded.
Protein-coding regions frequently contain long open reading frames; others rarely do.
