BIO 151 Quiz Make up

¡Supera tus tareas y exámenes ahora con Quizwiz!

Is the following a modification made to a pre-mRNA from eukaryotic cells? YES/NO - "A specialized-nucleotide cap is added to the 3' end of the pre-mRNA"

NO

You imagine that not all life forms (if you include viruses and aliens) must have double-stranded DNA molecules as their genetic material. Theoretically, a life form could have a genome made of: Genome = 15%G, 0%T, 32%C, 25%U, 28%A Which type of genome is each of these life forms most likely to have based on the percentage total nucleotides in their genome? (Assume that the same base pairing rules apply. Also remember that RNA contains Uracil, not Thymine and that it base pairs with Adenine) Select one: a. Single-stranded RNA b. A hybrid of one strand of RNA with one strand of DNA. c. Single-stranded DNA d. Double-stranded DNA e. Double-stranded RNA

a

The following is a transcription unit from a gene: 5'ATTCTAGCTAGCATGCTACGATGCTTTACAAGCGCGTACGTAC3' 3'TAAGATCGATCGTACGATGCTACGAAATGTTCGCGCATGCATG5' The mRNA transcribed from this gene is: 5'AUUCUAGCUAGCAUGCUACGAUGCUUUACAAGCGCGUACGUAC3' Based on this information: Which strand is the template strand in the DNA as shown above? Select one: a. bottom DNA strand b. top DNA strand

a. bottom

You imagine that not all life forms (if you include viruses and aliens) must have double-stranded DNA molecules as their genetic material. Theoretically, a life form could have a genome made of: Genome = 15%G, 0%T, 15%C, 35%U, 35%A Which type of genome is each of these life forms most likely to have based on the percentage total nucleotides in their genome? (Assume that the same base pairing rules apply. Also remember that RNA contains Uracil, not Thymine and that it base pairs with Adenine) Select one: a. Double-stranded RNA b. A hybrid of one strand of RNA with one strand of DNA c. Single-stranded RNA d. Single-stranded DNA e. Double-stranded DNA

a. double stranded RNA

Is this an example of a proto-oncogene mutating into an oncogene? "A loss of function mutation in CDK inhibitor" Select one: a. No b. Yes

a. no

Is this an example of a proto-oncogene mutating into an oncogene? "A mutation in p53 such that it is always bound to the DNA" Select one: a. No b. Yes

a. no

You imagine that not all life forms (if you include viruses and aliens) must have double-stranded DNA molecules as their genetic material. Theoretically, a life form could have a genome made of: Genome = 15%G, 25%T, 32%C, 0%U, 28%A Which type of genome is each of these life forms most likely to have based on the percentage total nucleotides in their genome? (Assume that the same base pairing rules apply. Also remember that RNA contains Uracil, not Thymine and that it base pairs with Adenine) Select one: a. A hybrid of one strand of RNA with one strand of DNA b. Double-stranded RNA c. Single-stranded DNA d. Double-stranded DNA e. Single-stranded RNA Feedback Your answer is correct. The correct answer is: Single-stranded DNA Question 11 Correct 1.00 points out of 1.00 Flag question Question text Is the following a modification made to a pre-mRNA from eukaryotic cells? "Exons are removed and introns are kept" Select one: a. no b. yes

a. no

Is the following a component of a processed, mature mRNA transcript? "Protein coding sequence" Select one: a. yes b. no

a. yes

s this an example of a proto-oncogene mutating into an oncogene? "A mutation in CDK that does not allow it to be phosphorylated by Wee1 (the kinase that phosphorylates and inhibits CDK)." Assume CDK is still active as a kinase. Select one: a. Yes b. No

a. yes

The following is a transcription unit from a gene: 5'ATTCTAGCTAGCATGCTACGATGCTTTACAAGCGCGTACGTAC3' 3'TAAGATCGATCGTACGATGCTACGAAATGTTCGCGCATGCATG5' The mRNA transcribed from this gene is: 5'AUUCUAGCUAGCAUGCUACGAUGCUUUACAAGCGCGUACGUAC3' Based on this information: Where is the promoter DNA with respect to this transcription unit? Select one: a. To the right of this transcription unit b. To the left of this transcription unit

b

Is the following a modification made to a pre-mRNA from eukaryotic cells? "The entire 3'UTR is removed" Select one: a. yes b. no

b. no

Is this an example of a proto-oncogene mutating into an oncogene? "A mutation in TFa such that it cannot enter the nucleus" Assume TFa is a transcription factor involved in the cell division signaling pathway. Select one: a. Yes b. No

b. no

The following is a segment of DNA containing the beginning of the coding region of a gene: 5'- CCGTATGAAGTCAGTTCTCTGTATC -3' 3'- GGCATACTTCAGTCAAGAGACATAG -5' If an RNA polymerase were to transcribe the gene from right to left on the DNA as shown, is the top or the bottom strand serving as the template strand? Select one: a. bottom strand b. top strand

b. top

Is the following a component of a processed, mature mRNA transcript? "5` UTR" Select one: a. no b. yes

b. yes

Is the following a modification made to a pre-mRNA from eukaryotic cells? "The 3' end of the mRNA is cleaved and a poly-A tail is added to the pre-mRNA at the 3' end" Select one: a. no b. yes

b. yes

Is this an example of a proto-oncogene mutating into an oncogene? "An E2F transcription factor that cannot bind Rb and is always active" Select one: a. No b. Yes

b. yes

Is the following a component of a processed, mature mRNA transcript? "The polyadenylation signal sequence" Select one: a. no b. yes

yes


Conjuntos de estudio relacionados

Algebra 2.11: Reasoning + quiz answers

View Set

Chapter 7: Identity and Difference in Organizational Life

View Set

Health, Society and Culture exam 1

View Set

LS 7A - Week 8 - Practice Exam Questions

View Set

France Under Louis XIV: Chapter 16 Section 2

View Set