Bio 160 Final Exam
If a codon reads 5' UCA 3', the corresponding anticodon would read 3'------ G ----- 5'.
AGU
What do cells do to activate nucleotides before polymerization can occur?
Add two additional phosphate groups
label the functional group: NH2
Amino
Which of the following correctly describes how amino acids polymerize?
Amino acids polymerize when a bond forms between the carboxyl group of one amino acid and the amino acid group of another.
Which of the following adds an amino acids to a tRNA?
Aminoacyl tRNA syntheses
Which of the following does NOT occur post -translational?
An mRNA is degraded in the cytoplasm
What catalyzes peptide bond formation in the ribosome?
An rRNA
Which of the following terms is least related to the other terms?
Benign tumor
If one strand of a DNA molecule is 5' GGATCC 3' , then the complementary strand would be 3' ____________ 5'
CCTAGG
If a segment of a DNA template strand is 3' GGAACCTT 5' then the corresponding mRNA would be 5' ____________ 3'
CCUUGGAA
Which of the following statements is false?
Carrier proteins can transport molecules from a low to a high concentration
Which of the following facilitates the proper folding of proteins
Chaperones
Gentoype is to --- as phenotype is to ---.
DNA base sequence; physical traits that are products of the proteins produced.
Which of the following statements about DNA and RNA is FLASE?
DNA can have a tertiary structure, where as RNA cannot.
Catalyzes the joining of Okazaki fragments
DNA ligase
Removes the RNA primer and replaces it with DNA
DNA polymerase I
Synthesizes the daughter strands
DNA polymerase III
Which of the following summarizes the central dogma of biology?
DNA--> RNa--> protein
Reaction that links monomer molecules, releasing a water molecule for each bond formed
Dehydration synthesis
Which type of bond stabilizes the tertiary structures of proteins.
Disulfide bonds, hydrogen bonds, and ionic bonds
DNA replication is semiconservative meaning that following replication of double stranded DNA molecule -----.
Each double stranded molecule includes one parental and one daughter strand.
Which of the following domains contain eukaryotes?
Eukarya only
Populations of organisms and their cellular components have changed over time through both selective and non-selective evolutionary processes.
Evolution
The leading strand is synthesized in the 5' --> 3' direction, and the lagging strand is synthesized in the 3' --> 5' direction
False
The addition or deletion of one or a few base pairs that shifts the reading frame of the mRNA.
Frameshift mutation
cell size is adequate and social signals are present
G1
DNA was successfully replicated
G2
Which of the following checkpoints determines whether or not the DNA was replicated correctly
G2 checkpoint
If one strand of a DNA molecule is 5' CATCGA 3' , then the complementary strand would be 3' ____________ 5'
GTAGCT
protein, lipid, and carbohydrate processing
Golgi apparatus
Which of these bonds is the weakest?
Hydrogen
Reaction that causes breakdown of larger molecules into smaller molecules by utilizing water
Hydrolysis
label the functional group: OH
Hydroxyl
Which of the following is a suggested explantation for an observation that can be tested?
Hypothesis
Which of the following FBIs is the "capable of reproduction" characteristic of life being related to in the following example? During reproduction, the information stored in DNA is passed from one generation to the next generation.
Information Flow, Exchange, and Storage
Information (DNA, for example) and signals are used and exchanged within and among organisms to direct their functioning.
Information, Flow, exchange and storage
Calvin cycle of photosynthesis: Carbon dioxide
Input
Calvin cycle of photosynthesis: NADPH
Input
light capturing reactions of photosynthesis: NADP+
Input
Chromosomes have properly segregated and MPF is absent
M- phase 2
chromosomes are attached to microtubules
M-phase 1
Which of the following statements is false about meiosis and mitosis?
Meiosis produces two cells while mitosis produces four cells.
label the functional group: CH3
Methyl
Which of the following statements is false?
Micro tubules allow cells with pseudopodia to move.
chitin:polysaccharide with its monomer
NAG only
light capturing reactions of photosynthesis: Carbon DIoxide
Neither
Which of the following DNA repair mechanisms fixes thymine dimers caused by UV radiation?
Nucleotide excision repair
Which of the following DNA repair mechanisms repairs thymine dimers?
Nucleotide excision repair
Which of the following correctly describes how nucleotides polymerize?
Nucleotides polymerize when a bind forms between the hydroxyl on the sugar component of one nucleotide and the phosphate group of another.
Calvin cycle of photosynthesis: G3P
Output
light capturing reactions of photosynthesis: NADPH
Output
light capturing reactions of photosynthesis: Oxygen
Output
Which of the following is NOT a stage in the Calvin cycle?
Oxidation
Cellulose 3D structure
Parallel strands joined by hydrogen bonds
All living things acquire, use, and release and cycle matter and energy for cellular / organismal functioning.
Pathways and Transformations of energy and matter
-A proton has a ---- charge and is ---- of an atom. -A neutron has a ---- charge and is ---- of an atom. -An electron has a ---- charge and is ---- of an atom.
- positive and found in the nucleus -neutral and found in the nucleus -negative and not found in the nucleus
-RNA polymerase begins transcribing the template -Holoenzyme binds to the promoter region -sigma dissociates
-2 -1 -3
bacterial translation in order from first to last (1-->6): -A peptide bond forms between the 1st and 2nd amino acids. -Small subunit binds the mRNA -The 2nd aminoacyl tRNA (carrying the 2nd amino acid) binds to the mRNA in the A site -The initiator tRNA binds to the mRNA in the P site -The large subunit binds to the small subunit -Translocation occurs
-5 -1 -4 -2 -3 -6
C is the element symbol for Carbon. The atomic number is ----. The mass number is ----. This isotope contains 6 protons and ---- neutrons.
-6 -14 -8
-analyze the results -ask a question -conduct an experiment -form a hypothesis and make a prediction -make an observation -make conclusions -publish results in a peer- reviewed journal -read peer- reviewed literature
-6 -2 -5 -4 -1 -7 -8 -3
-mature eukaryotic mRNA: -3' poly(A) tail -3' UTR -5' cap -5' UTR -Exons -Introns -Promoter -Start codon -Stop codon
-Present -Present -Present -Present -Present -Absent -Absent -Present -Present
If a segment of double-stranded DNA contains 40% thymine, it will contain ______% cytosine.
10
Stomach acid (pH 2) has a ---- times ---- H+ concentration than urine (pH 6).
10,000 and higher
Urine (pH 6) has ---- H+ concentration than stomach acid (pH 2)
10,000 times lower
If a diploid animal has 24 chromosomes in its body cells, how many chromosomes would be found in its gametes (sperm or egg cells)
12
step in cellular respiration: pyruvate processing
2
From its atomic number of 4 you can tell that the beryllium atom has----
2 protons and 2 neutrons
step in cellular respiration: citric acid cycle
3
Which of the following is the anti codon for this codon (5' AGC 3')
3' UCG 5'
If a segment of double-stranded DNA contains 20% guanine, it will contain ______% adenine.
30
A 2n = 4 cell undergoes mitosis and cytokinesis. How many chromosomes are in each daughter cell?
4
How many unpaired electrons are in the valence shell of a carbon atom?
4
step in cellular respiration: oxidative phosphorylation
4
If a double stranded DNA molecule was comprised of 10% adenine, what percent of the bases would be cytosine?
40%
If one strand of a DNA double helix has the sequence 3' CATGAG 5' what is the sequence fo the other DNA strand?
5' GUACUC 3'
Equation for photosynthesis
6 carbon dioxide +6 water ----> glucose+ 6 oxygen
How is light energy captured by plants?
A chlorophyll molecule absorbs a photon and becomes excited.
Which of the following mutations would MOST severely affect the protein coded for by a gene?
A frameshift mutation at the beginning of the gene
Which of the following could lead to cancer?
A mutation resulting in a hyperactive growth- stimulating protein
Which of the following does not lead to cancer?
A mutation resulting increased transcription of a tumor- suppressor gene
A proton has a charge of --- and --- located in the nucleus of the atom.
+1; is
eukaryotic gene expression in order from first to last (1-->5): -mRNA transported out of the nucleus -Protein folding, modification, and transport -RNA processing -Transcription -Translation
-3 -5 -2 -1 -4
step in cellular respiration: glycolysis
1
Which of the following phases is correctly paired with a major event that occurs with it?
Anaphase II of meiosis; sister chromatids seperate
Which of the following domains contain prokaryotes?
Bacteria; Archaea
label the functional group: COOH
Carboxyl
Catalyzes the breaking of hydrogen bonds between base pairs
Helicase
What are prions?
Misfolded versions of normals protein that can cause disease
A point mutation that changes one amino acid for another within a protein.
Missense mutation
peptidoglycan: polysaccharide with its monomer
NAG and NAM
Calvin cycle of photosynthesis: Oxygen
Neither
Which of the following statements is false?
Prokaryotes use basal transcription factors to locate promoters.
What is a stoma?
Small opening that regulates gas exchange and water balance
Which of the following is TRUE about protein folding?
Some proteins can fold spontaneously.
strach 3D structure
Unbranched or branched helices
snRNPs -----.
compose splicesomes
stores energy
fats
Mitosis is required for ----.
growth of a multicellular organism
Cells that contain one set of chromosomes are called ----- . Cells that contain two sets of chromosomes are called -----.
haploid; diploid
glycogen 3D structure
highly branched helices
the attraction between oppositely charged atoms after an electron is transferred from one atom to the other atom allowing both atoms to complete their outer shells
ionic
correct phase of meiosis: crossing over occurs
prophase I
correct phase of mitosis: Microtubules attach to the kinetochores
prophase/ prometa phase
correct phase of mitosis: Nuclear envelope breaks down
prophase/ prometa phase
correct phase of mitosis: Spindle apparatus forms
prophase/ prometa phase
lipid synthesis
smooth er
--- can function as hormones.
steriods
some are hormones
steroids
Which of the following would be the hardest at room temp? polyunsaturated fats, saturated fats, unsaturated fats, and waxes
waxes
do plants perform photosynthesis?
yes
does algae perform photosynthesis?
yes
does cyanobacteria perform photosynthesis?
yes
----- splits water and release --- as a by- product
Photosystem II; Oxygen
Which of the following occurs in BOTH eukaryotes and prokaryotes?
Post translational modifications
Which of the following levels of gene expression regulation would provide the fastest response time to changes in the environment?
Post-translational
This level is the sequence of amino acids in a protein.
Primary
Catalyzes the synthesis of the RNA primer
Primase
A muscle cell and a skin cell from the same individual have different structures and functions because they contain different ----.
Proteins
This level is the result of two or more protein subunits assembling to form a larger, biologically active protein complex.
Quaternary
Composed of RNA and proteins and is involved in protein synthesis
Ribosomes
Which of the following statements is false?
Ribosomes are composed of rRNAs and tRNAs
Has a single membrane associated with ribosomes and is involved in protein synthesis
Rough ER
DNA synthesis occurs during ----.
S phase
When does DNA replication occur?
S phase
This level describes the alpha-helices and beta-sheets that are formed by hydrogen bonding between the backbone atoms located near each other in the polypeptide chain.
Secondary
Which level of structure in DNA and RNA is formed by hydrogen bonding between nitrogenous bases?
Secondary
A point mutation that changes the sequence of the codon without changing the amino acid that is specified.
Silent mutation
Stabilizes the single-stranded DNA
Single-stranded DNA binding proteins
All living systems (organisms, ecosystems, etc.) are made of structural components whose arrangement determines the function of the systems.
Structure and Function
label the functional group: SH
Sulfhydryl
This level is achieved when a protein folds into a compact, three-dimensional shape stabilized by interactions between side-chain R groups of amino acids.
Tertiary
which level of DNA structure is formed by phosphodiester linkages?
Tertiary
Which of the following two molecules would cross a lipid bilayer the fastest and why?
Testosterone because it has fewer polar covalent bonds than sucrose
A given codon never codes for more than one amino acid.
The code is ambiguous
Once the ribosome locks onto the first codon, the reading frame is established.
The code is collinear (non- overlapping)
Most amino acids are coded for by more than one codon.
The code is degenerate (redundant)
With a few minor exceptions, all codons specify the same amino acids in all organisms.
The code is nearly universal.
Which of the following does not promote M phase?
The degeneration of MPF cyclin
Which of the following does NOT promote MPF Cdk activity?
The degradation of MPF Cyclin
Which of the following statements is true?
The nucleus has a double membrane and stores information(DNA).
Which of the following is NOT a nitrogenous base found in RNA?
Thymine
Which of the following is not a reason why prokaryotes need to regulate gene expression?
To create specialized cells (cellular differentiation)
Which strand is the template strand? 5' GGCTTACCGGCCAAACATCC 3' 3' CCGAATGGCCGGTTTGTAGG 5'
Top strand
Breaks and rejoins the DNA double helix to relieve tension
Topoisomerase
Which of the following levels of gene expression regulation would conserve the most energy?
Transcriptional
---- is the process of converting mRNA to an amino acid sequence
Translation
Which of the following is the strongest evidence that a protein's overall folded shape is essential to its function?
Unfolded proteins do not function normally.
Javier jumped off go the diving board and did a belly flop into the pool. What property of water explains why his abdomen and chest hurt after doing the belly flop?
Water molecules are cohesive.
Oxidative phosphorylation produces ---, ------.
Water; ATP,NAD+, FAD
What type of bond forms between two monosaccharides?
a glycosidic linkage
Which one of the following is NOT attached to the central carbon of a single amino acid?
a nitrogenous base
Which of the following lipids contain two fatty acid tails?
a phospholipid
Which of the following statements is correct?
a polar covalent bond is the attraction between oppositely charged atoms after an electron is transferred from one atom to the other atom allowing both atoms to complete their outers hells.
Which of the following would you expect of a eukaryote lacking telomerase?
a reduction in chromosome length in gametes.
What are the components of a nucleotide?
a sugar, a phosphate group, and a nitrogenous base
---- donate protons thus --- the pH of the solution
acids; lowering
If gene X is under positive transcriptional control, it means that regulatory protein is a(an)---- that 0---- transcription of gene X.
activator; promotes
A substrate binds to the --- of an enzyme.
active site
which of the following requires energy to transport materials?
active transport
when a molecule binds to an enzyme and changes the shape of the active site allowing the substrate to bind
allosteric activation
When a molecule binds to an enzyme and changes the shape of the active site preventing the substrate from binding
allosteric inhibition
Starch: polysaccharide with its monomer
alpha- glucose
glycogen: polysaccharide with its monomer
alpha-glucose
match with correct monomer: amino group
amino acid
match with correct monomer: carboxyl group
amino acid
match with correct monomer: r group (side chain)
amino acid
an ionic bond involves ------.
an attraction between ions of opposite charge
Defects in DNA repair systems lead to --- in unprepared mutations this ---- the risk of developing cancer.
an increase; increasing
correct phase of mitosis: Sister chromatids are separated and the chromosomes are pulled to opposite poles
anaphase
correct phase of meiosis. homologous chromosomes separate
anaphase I
correct phase of meiosis. sister chromatids separate
anaphase II
Recall Pasteur's experiment that provided support for the cell theory. The spontaneous generation hypothesis was rejected because cells---
appeared in the straight neck flask
in eukaryotes, transcription and translation must occur
at different times
---- gains protons during chemical reactions thus ---- the pH of the solutions.
bases and raising
In a beetle population living in a muddy environment, most of the beetles are green in color. Some of the beetles contain a mutation that result in them being brown in color this making it harder for the birds that eat them to see them. The brown color mutation is an example of ---
beneficial mutation
cellulose: polysaccharide with its monomer
beta-glucose
citric acid cycle releases NADH, FADH2, CoA, --- and ATP
carbon dioxide
pyruvate processing produces----, ---, and ----
carbon dioxide; NADH; and Acetyl CoA
enzymes ---.
catalyze reactions
Has fibers running through carbohydrate or protein matrix and provides protection and support
cell wall
structural support and protection of the cell
cell wall
Which of the following is NOT one of the FBIs?
cells
Which of the following is not one of the six most abundant elements found in organisms
chlorine
production of sugars via photosynthesis
chloroplasts
a molecule binds to the active site of an enzyme and blocks the substrate from binding
competitive inhibition
Which of the following is NOT a characteristic of life?
consist of multiple cells
Genetic variation is accomplished by----
crossing over, independent assortment, and random fertilization
In prokaryotes, transcription occurs in the
cytoplasm
in eukaryotes, translation occurs in the
cytoplasm
in prokaryotes, translation occurs in the
cytoplasm
location related to cellular respiration or fermentation: alcohol fermentation
cytoplasm
location related to cellular respiration or fermentation: citric acid cycle in prokaryotes
cytoplasm
location related to cellular respiration or fermentation: glycolysis in eukaryotes
cytoplasm
location related to cellular respiration or fermentation: glycolysis in prokaryotes
cytoplasm
location related to cellular respiration or fermentation: lactic acid fermentation
cytoplasm
location related to cellular respiration or fermentation: pyruvate processing in prokaryotes
cytoplasm
structural support, movement of materials within a cell, or movement of the cell
cytoskeleton
A reaction will always be spontaneous when enthalpy ---- and entropy ----.
decreases; increases
Which type of reaction forms a bond between two monosaccharides
dehydration synthesis
Recall Pasteur's experiment that provided support for the cell theory. The spontaneous generation hypothesis was rejected because cells ________.
did not appear in the swan neck flask
Hydrophobic molecules are molecules that --- such as ---
do not dissolve in water; uncharged non polar molecules
Mitochondrion
double membrane
chloroplast
double membrane
nucleus
double membrane
The tendency of an atom to pull electrons toward itself is referred to as its ----.
electronegativity
total energy of a molecule
enthalpy
amount of disorder
entropy
---- contain large numbers of organelles and many types of organelles.
eukaryotes
bacteria can under go mitosis
false
when the end product of an enzymatic pathway, inhibits the first step of the pathway
feedback inhibition
A dehydration synthesis reaction 000000.
forms a bond and releases a molecule a water
equation for cellular respiration
glucose+ 6 oxygen ---> 6 carbon dioxide + 6 water
What type of bond forms between adjacent water molecules?
hydrogen
the attraction between an atom with a partial positive charge and an atom with a partial negative charge
hydrogen
Water has a high heat of vaporization because of the --- that can form between the hydrogen of one water molecule and the oxygen of another water molecule.
hydrogen bond
a solution that has a lower solute concentration than the fluid inside the cell
hyoptonic
a solution that has a higher solute concentration than the fluid inside the cell
hypertonic
a ----- is a suggested explanation for an observation that can be tested.
hypothesis
Solution X has a NaCl concentration of 5mM. a red blood cell with an NaCl concentration of 150mM is placed in solution X. Solution X is a --- solution so the red blood cell will ----.
hypotonic; swell
ATP synthase involved in cellular respiration location in the plant cell
inner mitochondria membrane
location related to cellular respiration or fermentation: electron transport chain in eukaryotes
inner mitochondrial membrane
Calvin cycle of photosynthesis: ATP
input
light capturing reactions of photosynthesis: water
input
a protein integrated into the membrane structure that interacts extensively with the phospholipid tails
integral protein
In eukaryotes, ATP synthase relies on the accumulation of protons in the -----.
inter membrane space
cytoskeletal filament: anchors the nucleus
intermediate filaments
cytoskeletal filament: strengthens your hair and nails
intermediate filaments
a solution that has the same solute concentration as the fluid inside the cell
isotonic
energy of motion
kinetic energy
----is a protein
lactase
-----is a carbohydrate
lactose
digestion and recycling (in animals)
lysosomes
Which of the following organelles is correctly paired with its function?
lysosomes; digestion and recycling
codons are located on ---
mRNA
A diploid cell undergoes this process and produces haploid cells
meiosis
Increases genetic variation
meiosis
Produces cells genetically different from the parental cell
meiosis
one cell produces four gametes (egg or sperm cells)
meiosis
correct phase of mitosis: Chromosomes are lined up in the middle of the cell
metaphase
correct phase of meiosis. homologous chromosomes are paired and lines up in the middle of the cell
metaphase I
correct phase of meiosis: chromosomes line up individually in the middle of the cell
metaphase II
cytoskeletal filament: has two intertwined strands composed of one type of protein
microfilaments
cytoskeletal filament: involved in muscle contraction
microfilaments
cytoskeletal filament: are hollow tubes composed of two types of proteins
microtubules
cytoskeletal filament: are structural elements of flagella, cilia, and centrioles
microtubules
cytoskeletal filament: pull chromosomes to opposite ends of a dividing cell
microtubules
Which of the following statements is false?
microtubules are involved in animal cytokinesis
Which organelle is involved in cellular respiration?
mitochondiron
ATP production via cellular respiration
mitochondria
Which is found in all plant and animal cells?
mitochondria
location related to cellular respiration or fermentation: citric acid cycle in eularyotes
mitochondria matric
location related to cellular respiration or fermentation: pyruvate processing in eukaryotes
mitochondrial matrix
A diploid cell undergoes this process and produces diploid cells.
mitosis
one cell produces two daughter cells
mitosis
produces identical daughter cells
mitosis
used for asexual reproduction
mitosis
What are the monomers of carbohydrates?
monosaccharides
Calvin cycle of photosynthesis: water
neither
light capturing reactions of photosynthesis: G3P
neither
Do animals perform photosynthesis?
no
Does fungi perform photosynthesis?
no
when the two atoms sharing electrons are equally electronegative
non polar covalent
The side chain of the amino acid below: (~pH 7.0) is ----
nonpolar
A point mutation that converts an amino-acid-specifying codon into a stop codon.
nonsense mutation
A car is ----- because it ----- exhibit all 7 characteristics of life.
not alive, does not
match with correct monomer: 5 carbon sugar
nucleotide
match with correct monomer: nitrogenous base
nucleotide
match with correct monomer: phosphate group
nucleotide
Has a double membrane and stores information in chromosomes
nucleus
in eukaryotes, transcription occurs in the
nucleus
information storage and transmission
nucleus
What does it mean when we say the genetic code is collinear (non overlapping)
once the ribosome locks onto the first codon, the radio frame is established.
light capturing reactions of photosynthesis: ATP
output
Which step of cellular respiration generates the most ATP?
oxidative phosphorylation
Chitin 3D structure
parallel strands joined by hydrogen bonds
peptidoglycan 3D structure
parallel strands joined by peptide bonds
amino acids are linked together when a ----- forms between them during a ------.
peptide bond and dehydration synthesis reaction
a protein at the plasma membrane's surface either on its exterior or interior side
peripheral protein
oxidation of fatty acids, ethanol, or other compounds
peroxisomes
forms the lipid bilayer of the plasma membrane
phospholipids
plants are--- because they use light to produce their own food
photoautotrophs
Selectively permeable membrane that maintains intracellular environment
plasma membrane
location related to cellular respiration or fermentation: electron transport chain in prokaryotes
plasma membrane
selective permeability maintains intracellular environment
plasma membrane
when one of the atoms sharing electrons is more electronegative than the other atom
polar covalent
Protein X only functions in the leaves of plants. You measure the amount of its mRNA present in the flowers, roots, and leaves, You only detect mRNA from gene X in the leaves. Which of the following could not be the level of expression of gene x is regulated?
post- translational
stored energy based on location or structure
potential energy
reactant or product of cellular respiration: carbon dioxide
product
reactant or product of cellular respiration: water
product
eukaryotes are usually larger than
prokaryotes
DNA is loosely clustered in the cytoplasm in ---- and is inside the nucleus in ---.
prokaryotes; eukaryotes
correct phase of mitosis: Chromosomes condense
prophase/ prometaphase
glycolysis generates ---,--- and ATP
pyruvate; NADH
reactant or product of cellular respiration: glucose
reactant
reactant or product of cellular respiration: oxygen
reactant
A+BH2--> AH2+B A is being--- and B is being ----
reduced; oxidized
A red shirt appears red because red light is being ---- and all other wavelengths of light are being ---- absorbed by the pigments in the shirt.
reflected; absorbed
protein synthesis
rough ER
When does DNA replication occur
s phase
----- fats only contain single bonds between neighboring carbon atoms.
saturated
DNA undergoes ----.
semiconservative replication
in prokaryotes, transcription and translation can occur
simultaneously
Endoplasmic Reticulum
single membrane
Golgi apparatus
single membrane
lysosome
single membrane
vacuole
single membrane
Calvin cycle located in the plant cell
stoma
What are the three components of a nucleotide?
sugar, phosphate group, and nitrogen base
Living systems are interconnected, and they interact and influence each other on multiple levels
systems
correct phase of mitosis: Chromosomes decondense
telophase
correct phase of mitosis: Nuclear envelope reforms
telophase
Meiosis is required for ----
the production of sperm and egg cells
During photosynthesis, ATP synthase relies on the accumulation of protons in the _______.
thylakoid lumen
ATP synthase involved in the light - capturing reactions of photosynthesis location in the plant cell
thylakoid membrane
electron transport chain involved in photosynthesis located in a plant cell
thylakoid membrane
photosystem I location in the plant cell
thylakoid membrane
photosystem II location in a plant cell
thylakoid membrane
Which of the following is not a pyrimidine
thymine
Which of the following relives tension ahead of the replication fork during DNA replication?
topoisomerase
Which of the following levels of gene expression control conserves the most energy and resources?
transcriptional control
Hapliod cells can undergo mitosis
true
The carbon atoms that make up all of the molecules in your body come from carbon dioxide that was fixed during photosynthesis
true
----- fats contain at least one double bond between neighboring carbon atoms.
unsaturated
glycogen
used for energy storage in animals
starch
used for energy storage in plants
peptidoglycan
used for structural support in the cell walls of bacteria
chitin
used for structural support in the cell walls of fungi
cellulose
used for structural support in the cell walls of plants.
storage, digestion, and recycling (in plants)
vacuoles
In plants, water is transported from the roots to the leaves. What property of water explains how plants are able to transport water over a large distance?
water molecules are cohesive
3' TACAGAACGGTA 5'
Met-Ser-Cys-His