BIOL2170 Exam 4 Study Guide (CH.13-17)

Imagine that you are standing next to Aristotle in early Greece. You both see an older, balding man with visible age spots on his skin. This man also appears to be a wounded soldier, whose left leg has been amputated. What might Aristotle say to you? -"because that man is balding, his sons may also be born bald." -"because that man has age spots on his skin, his children were likely also born with spots." -"because that man is missing a leg, his children are likely also missing legs." -"because that man is balding and has age spots, his children will likely go bald and will develop age spots." -aristotle would likely say all of these statements to you.

"because that man is balding and has age spots, his children will likely go bald and will develop age spots."

A true breeding black rabbit is crossed with a true breeding white rabbit to produce an F1 generation with 8 individuals. If blending inheritance were true, which of the following would represent the expected phenotype of the F1 generation? -4 black rabbits, 2 white rabbits, 2 grey rabbits -8 black rabbits, 0 white rabbits, 0 grey rabbits -2 black rabbits, 2 white rabbits, 4 grey rabbits -0 black rabbits, 0 white rabbits, 8 grey rabbits -6 black rabbits, 2 white rabbits, 0 grey rabbits

0 black rabbits, 0 white rabbits, 8 grey rabbits

You have an F2 generation derived from two true-breeding parents (AA and aa) with different characteristics for the same trait (determined by a single allele). What percentage of the recessive phenotype would you expect to be true breeding if they were self-fertilized? -0 percent -25 percent -33 percent -67 percent -75 percent -100 percent

100 percent

The fruit fly cross shown here analyzes the transmission of two genes on the X chromosome. The male parent has mutant alleles for both the white gene (w-) and the crossveinless gene (cv-). The female parent has nonmutant forms of these genes (w+ and cw+). A cross between siblings of the F1 generation - a red-eyed, crossveined female and a red-eyed, crossveined male - generates F2 progeny. Examine the genotype of the F2 male progeny. Notice that the progeny fall into two groups. Refer to the figure below when answering the following question: The numbers of male F2 progeny with each of the four observed phenotypes are as follows: Red-eyed, crossveined = 357 White-eyed, crossveinless = 341 Red-eyed, crossveinless = 52 White-eyed crossveined = 45 What is the map distance between the genes w and cv? -13.9 -12.2 -97 -341 -357

12.2

When comparing DNA sequences of similar genes for proteins in related species, you see that some of the sequences are longer in one species compared to the other. Which of the following would most likely represent the extra number of bases that you would see? -5 -7 -17 -21 -25

21

If the phenotype of pea pod color is determined by incomplete dominance, the combination of an allele for yellow seeds and an allele for green seeds yields blue seeds. Therefore, you would expect the F2 generation from an original cross of true-breeding green stock with true-breeding yellow stock to be: -25 percent yellow, 50 percent blue, 25 percent green. -67 percent green, 33 percent yellow. -67 percent blue, 33 percent yellow. -100 percent green. -100 percent blue.

25 percent yellow, 50 percent blue, 25 percent green.

You have an F2 generation derived from two true-breeding parents with different characteristics for the same trait (determined by a single allele). What percentage of the F2 generation with a dominant phenotype would you expect to be homozygous for your single allele of interest? -0 percent -25 percent -33 percent -67 percent -75 percent

33 percent

In the sickle-cell anemia mutation, the 5′-GAG-3′ codon for glutamic acid becomes the 5′-GUG-3′ codon for valine. Assuming a single nucleotide substitution accounts for this mutation, what is the change in the DNA? -3′-CTC-5′/5′-GAG-3′ to 3′-CAC-5′/5′-GTG-3′ -5′-CTC-3′/3′-GAG-5′ to 3′-CAC-5′/5′-GTG-3′ -3′-CTC-5′/5′-GAG-3′ to 5′-CAC-3′/3′-GTG-5′ -5′-CTC-3′/3′-GAG-5′ to 5′-CAC-3′/3′-GTG-5′

3′-CTC-5′/5′-GAG-3′ to 3′-CAC-5′/5′-GTG-3′

Approximately what percentage of the human genome consists of repetitive DNA or transposable elements? -1 percent -5 percent -10 percent -25 percent -50 percent

50 percent

For a SNP with three alleles, how many different diploid genotypes are possible? -3 -4 -5 -6 -7

6

A true-breeding black rabbit is crossed with a true-breeding white rabbit. If the black color trait is dominant, which of the following represents the expected phenotype of an F2 generation consisting of 8 individuals? -0 black rabbits, 0 white rabbits, 8 grey rabbits -6 black rabbits, 2 white rabbits, 0 grey rabbits -2 black rabbits, 2 white rabbits, 4 grey rabbits -8 black rabbits, 0 white rabbits, 0 grey rabbits -4 black rabbits, 2 white rabbits, 2 grey rabbits

6 black rabbits, 2 white rabbits, 0 grey rabbits

Which of the following represents the expected genotypes of an F2 generation consisting of 8 individuals from an initial cross of a true-breeding black (BB) rabbit and a true-breeding white (bb) rabbit? -8 progeny: 2 BB, 2 bb, 4 Bb -8 progeny: 4 BB, 4 bb, 0 Bb -8 progeny: 0 BB, 0 bb, 8 Bb -8 progeny: 8 BB, 0 bb, 0 Bb

8 progeny: 2 BB, 2 bb, 4 Bb

Which of the following genotypes would result in a true-breeding stock? -AA or Aa or aa -Aa, but not AA or aa -aa, but not Aa or AA -AA or aa, but not Aa -AA, but not Aa or aa

AA or aa, but not Aa

A new gene is discovered that dramatically aids in the digestion of fish. You hypothesize that populations with a history of being near the shoreline would have more copies of this gene than populations found farther inland. How would you classify this genetic difference? -RFLP -CNV -VNTR -SNP -none of the answer options is correct.

CNV

DNA transposable elements are a class of transposable elements that uses: -RNA as an intermediate. -protein as an intermediate. -tandem repeats as an intermediate. -DNA as an intermediate. -ribosomes as an intermediate.

DNA as an intermediate.

Transposable elements are: -proteins that can move outside of the nucleus. -proteins that can move into the nucleus. -DNA sequences that can insert themselves into RNA. -DNA sequences that can insert themselves into new positions within the genome. -None of the answer options is correct.

DNA sequences that can insert themselves into new positions within the genome.

A patient is about to receive chemotherapy and the doctor is concerned with dispensing the correct dosage. Certain people cannot metabolize this type of chemical because they have a mutation that changes a codon for valine into one for aspargine. How would such a mutation be classified? -RFLP -CNV -SNP -PCR -none of the other answer options is correct.

SNP

It is always true that the larger the organism, the more genes the organism will have in its genome. -true -false

false

A testcross of an organism of unknown genotype is done when the organism is crossed to an organism that is: -a heterozygote. -a dominant homozygote. -a recessive homozygote. -all of these choices are correct.

a recessive homozygote.

In which of the following populations would you expect to have the most genetic diversity within the group? -the F1 generation of tomato plants from the cross of two different true-breeding stocks -a stock of tomato plants that is not true breeding -a true-breeding stock of tomato plants

a stock of tomato plants that is not true breeding

The fruit fly cross shown here analyzes the transmission of two genes on the X chromosome. The male parent has mutant alleles for both the white gene (w-) and the crossveinless gene (cv-). The female parent has nonmutant forms of these genes (w+ and cw+). A cross between siblings of the F1 generation—a red-eyed, crossveined female and a red-eyed, crossveined male—generates F2 progeny. Examine the genotype of the F2 male progeny. Notice that the progeny fall into two groups. Refer to the figure below when answering the following question: Why are the female progeny from the F1 cross shown in the figure not used for linkage analysis? -all F2 females have a wild-type phenotype of red eyes and cross-veined wings. -F2 females reveal the genotype of the F1 female parent as well as the genotype of recombinants. -F2 male progeny far outnumber the F2 female progeny. -F2 females appear to assort independently because they exhibit a 1:1:1:1 ratio. -all F2 females exhibit the genotype associated with genes located on the X donated by the male parent from the F1 cross.

all F2 females have a wild-type phenotype of red eyes and cross-veined wings.

The fruit fly cross shown here analyzes the transmission of two genes on the X chromosome. The male parent has mutant alleles for both the white gene (w-) and the crossveinless gene (cv-). The female parent has nonmutant forms of these genes (w+ and cw+). A cross between siblings of the F1 generation—a red-eyed, crossveined female and a red-eyed, crossveined male—generates F2 progeny. Examine the genotype of the F2 male progeny. Notice that the progeny fall into two groups. Refer to the figure below when answering the following question: Which of the statements below does not explain why the male progeny from the F1 cross are used for linkage analysis? -the phenotype of F2 males reveals the genotype of the X chromosome they inherited from their mother. -all four possible classes of maternal gametes are observed in the F2 male progeny in a 1:1:1:1 ratio, which indicates that the two genes undergo independent assortment. -the lack of independent assortment indicates that the two genes are linked on the X chromosome. -the Y chromosome in the male offspring allows the genotype of each X chromosome inherited from the mother to be observed in the male phenotype.

all four possible classes of maternal gametes are observed in the F2 male progeny in a 1:1:1:1 ratio, which indicates that the two genes undergo independent assortment.

In fruit flies, what kind of eye color would be expressed in male progeny from a white-eyed female and a red-eyed male? -half of the male progeny would have red eyes and half of the male progeny would have white eyes (1:1 ratio of eye color in males). -all males would have red eyes. -all males would have white eyes.

all males would have white eyes.

Which of the following are sequence motifs? -open reading frame -hairpin structures -promoters -coding region -all of these choices are correct.

all of these choices are correct

Genetic risk factors: -can increase the likelihood of diseases. -include mutations in the BRCA1 and BRCA2 genes. -can work synergistically with environmental risk factors. -can be heritable. -all of these choices are correct.

all of these choices are correct.

Imagine that a researcher is studying a mouse that carries a mutation in Pax7 —a gene that is involved in muscle development. To his surprise, these Pax7 mutant mice appear relatively normal. What is a possible explanation for this? -other members of the Pax gene family have redundant functions in muscle development (and can compensate for the Pax7 mutation). -the normal copy of Pax7 on the corresponding homologous chromosome is sufficient for mouse survival. -these Pax7 mutant mice may have a synonymous mutation. -all of these choices are correct.

all of these choices are correct.

Which of the following statements is true regarding sequence motifs? -sequence motifs are found in DNA but not in RNA. -sequence motifs in DNA are found only upstream of protein-coding regions. -an open reading frame is a type of sequence motif. -sequence motifs in RNA provide no information about sequence motifs in DNA. -none of the answer options is correct.

an open reading frame is a type of sequence motif.

The C-value paradox is the disconnect between genome size: -and gene size. -within the same species. -and protein ratio. -and gene ratio. -and organismal complexity.

and organismal complexity.

Mutation rates (per nucleotide per replication): -are similar across all organisms. -are lower in organisms with larger genomes. -are highest in bacteria. -are higher in organisms with larger genomes. -are highest in viruses.

are highest in viruses.

The rates of evolutionary change in DNA: -are zero -are constant in gene families with a diversity of members. -are constant among different gene families and thus are used to estimate the time of divergence. -are highly variable among different gene families. -can only be determined in conserved genes.

are highly variable among different gene families.

The region of DNA sequences before the start of a gene is often called the promoter. One type of promoter is called the TATA box. Many species' promoters are TATA boxes or a variation of the TATA box. DNA sequences that are similar in different organisms are called _____ sequences. -convergent -adjoined -conjugate -conserved -transposable

conserved

Animals that sexually reproduce are _____ and produce _____ gametes. -haploid; haploid -diploid; diploid -diploid; haploid -haploid; diploid

diploid; haploid

A researcher has carried out Giesma staining on a set of human chromosomes, and has arranged these chromosomes into a karyotype. He notices that in a homologous pair, a band is missing from one of the chromosomes. This likely resulted from: -a deletion. -a duplication. -an inversion. -a reciprocal translocation. -either a deletion or a reciprocal translocation

either a deletion or a reciprocal translocation.

Which of the following is not be considered an acquired trait? -leg amputation -muscle strength -eye color -scars -dyed hair color

eye color

A woman at a train station sees a family with five boys. The occurrence of five boys in this family is likely the result of a mutation in one of the X chromosomes of the mother that affects the survival of female embryos in the womb. -true -false

false

All organisms have either an X or Y chromosome, as these chromosomes are solely responsible for determining the sex of an individual. Mendel's failure to identify X and Y chromosomes in his pea plants invalidated a portion of the data he collected. -true -false

false

Any DNA "damage" is considered to be a mutation, even if it is immediately corrected by the action of DNA polymerase. -true -false

false

Any deviation in normal gene dosage is lethal. -true -false

false

In eukaryotes, genome size is a good predictor of gene number and organismal complexity. -true -false

false

You are given two true-breeding groups of rabbits. The first group has floppy ears and white coat color. The second group has straight ears and black coat color. When you perform a cross of these two groups to obtain an F1 generation you see that all of your rabbits have floppy ears and grey coat color. Which of the following possibilities appears to be supported by what you see in the F1 generation? -straight ears are dominant over floppy ears; coat color is determined by intermediate dominance. -floppy ears are dominant over straight ears; white coat color is dominant over black coat color. -straight ears are dominant over floppy ears; white coat color is dominant over black coat color. -straight ears are dominant over floppy ears; black coat color is dominant over white coat color. -floppy ears are dominant over straight ears; black coat color is dominant over white coat color. -floppy ears are dominant over straight ears; coat color is determined by incomplete dominance.

floppy ears are dominant over straight ears; coat color is determined by incomplete dominance.

Review the pedigree shown in Figure 17.7 and choose the most accurate statement about the inheritance of an X-linked recessive mutation -daughters of affected males are always affected. -the offspring of an affected male are usually affected. -the sons of the sisters of affected males will always be affected. -for rare X-linked traits, most of the affected individuals are males. -the brothers of affected males are always affected.

for rare X-linked traits, most of the affected individuals are males.

For any SNP, what is the maximum number of alleles possible? -one -two -three -four -any number, depending on the SNP

four

You are given two populations of true-breeding tomato plants with two simple dominant/recessive traits that sort independently. Using the multiplication rule, how many different phenotypic combinations would you expect to see in the F2 generation? In what phenotypic ratio? -two, 3:1 -three, 9:6:1 -four, 9:3:3:1

four, 9:3:3:1

The number of new mutations in organisms following a round of genome replication: -generally increases with larger genomes. -generally decreases with larger genomes. -is similar independent of genome size. -is highest in bacteria. -none of the other answer options is correct.

generally increases with larger genomes.

Which of the following explains the difference between VNTRs and RFLPs? -in VNTRs, we are looking at size differences resulting from different restriction sites being present; in RFLPs, we are looking at the number of times a sequence is repeated. -in VNTRs, we are looking at the number of times a sequence is repeated; in RFLPs we are looking at size differences resulting from different restriction sites being present. -in VNTRs, we are looking at sequence differences in noncoding DNA; in RFLPs we are looking at sequence differences in genes. -in VNTRs, we are looking at sequence differences in genes; in RFLPs we are looking at sequence differences in noncoding DNA.

in VNTRs, we are looking at the number of times a sequence is repeated; in RFLPs we are looking at size differences resulting from different restriction sites being present.

Which one of the following statements about segregation of the sex chromosomes is false? -in humans, the sex at each birth is not a random process because there are often large families with either all girls or all boys. -in humans, half of the fertilized eggs are expected to be male and half are expected to be female; this 1:1 ratio is characteristic of Mendelian segregation. -the secondary sex ratio of males to females at birth usually shows a slight excess of males. -in human males, segregation of the X chromosome from the Y chromosome occurs during anaphase I of meiosis.

in humans, the sex at each birth is not a random process because there are often large families with either all girls or all boys.

SNPs within a gene called FOXO correlate with increased longevity in humans. You are a researcher in a lab and wish to determine if you possess this SNP. Based on this correlation, where must the SNP be located in the genome in relation to the FOXO gene? -in the FOXO gene -adjacent to the FOXO gene -on a different chromosome from the FOXO gene -it is impossible to tell without further analysis.

it is impossible to tell without further analysis.

Imagine that you know two sisters—Rose and Sam—both of whom smoke. Rose has a mutation in the gene for alpha-1 antitrypsin, whereas Sam does not. Which of the following statements is true regarding these sisters? -as both sisters smoke, Rose and Sam will certainly develop emphysema; however, given her mutation, Rose will likely develop a much more serious form of the disease. -given that a mutation in alpha-1 antitrypsin serves a "protective" function against the development of emphysema, Rose will not develop this disease but Sam will. -it is possible that neither Rose nor Sam will develop emphysema; however, the fact that both sisters smoke—added to the mutation that Rose carries—increases their chances of developing this disease. -rose is predisposed to develop emphysema, but if Sam does, this will be a random occurrence; environmental factors or lifestyle choices (such as smoking) have not been associated with emphysema.

it is possible that neither Rose nor Sam will develop emphysema; however, the fact that both sisters smoke—added to the mutation that Rose carries—increases their chances of developing this disease.

Why was the theory of blending inheritance eventually disproven? -although the theory of blending inheritance accounted for a great deal of variation in a population, the theory of natural selection yielded explanations for every phenotype observed in a population. -the theory of blending inheritance suggested that inheritance is a diversifying force, whereas it is actually a homogenizing force. -it was eventually disproven by demonstrating segregation of alleles for the inheritance of many traits in diverse types of organisms. -it was based on the fact that the phenotypes of progeny of a given cross typically resemble either parent—and never present "intermediate" phenotypes (i.e., such as grey fur). -it suggested that traits such as blue eyes were recessive, whereas such traits are in fact actually the result of rare dominant mutations arising in populations.

it was eventually disproven by demonstrating segregation of alleles for the inheritance of many traits in diverse types of organisms.

What made the plant hybridization studies performed by Mendel more successful than plant hybridization studies performed by others? -mendel's understanding of natural selection inspired his methodology to examine the effect of environmental stressors on genetic diversity. -mendel was the first to identify characteristics of pea plants that could be observed as phenotypes. -mendel used statistical analysis to analyze the phenotypes he observed. -mendel did not use true-breeding organisms because he wanted to assess the inheritance of more than one trait per breeding. -mendel used qualitative analysis to evaluate the genotypes he observed.

mendel used statistical analysis to analyze the phenotypes he observed.

Imagine that a researcher is comparing the sequence of several protein-coding genes among mice, rabbits, and humans. She finds that, for most of these genes, the rabbit sequences are more similar to the human sequences than are the mouse sequences. What can she deduce? -mice and rabbits do not share a common ancestor. -mice and humans share a more "recent" common ancestor than do rabbits and humans. -more sequences are conserved between rabbits and humans than between humans and mice. -no similar proteins exist in mice and humans. -humans and mice do not share a common ancestor.

more sequences are conserved between rabbits and humans than between humans and mice.

Imagine that you are a detective who has identified a suspect in a homicide. You acquire a small amount of blood from the crime scene and hand it over to your lab. The lab carries out PCR for one polymorphism, and it returns as a match to your suspect. Is this enough to arrest your suspect? -yes, a match between DNA fingerprints is always definitive proof that the two sources are the same individual. -yes, the chance that your suspect will have the same polymorphism at a single site as a drop of blood from a random individual is about 1 in 50,000; this is enough to arrest the suspect. -no, your lab should assess additional polymorphisms; a single polymorphism does not constitute a DNA fingerprint. -no, the small amount of blood you acquired from the crime scene will not provide enough genetic material for PCR to be carried out efficiently; more than a single drop of blood is needed to provide enough raw material for analysis.

no, your lab should assess additional polymorphisms; a single polymorphism does not constitute a DNA fingerprint.

Which of the following statements is true regarding a chromosome deletion? -chromosome deletions do not affect gene dosage. -if a deletion eliminates the centromere, the chromosome is still passed on during cell division. -small chromosomal deletions usually have serious and often fatal consequences for an organism. -small chromosomal deletions are easily detected by microscopy. -none of the answer options is correct.

none of the answer options is correct.

The fruit fly cross shown here analyzes the transmission of two genes on the X chromosome. The male parent has mutant alleles for both the white gene (w-) and the crossveinless gene (cv-). The female parent has nonmutant forms of these genes (w+ and cw+). A cross between siblings of the F1 generation—a red-eyed, crossveined female and a red-eyed, crossveined male—generates F2 progeny. Examine the genotype of the F2 male progeny. Notice that the progeny fall into two groups. Refer to the figure below when answering the following question: The group represented by a large proportion of the progeny, deriving from maternal gametes containing alleles present in the same combinations as found in the mother's X chromosomes, is called the _____ group. -recombinant -wild type -parental -nonrecombinant -transgenic

nonrecombinant

Whole genome sequencing is often approached by a shotgun sequencing technique in which large genomes are: -randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order. -digested in a few specific spots, large fragments are sequenced, and the overlapping sequences are assembled in order. -randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from largest to smallest. -randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from smallest to largest. -All of these choices are correct.

randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order.

The fruit fly cross shown here analyzes the transmission of two genes on the X chromosome. The male parent has mutant alleles for both the white gene (w-) and the crossveinless gene (cv-). The female parent has nonmutant forms of these genes (w+ and cw+). A cross between siblings of the F1 generation—a red-eyed, crossveined female and a red-eyed, crossveined male—generates F2 progeny. Examine the genotype of the F2 male progeny. Notice that the progeny fall into two groups. Refer to the figure below when answering the following question: The group that represents a small proportion of the progeny, deriving from maternal gametes containing combinations of alleles not found in either X chromosome of the mother, is called the _____group. -nonrecombinant -wild type -parental -transgenic -recombinant

recombinant

A high school student wants to repeat Mendel's classic experiments for her science fair. To stay true to Mendel's work, what must the student do? -she must hand-pollinate the pea plants and keep careful track of the traits demonstrated by male and female parents. -she must leave the pollinated plants uncovered so that they can receive adequate amounts of light, carbon dioxide, and water. -she must remove the male organs (anthers) from plants she has designated as females. -she must remove the male organs (anthers) from plants she has designated as females, and she must hand-pollinate plants and keep track of the traits seen in male and female parents. -she must allow true-breeding pea plants to self-fertilize.

she must remove the male organs (anthers) from plants she has designated as females, and she must hand-pollinate plants and keep track of the traits seen in male and female parents.

In the eukaryotic DNA sequence below, the highlighted repeat is a tandem repeat. It is also what other kind of repeat? CACACACACACACACACACA Please choose the correct answer from the following choices, and then select the submit answer button. -transposon repeat -short terminal repeat -long terminal repeat -dispersed repeat -simple sequence repeat

simple sequence repeat

In the eukaryotic DNA sequence below, which type of repeat is highlighted? ATTATTTACTAATCCTCATCATCATCATCATGGAATTCATAATGCTAATGG -short terminal repeat -tandem repeat -simple sequence repeat -dispersed repeat -long terminal repeat

simple sequence repeat

Repeated sequences within eukaryotic genomes may be represented as long repeated sequences next to each other, and are called _____ repeats. Repeated sequences in eukaryotic genomes can also be spread throughout the genome, and are called _____ repeats. -tandem; dispersed -dispersed; tandem -overlapping; adjacent -adjacent; overlapping -none of the answer options is correct.

tandem; dispersed

Two genes, A and B, are found on the same chromosome. One chromosome has alleles A and B, while its homolog has alleles a and b. If genes A and B are so closely linked that the recombination frequency is 0 percent, only AB and ab gametes will be produced during meiosis. -true -false

true

The ability to perceive a bitter taste from certain chemicals including PTC has been linked to certain alleles. Which of the following would provide an explanation for the fact that almost all nonhuman primates have the "taster" phenotype, whereas the human population has a significant percentage of "nontaster" phenotypes? -nonhuman primates only eat foods that are not bitter, so the phenotype of tasting bitter compounds was not selected against. -the advantage to not being able to taste bitter compounds means that humans are more likely to eat vegetables and hence live longer than nonhuman primates. -humans needed the ability to not taste bitter compounds, so the mutation happened. -the advantage to being able to taste bitter compounds would keep you from eating poisonous compounds, an advantage not needed in the human population anymore.

the advantage to being able to taste bitter compounds would keep you from eating poisonous compounds, an advantage not needed in the human population anymore.

In the figure below, none of the F2 females has white eyes. Why? -F2 females have two X chromosomes, and in this cross all F2 females are homozygous for the red-eye allele. -F2 females have two X chromosomes, and in this cross they all have one X carrying a red-eye allele and another X carrying a white-eye allele. -females always have red eyes because this allele is dominant. -females can never have white eyes because this allele is recessive. -the allele for red eyes is dominant over white eyes, and these F2 females are either homozygous dominant (red-eye allele) or are heterozygous.

the allele for red eyes is dominant over white eyes, and these F2 females are either homozygous dominant (red-eye allele) or are heterozygous.

Until 20 or 30 years ago, people with cystic fibrosis (CF) wouldn't live long enough to reproduce. CF is a homozygous recessive condition, leading researchers to think that over time the incidence of CF would decrease because the allele would be removed from the gene pool. The results actually indicate that the rate of CF is on the rise. Based on what you know about why certain genotypes and phenotypes persist in a population, which of the following could be a likely explanation for why the rate of CF is on the rise? -the heterozygous condition is beneficial, much like what we see with sickle cell trait. -we are being subjected to more mutations as a population due to more pollution. -the population is increasing, and more people mean more mutations. -people are traveling more, so when people from different areas reproduce, more mutations will result.

the heterozygous condition is beneficial, much like what we see with sickle cell trait.

Repeated sequences make genome sequencing challenging for of all of the following reasons except: -repeated sequences are typically longer than the short sequences obtained by automated sequencing. -there is no easy way to determine how many copies of the same repeat are present within one chromosome. -short repeats may fold back upon themselves to form a double-stranded structure that is not easily sequenced. -the long repeats often have mutations that are not easily sequenced. -All of these choices are correct.

the long repeats often have mutations that are not easily sequenced.

Which of the following statements explains why all of the F1 females from a cross between a red-eyed homozygous female fly and a white-eyed male fly are heterozygous? -the male parent provides them with a white-eye allele on the X and a red-eye allele on the Y. -the male parent provides them with a white-eye allele on the X, and the female parent provides them with a red-eye allele on the Y. -the male parent provides them with a white-eye allele on the X, and the female parent provides them with a red-eye allele on the X. -the female parent provides two X chromosomes to each daughter who both carry the red-eye allele. -none of the answer options is correct.

the male parent provides them with a white-eye allele on the X, and the female parent provides them with a red-eye allele on the X.

Imagine that a rancher has a herd of cattle with brown hides and short horns. All of his cattle are also relatively short in stature. If all of these traits were true breeding, what could you say about the progeny of these cattle? -it is impossible to determine the traits of such progeny—they will likely demonstrate different hide colors, horn lengths, and heights. -the progeny of these cattle will have short horns, but a variety of hide colors and heights. -the progeny of these cattle will be short in stature and have brown hides and short horns. -the progeny of these cattle will have brown, black, white, and spotted hides. -since the cattle are true breeding, the progeny of this herd will all be sterile.

the progeny of these cattle will be short in stature and have brown hides and short horns.

Which one of the following statements about the sex chromosomes is false? -in contrast to the approximately 1000 genes on the X chromosome, the Y chromosome contains only about 50 genes. -crossing over between the X and Y chromosomes allows the sex chromosomes to align correctly during metaphase I and separate from each other during anaphase I. -crossing over between the X and Y chromosomes occurs in very small regions of homology at the tips of the chromosomes. -the X chromosome has a gene density similar to most autosomes. -the relative size and gene content of the X and Y chromosomes is very similar across all animal species.

the relative size and gene content of the X and Y chromosomes is very similar across all animal species.

Which of the following is the likely explanation for a flower showing multiple sectors with different coloration? -the result of a germline mutation -the result of the plant being triploid -the result of the plant being tetraploid -the result of transposable elements -the result of a deletion

the result of transposable elements

Which of the following statements is true concerning the work of the Esther and Joshua Lederberg? -their work demonstrated that mutations cannot occur randomly in organisms. -their work demonstrated that mutations in organisms arise in response to environmental conditions. -their work demonstrated that mutations are determined by an organism's "needs." -their work relied on a technique of bacterial culture known as "replica plating." -their work relied on a technique of bacterial culture known as "replica plating," and demonstrated that mutations occur randomly in organisms.

their work relied on a technique of bacterial culture known as "replica plating," and demonstrated that mutations occur randomly in organisms.

After doing PCR on the same region between two individuals, you notice that each person's DNA yielded pieces of different sizes. Which of the following is the most likely explanation? -a mistake was made during the PCR. -a mistake was made during gel electrophoresis. -this is an example of VNTRs. -this is an example of RFLPs. -none of the other answer options is correct.

this is an example of VNTRs.

Genetic studies have identified an allele (Δ32) that seems to provide protection against HIV. Which of the following would most likely explain the reason why our population has this mutation? -this mutation was likely induced in the genome by the presence of HIV virus. -this mutation likely benefited the human population against some other related pathogen. -our bodies are designed to protect us against a myriad of pathogens, and the immune system was preparing for future viruses like HIV. -this mutation is very likely a neutral mutation.

this mutation likely benefited the human population against some other related pathogen.

Which of the following is not a type of sequence identified by gene annotation? -single copy gene -noncoding RNA -tandem repeat -topoisomerase -simple sequence repeat

topoisomerase

Normally, in corn, genes for waxy and virescent kernel appearance are in the same chromosome. In a certain stock, however, it was found that these two genes are in different chromosomes. Which chromosomal aberration would explain this? -translocation -inversion -duplication -deletion -none of the other answer options is correct.

translocation

A Punnett square can be used to interpret the results of a testcross. -true -false

true

Among flowering plants, 30 percent to 80 percent of existing species are polyploidy somewhere within their evolutionary history. -true -false

true

For any two genes located on the same autosome, the frequency of recombination has an upper limit of 50 percent. -true -false

true

In the human genome, retrotransposons vastly outnumber DNA transposons. -true -false

true

Nondisjunction could be the reason that a red-eyed male is among the offspring of a cross between a red-eyed male fruit fly and a white-eyed female fruit fly. -true -false

true

The fruit fly cross shown here analyzes the transmission of two genes on the X chromosome. The male parent has mutant alleles for both the white gene (w-) and the crossveinless gene (cv-). The female parent has nonmutant forms of these genes (w+ and cw+). Use the figure below to answer the following question: If an F1 female resulting from this parental cross is crossed with any male, his Y-bearing sperm will allow the experimenter to determine distance between the w and cv genes by analyzing the phenotypes of the F2 male progeny. -true -false

true

The addition rule requires which of the following? -more than one outcome (such as two different genotypes resulting in black fur) can occur simultaneously in an organism. -two outcomes (such as having the genotype BB or Bb) are mutually exclusive in an organism.

two outcomes (such as having the genotype BB or Bb) are mutually exclusive in an organism.

Retrotransposons are a class of transposable elements that: -replicate and transpose via DNA replication and repair. -uses protein as an intermediate. -uses RNA as an intermediate. -uses ribosomes as an intermediate. -uses DNA as an intermediate.

uses RNA as an intermediate.

Which of the following statements explains why restriction enzymes are not useful for genome-wide studies of genetic variation? -there is simply too much DNA that has to be cut in order to get any information. -the differences in restriction sites are evened out when looking at the entire genome. -using restriction enzymes will only tell us differences in sequence variation in restriction sites. -restriction enzymes only recognize sequences found in genes. -none of the answer options is correct.

using restriction enzymes will only tell us differences in sequence variation in restriction sites.

Which of the following statements concerning cancer and mutations is correct? -cancer can only occur with a mutation in a somatic cell. -cancer can only occur with a mutation in a germ cell. -usually multiple mutations are required in different genes to cause cancer. -usually a single mutation is all that is required to cause cancer. -none of the answer options is correct.

usually multiple mutations are required in different genes to cause cancer.

The fruit fly cross shown here analyzes the transmission of two genes on the X chromosome. The male parent has mutant alleles for both the white gene (w-) and the crossveinless gene (cv-). The female parent has nonmutant forms of these genes (w+ and cw+). Use the figure below to answer the following question: In the parental generation, the genotype of the female parent is _____, and the genotype of the male parent is _____. -w-cv-w+cv+; w-cv+/Y -w+cv+/w+cv+; w+cv- Y -w-cvZZ-/w-cv-; w-cv-/Y -w+cv+/w+cv+; w-cv-/Y -w+cv+/w-cv-; w-cv-/ Y

w+cv+/w+cv+; w-cv-/Y