Biology chapter 9-13
Which of the following statements is correct? A genetic cross produces the P generation. True-breeding plants are able to produce a variety of flower colors when self-fertilized. Offspring of two different true-breeding varieties are called hybrids. Mendel's pea plants could cross-fertilize but not self-fertilize.
Offspring of two different true-breeding varieties are called hybrids.
Which of the following statements best describes the end result of bacterial conjugation?
One cell has given a copy of a plasmid to another cell and kept one copy for itself.
An individual with the genotype AaBb produces four different gametes in equal proportions. This is a demonstration of ______.
Mendel's law of independent assortment
A BbGg x bbgg cross yields a phenotypic ratio of approximately 5 black eyes, green skin : 5 orange eyes, white skin : 1 black eyes, white skin : 1 orange eyes, green skin. Which of the following best explains these results?
Mendel's law of independent assortment is being violated.
That each gamete contains a single allele of the eye color gene is an illustration of _____.
Mendel's law of segregation only
The observed distribution of alleles into gametes is an illustration of _____.
Mendel's laws of segregation and independent assortment
Homologous pairs of chromosomes are lined up independently of other such pairs during _____.
Metaphase I
Why is natural selection considered to be the most important mechanism of microevolution?
Natural selection is the only mechanism that consistently leads to adaptive changes in populations.
Which of the following events occurs during transcription?
A molecule of RNA is formed based on the sequence of nucleotides in DNA.
The DNA polynucleotide structure contains which one of the following?
adenine, guanine, cytosine, thymine
The result of the following cross indicates that genotypically the offspring _____.
are all Bb
There are five examples of a ____ : A, G, C, T, and U.
base
The result of the following cross indicates that the genotype of the female parent is _____.
bb
In order to determine the genotype of a MendAlien with black eyes and green skin, you would cross this individual with a(n) _____ individual.
bbgg
A _____ is an inherited feature that varies from individual to individual.
character
DNA and protein together form a complex called ____
chromatin
The DNA of every eukaryotic cell is stored in one or more ____ located in the ____
chromosomes;nucleus
Which of these is NOT a carcinogen?
cigarette smoke, fat, UV light, testosterone, all of the above are carcinogens -all of these substances can cause cancer
What is recombinant DNA technology?
combining genes from different species
Translation occurs in the _____.
cytoplasm
A(n) ____ is a protein that promotes cell division. In excess, such a protein may lead to cancer.
growth factor
In a PCR reaction, the strands of DNA are first separated by ___.
heating
Which trait is polygenic in humans?
height
The first step in the replication of DNA is catalyzed by _____.
helicase
What is the name of the process shown in the diagram?
initiation of translation
A(n) ____ is a gene that encodes proteins that inhibit cell division. Such proteins normally help prevent cells from becoming cancerous.
tumor suppressor gene
All of life is related through common ancestry, accounting for the ____ of life.
unity
Although generally not considered to be alive, a ____ is studied alongside other microbes such as bacteria.
virus
A DNA microarray is used to __________.
visualize patterns of gene expression
Although it was groundbreaking for its time, it is now fairly routine to completely sequence the DNA of an organism using the ____ method. In this method, the DNA is chopped up with restriction enzymes, the fragments are sequenced, and then they are reassembled into one continuous sequence. Through such analyses, scientists are learning much about human DNA and its relation to other species.
whole-genome shotgun
The most common phenotype in a natural population is referred to as the __________.
wild type
____is the process in which mRNA codons are converted into an amino acid sequence.
Translation
Which characteristic of living cells do viruses lack?
They lack a complete replication apparatus.
True or False. During bacterial conjugation, the recipient cell receives a single-stranded loop of DNA.
True
When is PCR particularly applicable?
When there are small quantities of DNA to analyze
If you are a male, the Law of Independent Assortment indicates that your gametes contain _____.
a random mix of the chromosomes you inherited from each parent
A phenotypic ratio of 9:3:3:1 in the offspring of a cross indicates that _____.
both parents are heterozygous for both genes
All the genes in a population are that population's _____.
gene pool
The relationship of the genome to an organism is similar to that of the __________ to a population.
gene pool
The total collection of alleles in a population at a given time is the population's ____
gene pool
The total collection of alleles in a population at any one time makes up that population's ________.
gene pool
A characteristic of the human immunodeficiency virus (HIV) that makes it different from some other RNA viruses is that it __________.
can synthesize DNA from an RNA template
An understanding of gene regulation mechanisms has led to several interesting and important applications. For example, the loss of gene regulation can result in ____, or out-of-control cell growth.
cancer
Tristan da Cunha is a remote island in the Atlantic Ocean. In 1814, 15 people formed a colony there, one of whom carried a rare gene for blindness. The frequency of this gene is now 10 times higher on the island than on the mainland from which the settlers arrived. The mechanism of evolution is ____
founder effect
GgTt pea plants can produce __________ type(s) of gamete(s), and a ggtt plant can produce __________ type(s) of gamete(s).
four ... one
In the Hardy-Weinberg formula, what does p2 represent?
frequency of the homozygotes for one allele
The flow of information in a cell proceeds __________.
from DNA to RNA to protein
The ABO blood group in humans is an example of __________ producing four phenotypes.
multiple alleles
A(n) ____ is a change in the nucleotide sequence of DNA.
mutation
The original source of genetic variation that serves as the raw material for evolution is ________.
mutation
A(n) ____ is a group of individuals of the same species living in the same area that interact with each other.
population
Human insulin is produced in large quantities by __________.
recombinant E. coli bacteria grown in large fermentation vats
The percentage of recombinant phenotypes resulting from fertilization involving recombinant gametes is called _____.
recombination frequency
You cross a true-breeding red-flowered snapdragon with a true-breeding white-flowered snapdragon. All of the F1 are pink. What can you say about the alleles for the parental traits?
red and white show incomplete dominance
The nuclear membrane's role in the regulation of gene expression involves _____.
regulating the transport of mRNA to the cytoplasm
Which of these is NOT a component of the lac operon?
regulatory gene only
Natural selection __________.
relies on variation among individuals in a population
DNA copies itself via the process of ____
replication
The action of helicase creates _____.
replication forks and replication bubbles
And ____ can produce new live individuals, while ____ can produce potentially therapeutic stem cells.
reproductive cloning and therapeutic cloning
A ____ serves as the site of protein synthesis in the cytoplasm.
ribosome
The site of translation is
ribosomes in the cell cytoplasm.
What is the correct sequence of events that occur in a PCR reaction?
separation of DNA strands; addition of primers; use of DNA polymerase to produce second strand of DNA
In sexual selection, individuals with certain inherited characteristics are more likely to obtain mates than other individuals. This often results in ____, differences between the sexes in size, appearance, and behavior.
sexual dimorphism
What is the term used to indicate apparent physical differences between males and females of the same species beyond the obvious differences in reproductive organs?
sexual dimorphism
Researchers discovered that female gray tree frogs prefer to mate with males who sound the longest mating calls. The mechanism of evolution is ____
sexual selection
The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____.
sticky ends
A vaccine works by ________.
stimulating the immune system to develop lasting defenses
You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a _____.
sugar with two, and not three, oxygen atoms
To determine the phenotype of an individual who expresses a dominant trait, you would cross that individual with an individual who is homozygous recessive for that trait. This technique is referred to as a(n) ________.
test cross
DNA polymerase is a heat-sensitive enzyme. What is one thing that would need to be considered concerning the activity of this enzyme in PCR when the temperature is heated during each cycle to separate the DNA strands?
that the DNA polymerase could be denatured
The lac operon of Escherichia coli, a bacterium, is composed of __________.
three genes and two DNA control sequences: the promoter and the operator
A ____ is a virus that specifically infects bacteria.
bacteriophage
____ favors phenotypes at one end of a range and is common in periods of environmental change.
directional selection
In a species of snail, dark-shelled individuals are better hidden from bird predators in the shady forest, while light-shelled individuals are better hidden in well-lit brushy edge areas. If there were no areas of intermediate brightness in this habitat,which type of selection would act on shell color in these snails?
disruptive selection
____ favors phenotypes at both ends of a range over intermediate phenotypes. This type of selection may occur when the habitat is varied.
disruptive selection
Which of these gametes contain one or more recombinant chromosomes?
B, C, F, G
The result of the following cross indicates that the genotype of the male parent is _____.
BB
What do DNA and RNA have in common?
Both are composed of nucleotides.
The direction of synthesis of an RNA transcript is _____.
5' to 3'
Genes that violate Mendel's principle of independent assortment are ________.
linked
An old DNA strand is used as a _____ for the assembly of a new DNA strand.
template
The sticky end of the DNA restriction fragment shown here will pair with a DNA restriction fragment with the sticky end _____.
-ACGT
How do mutations affect an organism?
-They may cause the development of a disease-causing allele -They may cause the development of a more beneficial allele - They, in some cases, may have no noticeable affect
Who demonstrated that DNA is the genetic material of the T2 phage?
Hershey and Chase
The initiator tRNA attaches at the ribosome's _____ site.
P
If B represents the allele for black eyes (dominant) and b represents the allele for orange eyes (recessive), what would be the genotypic ratio of a cross between a heterozygous black-eyed MendAlien and an orange-eyed MendAlien?
0 homozygous black (BB): 1 heterozygote (black) (Bb): 1 homozygous orange (bb)
If the frequency of one allele in a population is 0.7 in a population with two alleles at a particular locus, what is the frequency of the alternate allele?
0.30
Suppose there is a population of 100 rabbits. In this population, 60 rabbits are FF, 20 are Ff, and 20 are ff. What is the allele frequency for the F allele in this population's gene pool?
0.7
In a situation in which genes assort independently, what is the ratio of the gametes produced by an AaBB individual?
1 AB : 1 aB
If B represents the allele for black eyes (dominant) and b represents the allele for orange eyes (recessive), what would be the phenotypic ratio of a cross between a heterozygous black-eyed MendAlien and an orange-eyed MendAlien?
1 black : 1 orange
Black eyes are dominant to orange eyes, and green skin is dominant to white skin. Sam, a MendAlien with black eyes and green skin, has a parent with orange eyes and white skin. Carole is a MendAlien with orange eyes and white skin. If Sam and Carole were to mate, the predicted phenotypic ratio of their offspring would be _____.
1 black eyes, green skin : 1 black eyes, white skin : 1 orange eyes, green skin : 1 orange eyes, white skin
An individual heterozygous for eye color, skin color, and number of eyes mates with an individual who is homozygous recessive for all three characters; what would be the expected phenotypic ratio of their offspring? [Hint: B = black eyes, b = orangeeyes; G = green skin, g = white skin; C = two eyes, c = one eye]
1 black eyes, green skin, two eyes : 1 black eyes, green skin, one eye : 1 black eyes, white skin, two eyes : 1 black eyes, white skin, one eye : 1 orange eyes, green skin, two eyes : 1 orange eyes, green skin, one eye : 1 orange eyes, white skin, twoeyes : 1 orange eyes, white skin, one eye
In a nucleotide, the nitrogenous base is attached to the sugar's _____ carbon and the phosphate group is attached to the sugar's _____ carbon.
1' ... 5'
Mutations in the nucleotide sequence of DNA are the ultimate source of genetic variation, which in turn results in genotypic and phenotypic variation in a population. Look at this population of rabbits. How many different genotypes and phenotypes do you observe? How many different fur color alleles are in this rabbit population?
2
Mutations in the nucleotide sequence of DNA are the ultimate source of genetic variation, which in turn results in genotypic and phenotypic variation in a population. Look at this population of rabbits. How many different genotypes and phenotypes do you observe? How many different phenotypes are in this rabbit population?
2
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
2 times
In human gamete production there is an average of _____ crossover events per chromosome pair.
2-3
Early geneticists wondered how only four nucleotides could specify the sequence of 20 amino acids in proteins. Today we know that there is a genetic code in which __________ nucleotide(s) code(s) for each amino acid.
3
Mutations in the nucleotide sequence of DNA are the ultimate source of genetic variation, which in turn results in genotypic and phenotypic variation in a population. Look at this population of rabbits. How many different genotypes and phenotypes do you observe? How many different genotypes are in this rabbit population?
3
A gene is a sequence of DNA nucleotide bases that codes for a single protein. Approximately how many nucleotide bases would be required to code for a protein chain that is 100 amino acids long?
300
Hershey and Chase used _____ to radioactively label the T2 phage's proteins.
35S
A purebred plant that produces yellow seeds is crossed with a purebred plant that produces green seeds. The F1 plants have yellow seeds. What is the expected phenotypic ratio of seed color of the offspring of an F1 × F1 cross?
3:1
If guanine makes up 10% of the bases in a DNA double helix, what percent of the bases is adenine?
40%
Nucleic acids are assembled in the _____ direction.
5' to 3'
A couple has two female children. What is the probability that their next child will be male?
50%
The presence of freckles is due to a dominant allele. Four percent of the individuals in a particular population lack freckles. Use the Hardy-Weinberg formula to calculate the percentage of individuals in this population who are homozygous dominant for freckles.
64%
Which of these is responsible for initiating a signal transduction pathway?
A; single molecule
Which of these indicates an enhancer region?
A;beginning of cycle
Which of these is a testcross?
A? x aa
Which of these individuals is a homozygous genotype?
AA
Suppose that every few years, all people over 6 feet tall do not have any children. How will this affect the human population?
Alleles that promote "tallness" will decrease in frequency.
The hierarchical system of taxonomy most commonly used today was introduced by which individual?
Carolus Linnaeus
________ believed that species are fixed forms that do not change over time while ________ believed that evolution is the refinement of traits that equip organisms to perform successfully in their environments.
Aristotle; Lamarck
Which of these is a membrane receptor?
B
Which of these is a tRNA?
B
In the accompanying image, a nucleotide is indicated by the letter _____.
B is indicating a single nucleotide.
In the following cross the genotype of the female parent is BbGg. What is the genotype of the male parent? [Hint: B = black eyes, b = orange eyes, G = green skin, g = white skin]
BBGg
What role does a transcription factor play in a signal transduction pathway?
By binding to DNA it triggers the transcription of a specific gene.
A nitrogenous base is indicated by the letter _____.
C *This is a nitrogenous base.
Which of these directly bind(s) to the promoter?
C and D Both RNA polymerase and transcription factors bind with the promoter.
Which of these is(are) pyrimidines?
C, D, and E *Pyrimidines are single-ring structures
DNA is a double helix composed of nucleotides. Suppose that a portion of one of the two strands of a DNA molecule has the sequence GCAGTAG.
CGTCATC
The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____.
CUG
A new DNA gene editing technique uses a bacterial enzyme called__________ to cut any double-stranded DNA sequence that is complementary to an associated molecule of guide RNA.
Cas9
Which of these is a regulatory gene?
D The regulatory gene is not a part of the operon.
Which of these acts as a second messenger?
D cyclic AMP
Which of these is responsible for catalyzing the formation of an RNA primer?
D, Primase catalyzes the formation of an RNA primer.
Chromosomes contain most of the cell's ____ which acts as the molecule of heredity.
DNA
The radioactive isotope 32P labels the T2 phage's _____
DNA
Which one of the following does not play a role in translation?
DNA
_____ serves as the molecular basis for life.
DNA
____is a long linear polymer found in the nucleus of a cell, shaped like a double helix, and associated with the transmission of genetic information.
DNA
During DNA replication, which nucleotide will bind to an A nucleotide in the parental DNA?
During DNA replication, A binds with T.
Which of these is a difference between a DNA and an RNA molecule?
DNA is usually double-stranded, whereas RNA is usually single-stranded.
The molecule that seals the gaps between the pieces of DNA in the lagging strand is
DNA ligase
Which enzyme "pastes" DNA fragments together?
DNA ligase
Which statement about DNA replication is FALSE?
DNA ligase adds nucleotides to the lagging strand.
What is the first level of control of eukaryotic gene transcription?
DNA packing and unpacking
Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments?
DNA polymerase can assemble DNA only in the 5' to 3' direction
Which of the following build(s) new strands of DNA?
DNA polymerases
DNA is considered to be the molecule of life.
DNA produces more of itself. DNA directs the production of proteins.
DNA carries out two basic functions in cells: (1) information storage and transfer (genes can be copied and passed to offspring) and (2) the "blueprint" function (genes provide instructions for building proteins). The key process for information storage and transfer to offspring cells is _____.
DNA replication
The central dogma describes how the genes in the nucleus work to produce an organism's phenotype. Another way of putting it is that the central dogma follows the flow of information from _____.
DNA to protein
In humans, the presence or absence of dimples is a trait controlled by a single gene. What is the genotype of an individual who is heterozygous for dimples?
Dd
Which of these DNA molecules is the shortest?
E (The shorter the DNA molecule, the farther it moves.)
Which of these correctly illustrates the pairing of DNA and RNA nucleotides?
GTTACG CAAUGC
The DNA codon GTA codes for an amino acid carried by a tRNA with the anticodon ________.
GUA
Consider a population of snowshoe hares in Montana. Their fur color changes in response to changes in day length. During the long summer days, they have brown fur, but as the days shorten in the fall, their fur turns white in preparation for winter. Then as the days get longer in the spring, their fur turns brown again. Their fur coloration acts as camouflage from predators. As climate change brings warmer fall temperatures to Montana, colder temperatures with snowfall are coming later in the year, and there may be less snowfall overall. As a result, the hares' fur color may be mismatched to the color of their surroundings, making them more visible to predators. Which snowshoe hares would have a reproductive advantage in this changing environment?
Hares with a mutation that causes them to change color in response to temperature rather than day length
The ____ was a massive scientific undertaking meant to identify and sequence all of the genes found In a human cell.
Human Genome Project
The world's first genetically engineered pharmaceutical product was ________.
Humulin
The operon model of the regulation of gene expression in bacteria was proposed by _____.
Jacob and Monod
________ introduced a system for grouping species into a hierarchy of categories.
Linnaeus
How have Mendel's laws fared as we have learned more about cell biology and processes such as meiosis?
Our new knowledge has helped to explain some of the exceptions to Mendel's laws of inheritance.
_____ catalyzes the production of _____, which then opens an ion channel that releases _____ into the cell's cytoplasm.
Phospholipase C ... IP3 .... Ca2+
While on his voyage aboard the HMS Beagle, Darwin was strongly influenced by this book.
Principles of Geology
All your cells contain proto-oncogenes, which can change into cancer-causing genes. Why do cells possess such potential time bombs?
Proto-oncogenes are necessary for the normal control of cell growth and division.
One way that _____ is different from DNA is that it contains Us instead of Ts.
RNA
The principal role of ____ is to act as a messenger carrying instructions from DNA out of the nucleus for the synthesis of proteins.
RNA
Repressors act by blocking the binding of _____ to the promoter.
RNA polymerase
The synthesis of a new strand begins with the synthesis of a(n) _____.
RNA primer complementary to a preexisting DNA strand
What is the function of a spliceosome?
RNA processing
Eukaryotes have more complex modes of control, includingthe packing of chromosomes, ____ (which can produce several mRNAs from a single gene), and the control of translation.
RNA splicing
The influenza virus, a deadly infectious agent found around the world, is composed of __________ and __________.
RNA to protein
Lipase is an enzyme (a type of protein) that breaks down fats.
The base sequence that codes for the lipase enzyme is duplicated during DNA replication. A specific sequence of bases in a DNA molecule codes for the lipase enzyme.
Which statement about DNA replication is CORRECT?
The leading strand is built continuously, and the lagging strand is built in pieces.
Which of these nitrogenous bases is found in DNA but not in RNA?
Thymine
Select all of the correct statements about transcription factors.
Transcription factors can switch genes off. Transcription factors can switch genes on.
As in the previous question, suppose there is a population of 100 rabbits that have different fur patterns. In this population several generations ago, there were 60 FF rabbits, 20 Ff rabbits, and 20 ff rabbits. Over time, the population changed, and now there are 40 FF rabbits, 40 Ff rabbits, and 20 ff rabbits. Has microevolution occurred? Why or why not?
Yes, because the allele frequencies have changed.
Can two plants with purple flowers produce offspring with white flowers?
Yes, if both parents are heterozygous for the trait.
Which of the following would indicate a base pairing mutation in DNA?
a G paired with a T
Which of the following is an example of a transgenic organism?
a bacterium with human gene for producing insulin
In the lysogenic cycle _____.
a viral reproductive cycle in which the viral DNA is added to the host cell's DNA and is copied along with the host cell's DNA
How many men died of prostate cancer in 2017?
about 30,000
_____ bind(s) to DNA enhancer regions.
activators
This unequal reproduction in a population leads to the gradual accumulation of ____ to the environment.
adaptations
Alleles are described as ______.
alternate versions of a gene
Crossing a plant with white flowers and a plant that is homozygous for purple flowers results in offspring with what color combinations?
all of the flowers will be purple.
A(n) ____ is an alternative version of a gene.
allele
Most human genes come in alternate versions called
alleles
A protein kinase activating many other protein kinases is an example of _____.
amplification
Which of the following binds to the operator of a bacterial gene?
an active repressor
Which of these plays a role in the regulation of transcription in both prokaryotic and eukaryotic cells?
attachment of RNA polymerase to the promoter
This hypothetical pedigree for a disease in humans illustrates inheritance that is ________.
autosomal recessive
In what type of organism was the CRISPR-Cas9 system discovered?
bacteria
Restriction enzymes are obtained from ________.
bacteria
What is the genotype of the parent with orange eyes and white skin? (Note: orange eyes are recessive.)
bbgg
A sudden volcanic eruption kills many members of a population of elk. By chance, the individuals that remain do not have the same mix of genes as the original population. The mechanism of evolution is ____
bottleneck effect
Although millions of prairie chickens once roamed the Midwest, their numbers dwindled to only 50 individuals in the 1990s. These few individuals have since produced a larger population. The genetic variation among the current population is quite low. The mechanism of evolution is ____
bottleneck effect
The population of American bison used to number in the millions. Hunting and other problems greatly decreased the number of bison to about 1,000. Today, the numbers are recovering to estimates of more than 200,000 bison. This crash in the population of bison and recent recovery is an example of __________.
bottleneck effect
In 2017, which type of cancer received the most diagnoses?
breast
A duplicated chromosome remains tightly paired with its partner at a region called the ___
centromere
Homology is evidence of ______.
common ancestry
Restriction enzymes __________________________.
cut DNA at specific nucleotide sequences
Which of these acts as a second messenger?
cyclic AMP
A cross between two individuals with black eyes and green skin which results in an individual with orange eyes and white skin is an example of a _____ cross.
dihybrid
The main goal of the Human Genome Project was to __________.
determine the nucleotide sequence of the entire human genome and map all the human genes
Although all of the cells in your body contain a complete set of DNA, different cells have different functions because __________.
different genes are switched on and off in each type of cell
The ____ of life arises from the adaptation of species to different habitats over long spans of time.
diversity
If an organism has two non-identical versions of a gene, the one that is expressed in the organism is called the _____ allele.
dominant
From which cell does the sex pilus originate during bacterial conjugation?
donor cell
After DNA replication is completed, _____.
each new DNA double helix consists of one old DNA strand and one new DNA strand
Which of the following cells is least differentiated?
embryonic stem cells
Human viruses that have appeared suddenly or have only recently come to the attention of medical scientists are called __________.
emerging viruses
Calcium ions that act as second messengers are stored in _____.
endoplasmic reticula
DNA testing (profiling) has been used to determine the guilt or innocence of crime suspects. This works because __________.
every person has a unique DNA sequence
Which mechanism for evolution was proposed by Lamarck?
evolution by inheritance of acquired characteristics
The RNA segments spliced to one another during RNA processing are _____.
exons
The expressed (coding) regions of eukaryotic genes are called ______.
exons
RNA processing involves the addition of ________ to the ends of the RNA transcript.
extra nucleotides
true and false: The bacterial chromosome is inserted into human cells.
false
true or false: The bacterial chromosome provides genetic information for making the protein of interest.
false
_____ is a carcinogen that promotes colon cancer.
fat
Mendel's law of segregation indicates that
gametes have one allele copy for each gene
All organisms must regulate ____ by turning genes on and off in different cells at different times.
gene expression
The process by which genotype becomes expressed as phenotype is ________.
gene expression
As habitats change, populations of northern pine trees that were once separated can now exchange pollen. This exchange of genes between populations is allowing the previously isolated gene pools to mix. The mechanism of evolution is ____
gene flow
Consider a population of birds living on an island. Suppose several individuals of the same species from a different population migrate to the island. Due to the arrivial of the new birds, the allele frequencies in the original population change. What mechanism of microevolution is at work in this example?
gene flow
Evolution that occurs by ____ results in a change in a population's gene pool due to the movement of individuals into and out of the population.
gene flow
Insecticide resistance among mosquitos is spreading around the world after mutations that originate in one population are spread to other populations through matings. The mechanism of evolution is ____
gene flow
The ease with which humans travel across the globe is likely to increase _____.
gene flow
Which is NOT a requirement of natural selection?
gene flow
Evolution that occurs by ____ results in a change in a population's gene pool due to chance.
genetic drift
Modern travel along with migration reduces the probability of _____ having an effect on the evolution of humans.
genetic drift
Which of the following are causes of evolutionary change?
genetic drift natural selection mutation gene flow
The scientific study of the transmission of traits from one generation to the next is called __________.
genetics
The scientific field that studies complete sets of genes is called ______.
genomics
This is just one example of ____, the branch of biology that studies whole ____, which are the complete sets of DNA found within organisms.
genomics; genomes
The _____ is the genetic makeup of an organism.
genotype
A female that is planning to become pregnant is concerned about her exposure to environmental mutagens which may have caused DNA mutations. In order for these mutations to become heritable, they must affect the:
her egg cells
Mendel crossed purebred purple-flowered plants with purebred white-flowered plants, and all of the resulting offspring produced purple flowers. The offspring are all ________, and the allele for purple flowers is ________.
heterozygotes... dominant
Mendel observed that pairs of alleles were separated or segregated in gametes and that they were rejoined in fertilization. We know that pairs of _____ are segregated in _____ and then are rejoined through fertilization.
homologous chromosomes ... meiosis
Similarity resulting from common ancestry is known as ____
homology
A testcross is a mating between an individual with a dominant phenotype (but unknown genotype) and __________
homozygous recessive individual
Cells in a multicellular organism may regulate gene expression in a distant cell. An example of this is secretion of __________. -->
hormones
A mating between a purebred purple-flowered pea plant and a purebred white-flowered pea plant would produce a(n) ______.
hybrid
Two key observations underlying natural selection are that members of a population vary in their ____ and that all species can produce more offspring than the environment can support.
inherited traits
The CORRECT sequence of events that occurs during transcription is ________.
initiation, elongation, termination
Non-coding DNA sequences are referred to as ________
introns
After an RNA molecule is transcribed from a eukaryotic gene, portions called __________ are removed and the remaining __________ are spliced together to produce an mRNA molecule with a continuous coding sequence.
introns and exons
After allowing phages grown with bacteria in a medium that contained 32P and 35S, Hershey and Chase used a centrifuge to separate the phage ghosts from the infected cell. They then examined the infected cells and found that theycontained _____, which demonstrated that _____ is the phage's genetic material.
labeled DNA ... DNA
Short segments of newly synthesized DNA are joined into a continuous strand by _____.
ligase
Using recombination data, it is possible to determine the location of genes on a chromosome. The result is _____.
linkage map
Infection by a virus increases the risk of developing which of the following forms of cancer?
liver lymphoma
What are the chances of surviving cancer after a diagnosis? This graph does not list those values, but they can be estimated by dividing the number of deaths by the number of diagnoses. This yields a percentage, with a lower number meaning greater survivability and a higher number meaning a greater risk of death. According to this graph, which of the following types of cancer is the deadliest?
lung
The ____ is a viral life cycle in which the virus inserts its genome into the genome of its host, where it may remain dormant for long periods.
lysogenic cycle
Cycle A is the _____ cycle and cycle B is the _____ cycle.
lytic and lysogenic
The ____ is a viral life cycle that results in bursting of the host cell.
lytic cycle
Which of the following does not occur during RNA processing?
mRNA attaches to the small subunit of a ribosome.
Which of the following is a correct statement about mRNA?
mRNA moves from the nucleus to the cytoplasm following RNA processing.
A particular gene does NOT constantly churn out the same protein at all times in every cell. This is true for two reasons. First, _____ can allow one gene to produce several different proteins. Second, genes are constantly being turned on and off through the process of _____.
mRNA processing ... gene regulation
Which of the following are applications of recombinant DNA technology?
making crops that are pest-resistant making proteins that are useful as medicines making bacteria that can clean up toxic waste
In a type of sexual selection often called ____, individuals of one sex (usually females) are choosy in selecting their mates. This choice is often based on the showy appearance or behavior of the male.
mate choice
Mendel's laws are based on the behavior of chromosomes during ________.
metaphase I and anaphase I of meiosis
A change in allele frequencies in a population over a span of generations is ____
microevolution
Changes in allele frequencies in a population over time is ____
microevolution
Generation-to-generation change in the allele frequencies in a population is _____.
microevolution
The phrase Darwin used to describe his broad theory of evolution is ''descent with ____.''
modification
A genetic cross involving parents that differ in a single character is called a
monohybrid cross
A mating between a purebred purple-flowered pea plant and a purebred white-flowered pea plant would be called a ________.
monohybrid cross
A process in which organisms with certain inherited characteristics are more likely to survive and reproduce than individuals with other characteristics is called __________.
natural selection
Darwin proposed a mechanism for how evolution occurs, which he called ____
natural selection
Evolution that occurs by ____ results in nonrandom reproductive success and adaptive change.
natural selection
In The Origin of Species, Darwin argued that the mechanism of descent with modification was ________.
natural selection
In gel electrophoresis DNA molecules migrate from _____ to _____ ends of the gel.
negative, positive
Crossing over, resulting in an increase in genetic variation, occurs between _____.
nonsister chromatids of homologous chromosomes
In the presence of a regulatory protein the lac operon is _____.
not transcribed
This is an image of a(n) _____.
nucleotide
Mendel formulated his principles of inheritance based on _____.
observations on the outcomes of breeding experiments. The underlying processes were unknown at the time.
Darwin inferred that those organisms with traits best suited to the environment tend to leave more ____ than other members of a population.
offspring
Incomplete dominance is a condition in which __________.
offspring have an appearance in between the phenotypes of the two parents
A gene that causes a cell to become cancerous is called a(n)
oncogene
How many active X chromosomes are there in each cell of a female mammal?
one
In an operon, the ______ acts as an on/off switch.
operator
Regulatory proteins bind to _____.
operator
In bacteria, what name is given to a cluster of genes with related functions, along with their DNA control sequences?
operon
In prokaryotic cells, related genes may be organized into ____, which can be turned on and off as a single unit.
operons
Which type of cancer has a genetic component and is associated with a STI?
ovarian
The best definition of a purebred plant is one that ________.
passes on the next generation only those traits identical to the parent
This is an image of a _____.
phage
The physical traits of an organism are called its
phenotype
The physical traits of an organism are called its _____.
phenotype
The letter A indicates a _____.
phosphate group
A supplemental appendix is to a book as a ____________ is to a bacterial chromosome.
plasmid
What can act as a vector to introduce new genes into a cell?
plasmids
The process of accurately amplifying a sample of DNA is called __________________________.
polymerase chain reaction
What type of infectious agent causes Creutzfeldt-Jakob disease in humans?
prion
Tumor-suppressor genes are important in the prevention of cancer because they __________.
produce gene products that prevent uncontrolled cell growth
Bacterial RNA polymerase binds to the ________.
promoter
A ____ is a viral genome that has inserted itself into the genome of its host.
prophage
Enzyme complexes that break down protein are called _____.
proteasomes
A ____ is made up of hundreds or thousands of smaller units called amino acids, attached to one another in long chains.
protein
Prions are infectious molecules that can cause brain diseases in several animals. What type of molecule is a prion?
protein
Protein-phosphorylating enzymes' role in the regulation of gene expression involves _____.
protein activation
One of the interesting conclusions from this project was that only about 1.5% of human DNA encodes for ____.
proteins
A normal gene that, if mutated, can lead to cancer is called a(n)
proto-oncogene
If an organism has two non-identical versions of a gene, the one that is not expressed in the organism is called the _____ allele.
recessive
The result of the following cross indicates the orange eyes are _____ black eyes.
recessive to
This genetic disorder causes red blood cells to assume an unusual shape and produce abnormal hemoglobin proteins.
sickle cell disease
A signal transduction pathway is initiated when a _____ binds to a receptor.
signal molecule
Cells communicate with one another via ________.
signal transduction pathways
"Sticky ends" are ________.
single-stranded ends of fragments of double-stranded DNA
Before a cell divides, it copies all of its chromosomes. While the two copies of a chromosome are attached they are called ____
sister chromatids
Gel electrophoresis separates pieces of DNA based on _________.
size
DNA replication occurs at an unbelievably fast rate. Once replication is complete, we can expect to find a _____ number of mistakes.
small
In colon cancer, a polyp is __________.
small benign tumor
Small lizards have difficulty defending their territory, but large lizards are more likely to be preyed upon by owls. Which type of selection would act on body size in these lizards under these conditions?
stabilizing selection
____ favors intermediate phenotypes, selecting against phenotypes at both ends of a range and reducing variation.
stabilizing selection
The anticodon of an incoming __________ molecule, carrying its amino acid, pairs with the mRNA __________ at the ribosome.
tRNA, codon
Homeotic genes are important for ________.
the development of an organism's body plan
Which anatomical features are homologous?
the forelimb of a dog and the forelimb of a cat
Genetic drift is a process based on _____.
the role of chance
During gel electrophoresis, DNA molecules are separated based on __________.
their length
A mutation occurs when _____.
there is a change in the DNA sequence of a gene
How many nucleotides make up a codon?
three
In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.
thymine and cytosine
DNA contains the nitrogenous base ________ instead of ________, which is found only in RNA.
thymine, uracil
What is the main function of the CRISPR-Cas9 system?
to alter the nucleotide sequences of specific genes in a living cell
As we now understand it, the Law of Independent Assortment applies _____.
to pairs of genes that are on different chromosomes, but NOT to pairs of genes that are close together on the same chromosome
A _____ is one particular variation of a character.
trait
RNA is produced from DNA via the process of _____
transcription
____is the first step of gene expression, during which a particular segment of DNA is converted into RNA.
transcription
tRNA molecules work to _____.
translate mRNA to produce a specific amino acid sequence
Proteins are produced from RNA via the process of ____
translation
Which of the following processes occurs in the cytoplasm of a eukaryotic cell?
translation
true or false: Bacteria act as microscopic protein factories.
true
true or false: Bacteria are the source of plasmids.
true