Chapter 16 & 17 Homework

If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides: 5' - ATGACTACGTGA - 3' Sort the following replicated DNA sequences by the type of point mutation each contains (frameshift, base substitution, or neither), as compared to the correct sequence shown above. You are being given a small sequence of the coding strand in this scenario.

A base substitution mutation can occur if the DNA polymerase inserts the wrong nucleotide base as it synthesizes a new strand of DNA. A frameshift mutation can occur if the DNA polymerase leaves out a nucleotide or adds an extra nucleotide to the sequence. Certain forms of cancer occur because of mutations in DNA sequences that are located in so-called mutational hotspots. These hotspots are locations in the DNA sequence where mutations occur more often than in other places.

Mutant N. crassa cells that cannot make arginine on their own must be supplied with arginine to grow. For the metabolic pathway shown in Figure 16.1, if a mutant lacked enzyme 2, would it still be able to grow if it were provided with (a) ornithine or (b) citrulline in its diet?

(a) No (b) Yes Citrulline, but not ornithine, can still be converted to arginine even if enzyme 2 is lacking.

How did the P site of the ribosome get its name?

It is where the polypeptide chain attached to the tRNA is transferred to the aminoacyl tRNA for peptide-bond formation.

The RNA segments joined to one another by spliceosomes are _____.

exons Exons are expressed regions.

In Figure 16.7b, what would be the base sequence of the mRNA and the amino acid sequence of the protein if the bottom DNA strand serves as the template for transcription?

mRNA: 5'AUGCUGGAGGGGGUUAGACAU3' Protein: Met-Leu-Glu-Gly-Val-Arg-His

A point mutation that results in the substitution of one amino acid for another within a protein is a ______.

missense mutation The majority of point mutations do not benefit the organism.

During RNA processing a(n) _____ is added to the 5' end of the RNA.

modified guanine nucleotide The 5' cap consists of a modified guanine nucleotide.

5' caps and 3' poly(A) tails of eukaryotic mRNAs ______.

protect mRNA from degradation and enhance translation Research has shown that mRNAs that have a cap and tail last longer in cells than mRNAs that don't.

Spliceosomes are composed of _____.

small RNAs and proteins Spliceosomes are complexes composed of small RNAs and proteins.

During transcription, in which direction is (1) RNA synthesized and in which direction is (2) the DNA template "read"?

(1) 5'—>3' (2) 3'—>5'

Where does translation take place?

Ribosome Translation, or protein synthesis, occurs at the ribosome.

Which nucleic acid is translated to make a protein?

mRNA mRNA is the message that is translated to make a protein.

During the elongation phase of translation, individual tRNAs move through the three sites of the ribosome in the following sequence _____.

A—>P—>E Aminoacyl-tRNAs (tRNAs carrying the next amino acid in the chain) enter at the A site, move to the P site after Peptide-bond formation, then Exit through the E site.

The direction of synthesis of an RNA transcript is _____.

5' —> 3' Nucleotides are added to the 3' end of RNA.

In the diagram below, the gray unit represents _____.

RNA polymerase. RNA polymerase untwists a portion of the DNA double helix.

Translation occurs in the _____.

cytoplasm Ribosomes, the sites of translation, are found in the cytoplasm.

At which site do new aminoacyl tRNAs enter the ribosome during elongation?

A-site This is the site at which new aminoacyl tRNAs that are complementary to the mRNA codon enter the ribosome.

Each codon shown below specifies an amino acid. For which one is it possible that a change in a single base could create a stop codon?

AAA Changing the first base from A—>U creates the stop codon UAA.

Which one of the following, if missing, would usually prevent translation from starting?

AUG codon

Codons are three-base sequences that specify the addition of a single amino acid. How do eukaryotic codons and prokaryotic codons compare?

Codons are a nearly universal language among all organisms.

In the diagram below, the two blue strands represent _____.

DNA DNA is a double helix.

What are the steps (in the correct order) that link a change in the base sequence of a gene to a change in the phenotype of an organism like a mouse or a human?

DNA—>RNA—>Protein This is the central dogma, which summarizes the flow of information in cells from DNA (genes) to proteins. For genes that encode RNAs that do not function as mRNAs, only the DNA—>RNA step occurs.

Which of these correctly illustrates the pairing of DNA and RNA nucleotides?

GTTACG CAAUGC In RNA, uracil takes the place of thymine.

When a base substitution mutation occurs, one nucleotide in a replicating DNA sequence is substituted for another, which results in the production of a mutant strand of DNA. The result of the mutation depends on how the substituted nucleotide base alters the string of amino acids coded by the mutant DNA. The three types of base substitution mutations are nonsense mutations, missense mutations, and silent mutations. Each type is defined by how it affects protein synthesis.

Label the four mutated DNA segments shown below according to the type of point mutation each represents. Use the codon table above to determine how each mutation would affect the amino acid coding for each segment. Drag the labels to their appropriate locations to identify the type of point mutation shown. Point mutations in DNA sequences can profoundly affect protein synthesis, or they can have no effect at all. Point mutations can be beneficial to an organism but are more commonly neutral or harmful.

During translation, nucleotide base triplets (codons) in mRNA are read in sequence in the 5' → 3' direction along the mRNA. Amino acids are specified by the string of codons. What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGGCAAGAAAA−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).

Met-Ala-Arg-Lys An amino acid sequence is determined by strings of three-letter codons on the mRNA, each of which codes for a specific amino acid or a stop signal. The mRNA is translated in a 5' → 3' direction.

Before a molecule of mRNA can be translated into a protein on the ribosome, the mRNA must first be transcribed from a sequence of DNA. What amino acid sequence does the following DNA nucleotide sequence specify? 3′−TACAGAACGGTA−5′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-His-Lys-Gly).

Met-Ser-Cys-His Before mRNA can be translated into an amino acid sequence, the mRNA must first be synthesized from DNA through transcription. Base pairing in mRNA synthesis follows slightly different rules than in DNA synthesis: uracil (U) replaces thymine (T) in pairing with adenine (A). The codons specified by the mRNA are then translated into a string of amino acids.

Just prior to the formation of a new peptide bond, the tRNA attached to the polypeptide chain occupies the _______ site of the ribosome.

P "P" stands for peptide.

Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates?

Ribonucleoside triphosphates have high potential energy, making the polymerization reaction exergonic. Because ribonucleoside triphosphates have three negatively charged phosphates close together, they have high potential energy, which is released during polymerization, making RNA synthesis spontaneous (ΔG<0) in cells.

Living organisms make and use three main types of ribonucleic acids (RNA) for their biological functions: ribosomal RNA (rRNA) messenger RNA (mRNA) transfer RNA (tRNA)

The cell uses three different types of RNAs to build proteins. rRNA is part of the ribosome, which is the site of protein synthesis. mRNA carries the genetic information from the DNA; the information specifies the sequence of amino acids in the new protein. tRNA interprets the information from the mRNA and brings the appropriate amino acids to the ribosome.

Which of the following steps occurs last in the initiation phase of translation?

The large ribosomal subunit joins the complex. This step occurs after the 5' mRNA is bound by the ribosome and the start codon is bound by an aminoacyl tRNA.

What is meant by translocation?

The ribosome slides one codon down the mRNA. Translocation is the process by which the ribosome slides down the mRNA so a new cycle of elongation can begin.

Indicate at which step of the transcription-translation process each type of RNA first plays a role. During which step of the transcription-translation process does each type of RNA first play a role? Drag each item to the appropriate bin.

The understanding that genetic information flows in one direction, from DNA to RNA to protein, became known as the central dogma of biology. The transcription-translation pathway is connected with the DNA→RNA→protein flow of information.During transcription, the DNA "message" is copied onto a molecule of mRNA.During translation, the information carried in the mRNA is transferred to molecules of tRNA to build a protein on the ribosomes.

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

a frameshift deletion at the beginning of the gene A frameshift mutation at the beginning of a gene would affect every codon after the point where the mutation occurred. During protein synthesis, incorrect amino acids would be inserted from the point where the frameshift mutation occurred on; the resulting protein would most probably be nonfunctional. For this reason, a frameshift mutation at the beginning of a gene is generally the most severe type of mutation.

During RNA processing a(n) _____ is added to the 3' end of the RNA.

a long string of adenine nucleotides A poly-A tail is added to the 3' end of the RNA.

A knock-out allele is ______.

a mutated form of a gene that does not make a functioning product Knock-out alleles are also known as null or loss-of-function alleles.

A promoter is ______.

a sequence in DNA that brings RNA polymerase near the site for transcription. The promoter is upstream of the DNA to be transcribed.

You can tell this diagram is showing transcription rather than replication because ...

only one strand is being used as template AND the product contains U.

In the diagram below, the green unit represents _____.

the promoter. The promoter is the region of DNA at which the process of transcription begins.

Beginning within the nucleus, the first step leading to the synthesis of a polypeptide is _____.

transferring of information from DNA to messenger RNA Transcription is the first of the two main steps of protein synthesis.

The process of using the information in mRNA to synthesize a protein is ______.

translation. The message in the mRNA must be translated into a protein.