Final Exam AP Biology
5.) Muscle cells differ form nerve cells mainly because they... A.) Contain different genes B.) Express different genes C.) Use different genetic codes D.) Have unique ribosomes E.) Have different chromosomes
B.) Express different genes.
60.) A scientist adds a chemical to a culture o dividing cells in order to disrupt DNA replication. The replicated DNA produced by the cells is double-stranded but sections of it lack covalent bonds between adjacent nucleotides. Which of the following claims is best support by the data? A.) The chemical prevents the formation of RNA primers B.) The chemical inhibits DNA ligase C.) The chemical blocks DNA polymerase D.) The chemical disrupts hydrogen bonding
B.) The chemical inhibits DNA ligase
1.) Humans produce sweat as a cooling mechanism to maintain a stable internal temps. Which of the following best explains how the properties of water contribute to this physiological process? A.) The high specific heat capacity of water allows the body to absorb a large amount of excess heat energy B.) The high heat of vaporization of water allows the body to remove excess heat through a phase change of water from liquid to gas C.) The high surface tension of water contributes to the psychical process y which water leaves the body D.) The high melting temperature of water allows the body to remove excess heat through a phase change of water from solid liquid
B.) The high heat of vaporization allows the body to remove excess heat through phase change of water from liquid to gas
3.) BLANK would be most likely to have a harmful effect on an organism... A.) A nucleotide-pair substitution B.) A deletion of three nucleotide near the middle of a gene C.) A single nucleotide insertion downstream of, and close to, the start of the coding sequence D.) A single nucleotide deletion near the end of the coding sequence E.) A single nucleotide deletion in the middle of an intron
C.) A single nucleotide insertion downstream of, and close to, the start of the coding sequence.
8.) CRISPR-Cas9 is a type of genetic medicine. Which of the following is a brief description of how this procedure works? A.) CRISPR allows scientists to change cell's DNA at a precise location B.) CRISPR binds to regulatory proteins that turn the transcription of genes on or off C.) CRISPR targets small sections of mRNA and destroys them D.) CRISPR interacts directly with disease causing proteins and blocks their negative effects
A.) CRISPR allows scientists to change a cell's DNA at a precise location.
2.) Which of the following is not true of a codon? A.) It extends from one end of tRNA molecule B.) It may code for the same amino acid as another codon C.) It never codes for more than one amino acid D.) It consists of three nucleotide E.) It is the basic unit of the genetic code
A.) It extends from one end of tRNA molecule
56.) Which of the following is the strongest evidence supporting the endometriosis hypothesis? A.) Mitochondria have their own DNA and divide independently of the cell B.) Mitochondria can carry out hydrophilic reactions on organic molecules C.) Mitochondria have a highly folded membrane D.) Mitochondria are found in a both plant and animals
A.) Mitochondria have their own DNA and divide independently of the cell
2.) A student placed a semipermeable membrane inside a U-shaped channel with two chambers, as shown. The membrane permits the movement of water but not salt. The student wants to vary the rate of osmosis that occurs across the membrane. Which of the following experimental designs will result in the fastest net rate of water movement into chamber A? A.) Placing salt water in chamber a and distilled water in chamber b B.) Placing distilled water in both chambers C.) Placing distilled water in chamber a and salt water in chamber b D.) Placing salt water in both chambers
A.) Placing salt water in chamber A and distilled water in chamber B
4.) If a particular operon encodes enzymes for making an essential amino acid and is regulated like the trp operon, then... A.) The amino acid acts as corepressor B.) The enzyme produced are called inducible enzymes C.) The repressor is active in the absence of the amino acid D.) The amino acid inactivates the repressor E.) The amino acid turns on transcription of the operon
A.) The amino acid acts as corepessor
40.) which of the following of most likely effect of a mutation in the gene coding for a DNA repair enzyme? A.) The cell containing the mutation will divide more frequently because the cell cycle checkpoints will not function properly B.) Mutation will accumulate more quickly because the cell will not be able to fix errors in replication C.) The mutated gene will not be transcribed because RNA polymerase cannot transcribe mutated DNA D.) The cell will immediately undergo apoptosis so that mutated DNA is not replicated in future rounds of cell division
A.) The cell containing the mutation will divide more frequently because the cell cycle checkpoints will not function properly
Arctic foxes typically have a white coat in the winter. In summer, when there i no snow on the ground, the foxes typically have a darker coat. Which of the following is mot likely responsible for the seasonal change in coat color?
A.) The decrease in the amount of daylight in winter causes a change in gene expression, which results in the foxes growing a lighter appearing coat
60.) Which of the following best explains why ligase is required for DNA replication? A.) The lagging strand cannot be replicated continuously, and ligase is needed to join fragments B.) Ligase forms the hydrogen bonds between complementary bases in the two strands of DNA C.) Ligase facilitates the binding of RNA polymerase region D.) Ligase enables the newly synthesized DNA to twist into a double helix.
A.) The lagging strand cannot be replicated continuously, and ligase is needed to join fragments
The cells lining the respiratorty tract of pigs have receptors for both avian and human influenza virueses. Based on the model above, which of the following best describes the orgin of the new strin of human influenza virus?
A.) The new viral strian inherited a mixture of genetic material from both avain influnza virus and human influnza virus.
22.)Ultraviolet radiation can damage DNA by breaking weak bonds. Which of the following best explains how this occurs? A.) UV radiation disrupts the double helix structure by breaking the covalent bonds between the nitrogenous base pairs. B.) UV radiation disrupts the double helix structure by breaking the hydrogen bonds between the nitrogenous base pairs C.) UV radiation is able to break DNA strands in two by breaking covalent bonds between the sugar-phosphate backbone molecules D.) UV radiation is able to break DNA strands in tow by breaking hydrogen bonds between the sugar phosphate backbone molecules.
A.)UV radiation disrupts the double helix structure by breaking the covalent bonds between the nitrogenous base pairs
33.) Which of the following is evidence that eukaryotes and prokaryotes share a common ancestor? A.) All eukaryotes and prokaryotes contain linear DNA B.) All eukaryotes and prokaryotes contain a ribosomes C.) All eukaryotes and prokaryotes use organic molecules as an energy source D.) All eukaryotes and prokaryotes are capable of mitosis
B.) All eukaryotes and prokaryotes contain a ribosomes
9.) Which of these genetic medicine techniques utilizes viruses as vectors to deliver therapeutic genes? A.) CRISPR-Cas9 B.) Gene therapy C.) Gene switches D.) Exon skipping
B.) Gene therapy
11.) The hormone prolactin has varying effects in many different animal species. All vertebrates produce prolactin, which is involved in signal transduction pathways. In mamals, prolactin stimulates the production of milk in mammary glands. In fish prolactin plays an important role in osmoregulation. In birds, prolactin is involved in lipid metabolism. Which of the following best explains the presence of prolactin in various vertebrae species? A.) Through all vertebrates produce protactinium, its varies uses indicate it arose as result of convergent evolution and not as a result of common ancestry B.) Prolactin is a homologous hormone because it has a common origin but different functions in various species C.) Prolactin will bind only to intracellular receptors in animal species with phospholipid bilayers so its effects are varied in different species D.) Because of different receptors activating different signal transduction pathways within the same species, it is likely that prolactin production is a trait with highly selective pressure.
B.) Prolactin is a homologous hormone because it has a common origin but different functions in various species.
21.) Oncogenes are genes that can cause tumor formation as result of particular mutation. Which of the following potential therapies would be most effective at preventing the expression of an organism? A.) Reducing the number of ribosomes in the cell to prevent the creation of the oncogene's protein B.) Blocking membrane bound receptors of transcription factors C.) Introduction a chemical that binds to transcription factors associated with the oncogene's promoter D.) Producing additional transcription factors for tumor suppressor genes in the cell
C.) Introducing a chemical that binds to transcription factors associated with the oncogene's promoter
During the process of gene expression, a protein complex called the spliceosome is involved in a step called RNA splicing. What function does splicesome have in this step? A.) It binds to the DNA and attaches complementary nucleotides to the growing chain B.) It catalyzes the conversion of polypeptides to amino acids C.) It binds to the transcription to remove introns and splice together exons D.) it serves as a template for mRNA replication
C.) It binds to the transcript to remove introns and splice together exons.
30.) Which of the following best illustrated the flow of information required for the synthesis of proteins encoded in the genome of retrovirus? A.) DNA-RNA-Protein B.) RNA-DNA-Protein C.) RNA-DNA-RNA-Protein D. DNA-RNA-DNA-Protein
C.) RNA-DNA-RNA-Protein
1.) In his work with pneumonia-causing bacteria and mice, Griffith found that... A.) The protein coat form pathogenic cells was able to transform non pathogenic cells B.) Heat killed pathogenic cells caused pneumonia C.) Some substance from pathogenic cells was transferred to non pathogenic cells, making them pathogenic D.) The polyacrylamide coat of bacteria caused pneumonia E.) Bacteriologist injected DNA into bacteria
C.) Some substance from pathogenic cells was transferred to non pathogenic cells, making them pathogenic
28.) Which of the following describes the most direct effect of a mutation in the DNA that encodes a cell's rRNA? A.) The cell's ability to transport the amino acids needed for translation will be reduced. B.) The cell's ability to transcribe RNA transcripts that will be translated will be reduced C.) The cell's ability to properly assemble ribosomes and initate translation will be reduced D.) The cell's ability to modify proteins after they have been assembled will be reduced
C.) The cell's ability to properly assemble ribosomes and initate translation will be reduced
57.) Which of the following best explains how the expression of a eukaryotic gene encoding a protein will differ if the gene is expressed in a prokaryotic cell instead of in a eukaryotic cell? A.) No transcription will be made, bc eukaryotic DNA cannot be transcribed by prokaryotic RNA polymerase B.) The protein will have a different sequence of amino acids, bc prokaryotes use a different genetic code C.) The protein will be made but will not function, bc prokaryotes cannot remove interons D.) The protein will not be made, because prokaryotes lack the ribosomes necessary for translation.
C.) The protein will be made but will not function, bc prokaryotes cannot remove interons
11.) When DNA replicates, each strand of the original DNA molecule is used as a template for the synthesis of a second, complementary strand. Which of the following figures most accurately illustrates enzyme-mediated synthesis of the new DNA at a replication fork?
D (the one with the top arrows going up and bottom arrow for up)
Lactose digestion in E.coli begins with it's hydrolysis by the enzyme B-galactosidase. The gene encoding v-galactosidase, lacZ, is part of coordinately regulated operon contianing other genes required for lactose utlization. Which of the following figures correctly depicts depics the interactions at the lac operon when lactose is not being utilized?
D the one where the operator is the repressor protein.
6.) DNA in one of our brain cells is... A.) Most of the DNA codes for protein B.) The majority of genes are likely to be transcribed C.) Each gene lies immediately adjacent to an enhancer D.) It is the same as the DNA in one of your heart cells E.) Many genes are grouped into operon- like clusters
D.) It is the same as the DNA in one of your heart cells
Steroid hormones such as testerone, pass through the plasma membrane and bind to an intracellular protein as shown in the diagram below. The hormone-receptor complex then enters the nucleus, where it interacts with DNA to promotes transcription of a specific gene. Based on the info presented, which of the following will also occur in response to steroid signaling?
D.) Production of a specific mRNA will increase as a result of the binding of the hormone receptor complex to the DNA.
10.) Which of the following explains the concept of the "Central Dogma" of molecular biology? A.) The flow of energy form autotroph to hetrotroph B.) The flow of genetic information from parent to offspring C.) The flow of genes from virus to host cell D.) The flow of genetic information from DNA to RNA to protein
D.) The flow of genetic information form DNA to RNA to protein
20.) Figure 1 shows the inheritance of a particular genetic condition in three generations of one family. Which of the following best explains the observed pattern of inheritance? A.) The condition is passed randomly because of the independent assortment of chromosomes B.) The condition is passed from fathers to sons via a Y-linked gene C.) The condition is passed from mothers to son via x-linked gene D.) The condition is passed from mothers to offspring via mitochondria gene
D.)The condition is passed from mothers to offspring via a mitochondria gene.
Testosterone oxido-reductase is a liver enzyme that regulates testosterone levels in alligators. One study compared testosterone oxido reductase activity between male and female alligators form LAke Woodruff, a relatively pristine environment, and from Lake Apopka, an area that has suffered severe contamination, The graph above depicts the findings of that study. The data in the graph best support which of the following claims?
Environmental contamination reduces total testosterone oxido-reductase activity in females.
The trp operon is coordinately regulated group of genes that are required for tryptophan biosynthesis in E.Coli. Based on the figure above, which of the following correctly describes the regualtion of the trp operon?
In the presence of trptophan, the repressor is active and binds to the trp operator, preventing RNA polymerase from transcribing the operon.
which of the following best describes an event during step 2 simplified model above? Step 1- DNA to pre-mrna step 2- pre-mrna to mrna step 3 mrna to prtoein
Noncoding sequence are removed from a newly synthesized rna molecule
12.) The sequences for two short fragments of DNA are shown above. Which of the following is one way in which these two segment would differ? Segment 1 5' -ATATGAGTAGT-3' 3'- TATACTATCA-5' Segment 2 5'- GCGCAGACGAC-3' 3'-CGCGTCTGCTG-5' A.) Segment 1 would not code for mRNA because both strads have T, a base not found in RNA B.) Segment 1 would be more soluble in water than segment 2 because it has more phosphate groups C.) Segment 1 would become denatured at a lower temperature than would segment 2 because A-T base pairs have to hydrogen bonds whereas G-C base pairs have three D.) Segment 1 mus tbe from a prokaryote because it has predominately A-T base pairs
Segment 1 would become denatured at a lower temperature than would segment 2 because A_T base pairs have two hydrogen bonds whereas G-C base pairs have two hydrogen bonds whereas G_C base pairs have three.
5'GACCGCAUGGUGACGAAAUUUGGCAUUAA3' BAsed on the universal genetic cod, which of the following represents the correct polypeptide that will result from translation of the mRNA molecule shwon, begining with the first available start codon?
Val-thr-lys-phe-gly-his
10.) Protein x activates gene expression only in cells exposed to a specific signaling molecule. In a study, researchers determined the extracellular location of protein x in cultured cells both before and after exposing the cells to the signaling molecule. The results of the study are shown in the diagram. Based on the results, which of the following best describes what protein x is? A.) Protein x is an RNA splicing enzyme B.) Protein X is a cell membrane receptor protein C.) Protein X is a transcription factor D.) Protein X is a hormone
c.) Protein x is a transcription factor.
During the infection cycle for a typical retrovirus, such as HIV, which uses RNA as genetic material, the genetic variation in the resulting population of the new virus particles is very high because of...
errors introduced in the DNA molecule through reverse transcription.
