Microbio quiz 6

¡Supera tus tareas y exámenes ahora con Quizwiz!

viruses can be described as

acellular

Steps in viral replication

adsorption, penetration, synthesis, maturation, release

The following components are found on some but not all viuses. OPTIONS: capsid, capsule, envelope, enzymes, genome

capsid, enzyme, envelope

A Virus is always made up of: OPTIONS: capsid, capsule, envelope, enzymes, genome

capsid, genome

select the ways that describe how an animal virus can enter or penetrate a host cell.

endocytosis, membrane fusion

a virulent virus has a lysogenic relationship with the host cell while a temperate virus has a lyric infection relationship with the host cell. T/F

false

once injected into a host cell, the genome of a virus with negative sense rna can be directly read and translated into protein by the host cell ribosomes. T/F

false

uncoating is a necessary step for bacteriophage, but not animal viruses T/F

false

what is the protein that would result from this piece of dna? ACGCATACCGTTAGGAACTTCTGACTCGC

met-ala-lle-leu-glu-asp

which two steps in bacteriophage replication use the enzyme lysozyme

penetration, release

a retrovirus uses a rna dependent dna polymerade called what to make dna from an rna template?

reverse transcriptase

which step of replication differs the most between an animal rna and an animal dna virus?

synthesis

viruses have a genome made up of rna or dna, but not both rna and dna T/F?

true

if an organism had a genome (dna) made up of 60000 base pairs, and you know that there are 18000 Cytosine, how many Thymine are there?

42000


Conjuntos de estudio relacionados

Module 04: Security and Safety Quiz

View Set

Gero Mini exam 5 Practice Questions

View Set

Commercial Aviation Safety Test 1

View Set

SENSE Module #9 Inspection and Testing Principles

View Set