Microbio quiz 6
viruses can be described as
acellular
Steps in viral replication
adsorption, penetration, synthesis, maturation, release
The following components are found on some but not all viuses. OPTIONS: capsid, capsule, envelope, enzymes, genome
capsid, enzyme, envelope
A Virus is always made up of: OPTIONS: capsid, capsule, envelope, enzymes, genome
capsid, genome
select the ways that describe how an animal virus can enter or penetrate a host cell.
endocytosis, membrane fusion
a virulent virus has a lysogenic relationship with the host cell while a temperate virus has a lyric infection relationship with the host cell. T/F
false
once injected into a host cell, the genome of a virus with negative sense rna can be directly read and translated into protein by the host cell ribosomes. T/F
false
uncoating is a necessary step for bacteriophage, but not animal viruses T/F
false
what is the protein that would result from this piece of dna? ACGCATACCGTTAGGAACTTCTGACTCGC
met-ala-lle-leu-glu-asp
which two steps in bacteriophage replication use the enzyme lysozyme
penetration, release
a retrovirus uses a rna dependent dna polymerade called what to make dna from an rna template?
reverse transcriptase
which step of replication differs the most between an animal rna and an animal dna virus?
synthesis
viruses have a genome made up of rna or dna, but not both rna and dna T/F?
true
if an organism had a genome (dna) made up of 60000 base pairs, and you know that there are 18000 Cytosine, how many Thymine are there?
42000
